Phenotypic Mutation 'Vermeil'

• Allele: Vermeil
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 124,709,913 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Ptpn6
• Gene Name: protein tyrosine phosphatase, non-receptor type 6
• Synonym(s): Hcph, SHP-1, hcp, Ptp1C
• Chromosomal Location: 124,697,670-124,715,672 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Methionine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000004377] [ENSMUSP00000108103] [ENSMUSP00000129124] [ENSMUSP00000133747] [ENSMUSP00000133991]
• AlphaFold: P29351
• SMART Domains: Protein: ENSMUSP00000004377; Gene: ENSMUSG00000004266

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000108103; Gene: ENSMUSG00000004266; AA Change: V2M

Domain	Start	End	E-Value	Type
SH2	2	85	4.05e-28	SMART
SH2	108	200	1.45e-29	SMART
PTPc	243	517	7.51e-131	SMART
low complexity region	569	579	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
  (Using ENSMUST00000112484)
• SMART Domains: Protein: ENSMUSP00000129124; Gene: ENSMUSG00000004266

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000133747; Gene: ENSMUSG00000004266; AA Change: V2M

Domain	Start	End	E-Value	Type
SH2	2	64	2.35e-6	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
  (Using ENSMUST00000173647)
• SMART Domains: Protein: ENSMUSP00000133991; Gene: ENSMUSG00000004266

Domain	Start	End	E-Value	Type
Pfam:SH2	1	40	3.5e-6	PFAM
SH2	69	161	1.45e-29	SMART
PTPc	204	478	7.51e-131	SMART
low complexity region	530	540	N/A	INTRINSIC

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.0827
• Is this an essential gene?: Possibly nonessential (E-score: 0.481)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:37 PM by Diantha La Vine
• Record Created: 2018-04-05 12:21 PM by Bruce Beutler
• Record Posted: 2018-04-09
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_013545 (variant 1), NM_001077705 (variant 2); MGI:96055

Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU)(4) Gene trapped(3) Spontaneous (4) Targeted(5)

Phenotypic Description

Figure 1. Vermeil mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Vermeil mice exhibit decreased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Vermeil mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Vermeil mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Vermeil mice exhibit decreased frequencies of peripheral naïve CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Vermeil mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Vermeil mice exhibit increased CD44 expression on peripheral blood CD8 T cells . Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Vermeil mice exhibit reduced IgD expression on peripheral blood B cells . Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Vermeil mice exhibit reduced IgM expression on peripheral blood B cells . Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Vermeil phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5319, some of which showed reduced frequencies of B cells (Figure 1), IgD+ B cells (Figure 2), IgM+ B cells (Figure 3), B1 cells (Figure 4), and naïve CD8 T cells in CD8 T cells (Figure 5) with concomitant increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 6), all in the peripheral blood. Some mice showed increased CD44 expression on peripheral blood CD8 T cells (Figure 7) as well as reduced IgD expression (Figure 8) and IgM expression (Figure 9) on peripheral blood B cells.

Retina phenotypes observed in pedigree R5319 are attributed to the co-localizing mutation in Cacna2d2 (see the record for Steveo).

Nature of Mutation

Figure 10. Linkage mapping of increased central memory CD8 T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 66 mutations (X-axis) identified in the G1 male of pedigree R5319. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 6: Cacna2d4 and Ptpn6. The mutation in Ptpn6 was presumed causative as other Ptpn6 alleles exhibit similar phenotypes to that in Vermeil (see MGI). The mutation in Ptpn6 is a G to A transition at base pair 124,732,950 (v38) on chromosome 6, or base pair 5,760 in the GenBank genomic region NC_000072. The strongest association was found with an additive model of inheritance to the normalized frequency of peripheral blood central memory CD8 T cells, wherein four variant homozygotes departed phenotypically from six homozygous reference mice and 10 heterozygous mice with a P value of 4.62 x 10^-7 (Figure 10).  

The mutation corresponds to residue 205 in the mRNA sequence NM_013545 within exon 1 of 16 total exons.

202 ATGGTGAGGTGGTTTCACCGG 2   -M--V--R--W--F--H--R-

The mutated nucleotide is indicated in red.  The mutation results in a valine to methionine substitution at position 2 (V2M) in variant 1 of the SHP1 protein.

Protein Prediction

Figure 11. Domain structure of SHP1. The position of the Vermeil mutation is indicated. Other mutations found in SHP1 are noted in red. Click on the mutations for more specific information.

Ptpn6 encodes SHP1, a Src-homology 2 (SH2) domain-containing cytoplasmic protein tyrosine phosphatase. SHP1 has 4 isoforms. Three isoforms of SHP1 contain variations in their N-termini; the fourth isoform is a longer form with an extended C-terminus. SHP1 contains two tandem N-terminal SH2 domains (residues 1-108 and 116-208), a central catalytic domain (residues 270-532), and a C-terminal tail [Figure 11; (1), discussed in (2)]. The C-terminal tail contains multiple sites for tyrosine and serine phosphorylation. The Vermeil mutation results in a valine to methionine substitution at position 2 (V2M) within the first SH2 domain. The Vermeil mutation is predicted to affect all of the SHP1 isoforms.

For more information on Ptpn6, please see the record for spin.

Putative Mechanism

The phenotype of the Vermeil mice suggests decreased SHP1 function. The phenotype of Vermeil animals is less severe than the spin (3) and spin2 phenotypes as foot lesions were not observed in the Vermeil mice. The foot lesions observed in the spin mice were associated with the development of splenomegaly and an increased number of erythroid and myeloid cells in the spleen, as well as a reduction in mature B cell numbers in the peripheral blood, spleen and bone marrow. Spontaneously occurring motheaten (me) and viable motheaten (me-v) mutants are immunodeficient and exhibit multiple defects stemming from increased inflammation, including alopecia, glomerulonephritis, dermatitis, inflammation of the paws, and interstitial pneumonitis which ultimately causes death by 3 and 9 weeks of age in Ptpn6^me/me and Ptpn6^me-v/me-v mice, respectively. The phenotype of the Vermeil animals is significantly less severe than the Ptpn6^me-v allele, which encodes a SHP1 protein with approximately 20% catalytic activity (4).  It is likely that the SHP1 protein encoded by the Vermeil allele retains catalytic activity that is greater than 20% of normal, and greater than the SHP1 protein encoded by the spin and spin2 alleles.

Primers

PCR Primer
Vermeil_pcr_F: AAGTCACCCTGGTTCTTGCG
Vermeil_pcr_R: GTTCTAGTGAGTTCCCCTAAGG

Sequencing Primer
Vermeil_seq_F: GTTCTTGCGGCTGGGCC
Vermeil_seq_R: TGTCTCCGCCCTGCTGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 428 nucleotides is amplified (chromosome 6, - strand):

1   gttctagtga gttcccctaa ggggtcggcc gcgccccttc ctgtctccgc cctgctggct
61  gccccaggcc agtagagtgg tagcccgggg agcaggactg caggttggct ttggaggcct
121 gggctctgag agccttgcct gaggctcatc tctagagttt gtacgtgcct gcccagacaa
181 actgttccct ccacattttc tgcagccaat tcagtgagaa ccccaggatg gtgaggtaag
241 ggcctgggac ccatggagga taggaaacaa gggtggctgg agccctgggg atattccctc
301 actgccctgt gcacttttag gtggtttcac cgggacctca gcgggcctga tgcagagacc
361 ctgctgaagg gccggggagt ccctgggagc ttcctggctc ggcccagccg caagaaccag
421 ggtgactt

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Yang, J., Liu, L., He, D., Song, X., Liang, X., Zhao, Z. J., and Zhou, G. W. (2003) Crystal Structure of Human Protein-Tyrosine Phosphatase SHP-1. J Biol Chem. 278, 6516-6520.

  2. Poole, A. W., and Jones, M. L. (2005) A SHPing Tale: Perspectives on the Regulation of SHP-1 and SHP-2 Tyrosine Phosphatases by the C-Terminal Tail. Cell Signal. 17, 1323-1332.

  3. Croker, B. A., Lawson, B. R., Berger, M., Eidenschenk, C., Blasius, A. L., Moresco, E. M., Sovath, S., Cengia, L., Shultz, L. D., Theofilopoulos, A. N., Pettersson, S., and Beutler, B. A. (2008) Inflammation and Autoimmunity Caused by a SHP1 Mutation Depend on IL-1, MyD88, and a Microbial Trigger. Proc Natl Acad Sci U S A. 105, 15028-15033.

  4. Kozlowski, M., Mlinaric-Rascan, I., Feng, G. S., Shen, R., Pawson, T., and Siminovitch, K. A. (1993) Expression and Catalytic Activity of the Tyrosine Phosphatase PTP1C is Severely Impaired in Motheaten and Viable Motheaten Mice. J Exp Med. 178, 2157-2163.