Allele | achtung2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 58,438,985 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | G ⇒ T (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Edar | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | ectodysplasin-A receptor | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 58,436,611-58,511,476 bp (-) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008] PHENOTYPE: Mutations in this gene produce abnormalities of the hair,teeth and some exocrine glands. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Proline changed to Glutamine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9R187 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000003312 Gene: ENSMUSG00000003227 AA Change: P349Q
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.187) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(7) : Transgenic(2) Spontaneous(4) Chemically induced(1) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Embryos | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | none | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-04-24 5:29 PM by Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2008-02-05 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description | The achtung2 phenotype was identified among G3 ENU-mutagenized mice. Achtung2 mice are characterized by a lack of fur behind the ears, an unusually stiff posturing of the tail, a crook at the tip of the tail, and abnormally short teeth. The animals resemble achtung or tabby/Sleek/downless mice, which have mutations in components of the EDAR signaling pathway. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | The achtung2 mutation corresponds to a C to A transversion at position 1305 of the Edar transcript on Chromosome 10, in exon 12 of 12 total exons.
1289 AGCCCCACCGAGTTGCCGTTTGACTGCCTTGAG
343 -S--P--T--E--L--P--F--D--C--L--E-
The mutated nucleotide is indicated in red lettering.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
The achtung2 mutation results in the substitution of proline 349 by glutamine. This residue is located just N terminal to the death domain.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | RT-PCR analysis detects human EDAR transcript in embryonic and fetal skin at 11-15 weeks estimated gestational age, and in a 42-53 day old craniofacial cDNA library (3). Consistent with these data, mouse Edar transcript is detected in basal cells of the epidermis, where it is uniformly distributed before follicle initiation (~embryonic day 13) and subsequently elevated and restricted in follicle epithelial cells (~embryonic day 15-17) (1;4). EDAR is also detected in lacrimal, mammary, and salivary glands (7). Surprisingly, when expressed in 293A cells, EDAR protein is primarily expressed intracellularly, a localization that has been reported for other TNF receptors (8). It was postulated that EDAR may be delivered to the cell surface in a regulated manner (8).
In humans, Northern blot analysis also detects EDAR transcript in fetal kidney and lung (3).
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background | The four mutant mouse phenotypes Tabby (Tb), downless (dl), Sleek (Sl) and crinkled (cr), first reported in the 1950s, are characterized by lack of hair on the tail and behind the ears, lack of or abnormal morphology of incisors, a reduced number of vibrissae, and occasionally a kinked tail tip [(9-11) and reviewed in (7)]. Further study demonstrated that sweat glands (normally on the footpads), lacrimal, Meibomian and submandibular glands, and three of four types of mouse hair, are lacking in these mutants (7). Human patients also develop a similar syndrome, hypohidrotic (or anhidrotic) ectodermal dysplasia (HED), which may be transmitted in an autosomal dominant (OMIM #129490), autosomal recessive (OMIM #224900), or X-linked recessive (OMIM #305100) manner. Humans with HED typically have missing or sparse hair, missing or misshapen teeth, and absent or reduced ability to sweat. The reduced ability to sweat can cause hyperthermia, and results in a 30% mortality rate in children up to age 2 if the condition is not recognized (12). HED patients also have dry skin, eyes, airways and mucous membranes. Recently, ocular surface abnormalities (corneal lesions, inflammation) likely due to a lack of Meibomian glands were reported in both human HED patients and in Tabby mice (13;14).
Mutations in EDA (15), EDAR (3) and EDARADD (16) are now known to cause HED in humans, as well as the Tb (17;18), dl or Sl (1), and cr (16;19) phenotypes, respectively, when the orthologous genes are mutated in mice. In humans, mutations of the X-linked EDA gene cause the majority of cases of HED. Male patients display a similar severity of phenotype, but heterozygous females with EDA mutations vary considerably in their symptoms due to varying levels of X-inactivation of the chromosome containing the mutated gene (20;21). Mutations in EDAR account for approximately 25% of cases, and can cause both autosomal dominant or recessive forms of HED (22;23). As in humans, Eda is an X-linked gene in mice, and female Agouti (A) mice (normally with light/yellow hair) heterozygous for Tb, in contrast to hemizygous males, grow “tabby” colored fur (containing striping of variable degree) in a mosaic pattern, giving an appearance of transverse stripes of light-colored normal and dark hair (9;36). Loss of yellow pigment results in black hair in areas of skin containing the mutation in these mice (36). The underlying mechanism by which Eda affects pigmentation in A mice is unknown, and interestingly, no pigmentation defects have been reported in humans with EDA mutations. EDA (ectodysplasin), EDAR and EDARADD (EDAR-associated death domain) form the ligand, receptor and adaptor proteins, respectively, of a TNF-related signaling pathway specific to the development of so-called skin appendages, ectoderm-derived tissues including hair follicles, nails, teeth and exocrine glands in mammals.
The ligand for EDAR, EDA, is a trimeric type II transmembrane protein (extracellular C terminus) with extracellular collagen and TNF domains (24). Cleavage by furin near the collagen segment releases soluble EDA to bind to EDAR (25). The gene encoding EDA is alternatively spliced to form several different transcripts [at least six in humans (26) and nine in mice (27)]. The two longest isoforms, EDA-A1 (391 aa) and EDA-A2 (389 aa), account for approximately 80% of the total EDA transcripts in mouse keratinocytes (27), and appear to be the functional forms (26). EDA-A1 and EDA-A2 differ by only two amino acids in the receptor-binding region of the protein: E308 and V309 are lacking in EDA-A2 (4). Strikingly, this two amino acid difference accounts for an absolute specificity of EDA-A1 and EDA-A2 for different receptors, EDAR and XEDAR, respectively (4). As mentioned above (Protein Prediction), the third CRD of EDAR is thought to recognize distinct structural features conferred by the presence of E308 and V309 in EDA-A1, as is the third CRD of XEDAR for structural features of EDA-A2 (6).
Transfection of EDAR into 293E cells results in dose-dependent activation of NF-κB, and this response is drastically reduced when cells are transfected with mutant forms of EDAR containing the dl mutation or lacking the death domain (4;30). In vivo, loss-of-function mutations in the human or mouse IKK complex subunit IKKγ/NEMO result in HED (along with immunodeficiency) due to impaired NF-κB signaling (see panr2) (31;32). Mice expressing a constitutively active form of IκBα develop a phenotype similar to Tabby and downless (33). Together, the data suggest that the TRAF6/TAK1/TAB2 complex activates the IKK complex to phosphorylate IκB, which then releases NF-κB for translocation to the nucleus and activation of gene expression (16;29;31;34). Interestingly, although XEDAR signaling can also activate NF-κB in vitro (4), it appears that XEDAR has no role in skin appendage development, as XEDAR-deficient mice have normal ectodermal-derived organs (35). Troy, the third EDAR family member, is also expressed in skin, including hair follicles, and activates NF-κB when overexpressed in 293T cells (5). However, an ENU-induced mouse mutant of Troy that is unable to activate NF-κB has normal hair follicles, hair shafts, hair type composition and sweat glands (2).
The downstream targets of EDAR signaling are reported to include proteins of the Wnt, Sonic hedgehog (Shh), bone morphogenetic protein (BMP) and lymphotoxin- β (LTβ) pathways, which were identified by comparative gene expression analysis of Tabby and wild type skin [reviewed in (2)]. The specific role of these pathways in skin appendage development and the mechanisms by which they interface with EDAR signaling not well understood.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The achtung2 mutation results in the substitution of proline 349 by glutamine. This residue is located just outside the death domain (aa ~356-431) (1). Since proline residues typically facilitate kinks in polypeptide secondary structure, its substitution in achtung2 mice may disrupt such folding in this region of the protein. Aberrant folding of the death domain may prevent recruitment and subsequent signaling by EDARADD. Several EDAR mutations causing HED in humans or mice disrupt the function of the death domain. For example, the dl mutation is an E to K point mutation of residue 379, within the death domain, and the Sl mutation truncates EDAR just before the death domain (1). It appears that most HED-causing mutations in human EDAR occur within either the death domain or the ligand binding domain (3;22).
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Achtung2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.
Primers for PCR amplification
Ach2(F): 5’- TCCCAACCTCAGCTTTTAGCAGTG -3’
Ach2(R): 5’- GTCCAAGACAACTCTTCAGGACGC -3’
PCR program
1) 94°C 2:00
2) 94°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C ∞
Primers for sequencing
Ach2_seq(F): 5’- GTGTACTAGCTCTGGACTTAACATC -3’
Ach2_seq(R): 5’- TGCACCAACTTTGTGAGCAG -3’
The following sequence of 684 nucleotides (from Genbank genomic region NC_000076 for linear DNA sequence of Edar) is amplified:
72167 tccc aacctcagct
72181 tttagcagtg tactagctct ggacttaaca tcaaagtcac gttgactttt gaataccgaa 72241 ccagaactat acatccctag aataaatgtc acttgtagta aataattctc tgttctattg 72301 ttcaattcta tttgttaata ttttgttaag aatattgatt gttcttggtc tagttttgat 72361 atcagattcg gaaatatttc cttcttttct attttctgga agagactatt taggacttcc 72421 attaattctt tgagtactta ctcgatgtgt actattgagc tcccattgag cttccatttg 72481 tgacatgtaa ttctgaccaa ttcctctctt aggtctcagc cccaccgagt tgccgtttga 72541 ctgccttgag aagacaagcc gaatgctcag ctctacatac aactctgaga aggcggtcgt 72601 gaaaacatgg cgccaccttg ccgagagctt tggactgaag agggatgaga ttgggggcat 72661 gactgatggc atgcagctct ttgaccgcat cagcaccgcg ggctacagca tcccagagct 72721 gctcacaaag ttggtgcaga tcgagcggct ggatgctgtg gagtccttgt gtgcagacat 72781 attggagtgg gctggggttg taccacctgc ctccccaccc ccagctgcgt cctgaagagt 72841 tgtcttggac PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
10. Phillips, R. J. S. (1960) New mutant, Mouse News Lett 23, 29-30.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Karine Crozat, Sophie Rutschmann, Bruce Beutler |