Phenotypic Mutation 'achtung2' (pdf version)
Alleleachtung2
Mutation Type missense
Chromosome10
Coordinate58,438,985 bp (GRCm39)
Base Change G ⇒ T (forward strand)
Gene Edar
Gene Name ectodysplasin-A receptor
Chromosomal Location 58,436,611-58,511,476 bp (-) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce abnormalities of the hair,teeth and some exocrine glands. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010100; MGI: 1343498

MappedYes 
Amino Acid Change Proline changed to Glutamine
Institutional SourceBeutler Lab
Gene Model not available
AlphaFold Q9R187
SMART Domains Protein: ENSMUSP00000003312
Gene: ENSMUSG00000003227
AA Change: P349Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:TNFR 31 71 2e-16 BLAST
SCOP:d1jmab1 31 91 2e-3 SMART
Blast:TNFR 74 113 5e-20 BLAST
low complexity region 149 169 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
SCOP:d1ngr__ 348 430 2e-4 SMART
low complexity region 439 448 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000003312)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably nonessential (E-score: 0.187) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(7) : Transgenic(2) Spontaneous(4) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Edar APN 10 58464460 missense probably damaging 1.00
IGL01551:Edar APN 10 58441860 splice site probably benign
IGL02207:Edar APN 10 58446343 missense probably damaging 0.99
IGL02391:Edar APN 10 58464403 missense probably damaging 0.96
IGL03152:Edar APN 10 58445817 missense possibly damaging 0.88
two-tone UTSW 10 58439001 missense probably damaging 1.00
ANU23:Edar UTSW 10 58464460 missense probably damaging 1.00
R0113:Edar UTSW 10 58465271 missense probably damaging 1.00
R0413:Edar UTSW 10 58465262 missense probably benign 0.00
R0927:Edar UTSW 10 58465313 splice site probably null
R1217:Edar UTSW 10 58464453 missense probably damaging 1.00
R1458:Edar UTSW 10 58443188 missense probably benign 0.27
R1651:Edar UTSW 10 58441875 missense possibly damaging 0.49
R3820:Edar UTSW 10 58457185 missense probably damaging 1.00
R3932:Edar UTSW 10 58446164 missense probably damaging 1.00
R4050:Edar UTSW 10 58445769 missense possibly damaging 0.74
R4911:Edar UTSW 10 58457146 missense probably benign 0.03
R4924:Edar UTSW 10 58465197 missense probably damaging 1.00
R4998:Edar UTSW 10 58441915 missense probably damaging 1.00
R5311:Edar UTSW 10 58443257 missense possibly damaging 0.68
R5314:Edar UTSW 10 58443182 missense probably benign 0.00
R5371:Edar UTSW 10 58443274 missense possibly damaging 0.64
R5566:Edar UTSW 10 58464463 missense possibly damaging 0.50
R5847:Edar UTSW 10 58439001 missense probably damaging 1.00
R7330:Edar UTSW 10 58446376 missense probably damaging 0.98
R7529:Edar UTSW 10 58447830 missense probably benign
R7812:Edar UTSW 10 58465926 missense probably benign
R7872:Edar UTSW 10 58446348 missense possibly damaging 0.88
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
Repository

none

Last Updated 2018-04-24 5:29 PM by Diantha La Vine
Record Created unknown
Record Posted 2008-02-05
Phenotypic Description

The achtung2 phenotype was identified among G3 ENU-mutagenized mice. Achtung2 mice are characterized by a lack of fur behind the ears, an unusually stiff posturing of the tail, a crook at the tip of the tail, and abnormally short teeth. The animals resemble achtung or tabby/Sleek/downless mice, which have mutations in components of the EDAR signaling pathway.

Nature of Mutation
The achtung2 mutation corresponds to a C to A transversion at position 1305 of the Edar transcript on Chromosome 10, in exon 12 of 12 total exons.
 
1289 AGCCCCACCGAGTTGCCGTTTGACTGCCTTGAG
343  -S--P--T--E--L--P--F--D--C--L--E-
 
The mutated nucleotide is indicated in red lettering.
Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 1. Domain structure of EDAR. Following the cleavable signal peptide (SP), the 159 amino acid extracellular domain contains 14 cysteine residues (blue lines) in a sequence with similarity to the extracellular domain of TNFR. The transmembrane domain (TM) is followed by a 237 amino acid intracellular region containing a death domain (DD). The position of the achtung2 mutation is indicated. Other mutations found in EDAR are also noted. Click on the mutation to view more information.
The EDAR protein consists of 448 amino acids, and belongs to the tumor necrosis factor receptor (TNFR) superfamily (1). EDAR is highly conserved between vertebrate species, including fish, frogs, chicken, dogs, cattle and chimpanzee (2); the mouse and human proteins are 91% identical (3). Two additional EDAR family members exist: XEDAR (X-linked ectodysplasin-A2 receptor) (4) and Troy (5). Mouse EDAR is a type I transmembrane protein (extracellular N terminus), containing a cleavable signal peptide at the N terminus, followed by a 159 amino acid TNFR-like extracellular domain (Figure 1). The human protein does not appear to contain a signal peptide (3). The extracellular domain, responsible for ligand binding, contains 14 cysteine residues residing in three cysteine-rich domains (CRDs) similar to those of TNFR; the 6 cysteines closest to the N terminus follow the TNFR consensus sequence most closely (1;3). Ligand binding experiments using recombinant chimeric receptors containing combinations of the three CRDs from EDAR or XEDAR, and homology modeling of EDAR based on the structure of TNFR1, suggest that the specificity of EDAR-ligand interactions is determined by CRD3, the most membrane-proximal CRD (6). Following a single transmembrane domain, the 237 amino acid intracellular region of EDAR contains a segment near the C terminus with homology to the death domain of TNFR and other TNFR-like proteins (1;3). The death domain was first identified in proteins involved in cell death induction, but it is now known to function as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. In the case of EDAR, it does not seem to connect to the apoptotic machinery.
 
The achtung2 mutation results in the substitution of proline 349 by glutamine. This residue is located just N terminal to the death domain.
Expression/Localization
RT-PCR analysis detects human EDAR transcript in embryonic and fetal skin at 11-15 weeks estimated gestational age, and in a 42-53 day old craniofacial cDNA library (3). Consistent with these data, mouse Edar transcript is detected in basal cells of the epidermis, where it is uniformly distributed before follicle initiation (~embryonic day 13) and subsequently elevated and restricted in follicle epithelial cells (~embryonic day 15-17) (1;4). EDAR is also detected in lacrimal, mammary, and salivary glands (7). Surprisingly, when expressed in 293A cells, EDAR protein is primarily expressed intracellularly, a localization that has been reported for other TNF receptors (8). It was postulated that EDAR may be delivered to the cell surface in a regulated manner (8).
 
In humans, Northern blot analysis also detects EDAR transcript in fetal kidney and lung (3).
Background
The four mutant mouse phenotypes Tabby (Tb), downless (dl), Sleek (Sl) and crinkled (cr), first reported in the 1950s, are characterized by lack of hair on the tail and behind the ears, lack of or abnormal morphology of incisors, a reduced number of vibrissae, and occasionally a kinked tail tip [(9-11) and reviewed in (7)]. Further study demonstrated that sweat glands (normally on the footpads), lacrimal, Meibomian and submandibular glands, and three of four types of mouse hair, are lacking in these mutants (7). Human patients also develop a similar syndrome, hypohidrotic (or anhidrotic) ectodermal dysplasia (HED), which may be transmitted in an autosomal dominant (OMIM #129490), autosomal recessive (OMIM #224900), or X-linked recessive (OMIM #305100) manner. Humans with HED typically have missing or sparse hair, missing or misshapen teeth, and absent or reduced ability to sweat. The reduced ability to sweat can cause hyperthermia, and results in a 30% mortality rate in children up to age 2 if the condition is not recognized (12). HED patients also have dry skin, eyes, airways and mucous membranes. Recently, ocular surface abnormalities (corneal lesions, inflammation) likely due to a lack of Meibomian glands were reported in both human HED patients and in Tabby mice (13;14).
 
Mutations in EDA (15), EDAR (3) and EDARADD (16) are now known to cause HED in humans, as well as the Tb (17;18), dl or Sl (1), and cr (16;19) phenotypes, respectively, when the orthologous genes are mutated in mice. In humans, mutations of the X-linked EDA gene cause the majority of cases of HED. Male patients display a similar severity of phenotype, but heterozygous females with EDA mutations vary considerably in their symptoms due to varying levels of X-inactivation of the chromosome containing the mutated gene (20;21). Mutations in EDAR account for approximately 25% of cases, and can cause both autosomal dominant or recessive forms of HED (22;23). As in humans, Eda is an X-linked gene in mice, and female Agouti (A) mice (normally with light/yellow hair) heterozygous for Tb, in contrast to hemizygous males, grow “tabby” colored fur (containing striping of variable degree) in a mosaic pattern, giving an appearance of transverse stripes of light-colored normal and dark hair (9;36). Loss of yellow pigment results in black hair in areas of skin containing the mutation in these mice (36). The underlying mechanism by which Eda affects pigmentation in A mice is unknown, and interestingly, no pigmentation defects have been reported in humans with EDA mutations. EDA (ectodysplasin), EDAR and EDARADD (EDAR-associated death domain) form the ligand, receptor and adaptor proteins, respectively, of a TNF-related signaling pathway specific to the development of so-called skin appendages, ectoderm-derived tissues including hair follicles, nails, teeth and exocrine glands in mammals.
 
The ligand for EDAR, EDA, is a trimeric type II transmembrane protein (extracellular C terminus) with extracellular collagen and TNF domains (24). Cleavage by furin near the collagen segment releases soluble EDA to bind to EDAR (25). The gene encoding EDA is alternatively spliced to form several different transcripts [at least six in humans (26) and nine in mice (27)]. The two longest isoforms, EDA-A1 (391 aa) and EDA-A2 (389 aa), account for approximately 80% of the total EDA transcripts in mouse keratinocytes (27), and appear to be the functional forms (26). EDA-A1 and EDA-A2 differ by only two amino acids in the receptor-binding region of the protein: E308 and V309 are lacking in EDA-A2 (4). Strikingly, this two amino acid difference accounts for an absolute specificity of EDA-A1 and EDA-A2 for different receptors, EDAR and XEDAR, respectively (4). As mentioned above (Protein Prediction), the third CRD of EDAR is thought to recognize distinct structural features conferred by the presence of E308 and V309 in EDA-A1, as is the third CRD of XEDAR for structural features of EDA-A2 (6).
 
Figure 2. EDA Pathway. Ectodysplasin-A (EDA) is a trimeric type II membrane protein of the tumor necrosis factor family that signals during the development of ectodermal organs. EDA is cleaved by furin, releasing soluble EDA-1 that binds to EDAR. The EDARADD adapter is recruited to EDAR via death domain (DD) interactions. TRAF6, TAK1, and TAB2 are also recruited to the complex. IKK activation occurs upon polyubiquitination of NEMO by TRAF6 or phosphorylation of IKK by activated NIK. Once, activated IKK phosphorylates IκB, leading to ubiquitination and degradation of IκB, and release of NF-κB for translocation to the nucleus where it activates target genes. CYLD may inhibit this pathway by deubiquitinating TRAF6. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.
Like signaling from TNFR and the Toll-like receptors, signaling from EDAR is mediated by the TRAF6/TAK1/TAB2 complex, and ultimately activates NF-κB to stimulate gene transcription. EDA binds to EDAR as a trimer, leading to the recruitment of its specific adapter, EDARADD, through receptor/adapter death domain interactions (16). EDARADD can interact with TRAFs 1, 2 and 3 in GST pulldown experiments (16), but only TRAF6 has been detected in developing hair follicles (expression of other TRAFs in ectodermal tissues has not been tested) (28). EDARADD has recently been shown to coimmunoprecipitate from 293 cells with TRAF6, TAB2 and TAK1 (29). In addition, TRAF6-deficient mice develop a similar, but not identical phenotype, to that of Tabby or downless mice, with lack of hair on the tail and behind the ears, and defects in teeth, hair follicles, and exocrine glands (28). These data support the conclusion that EDARADD recruits a complex containing TRAF6, TAB2, and TAK1.
 
Transfection of EDAR into 293E cells results in dose-dependent activation of NF-κB, and this response is drastically reduced when cells are transfected with mutant forms of EDAR containing the dl mutation or lacking the death domain (4;30). In vivo, loss-of-function mutations in the human or mouse IKK complex subunit IKKγ/NEMO result in HED (along with immunodeficiency) due to impaired NF-κB signaling (see panr2) (31;32). Mice expressing a constitutively active form of IκBα develop a phenotype similar to Tabby and downless (33). Together, the data suggest that the TRAF6/TAK1/TAB2 complex activates the IKK complex to phosphorylate IκB, which then releases NF-κB for translocation to the nucleus and activation of gene expression (16;29;31;34). Interestingly, although XEDAR signaling can also activate NF-κB in vitro (4), it appears that XEDAR has no role in skin appendage development, as XEDAR-deficient mice have normal ectodermal-derived organs (35). Troy, the third EDAR family member, is also expressed in skin, including hair follicles, and activates NF-κB when overexpressed in 293T cells (5). However, an ENU-induced mouse mutant of Troy that is unable to activate NF-κB has normal hair follicles, hair shafts, hair type composition and sweat glands (2).
 
The downstream targets of EDAR signaling are reported to include proteins of the Wnt, Sonic hedgehog (Shh), bone morphogenetic protein (BMP) and lymphotoxin- β (LTβ) pathways, which were identified by comparative gene expression analysis of Tabby and wild type skin [reviewed in (2)]. The specific role of these pathways in skin appendage development and the mechanisms by which they interface with EDAR signaling not well understood.
Putative Mechanism
The achtung2 mutation results in the substitution of proline 349 by glutamine. This residue is located just outside the death domain (aa ~356-431) (1). Since proline residues typically facilitate kinks in polypeptide secondary structure, its substitution in achtung2 mice may disrupt such folding in this region of the protein. Aberrant folding of the death domain may prevent recruitment and subsequent signaling by EDARADD. Several EDAR mutations causing HED in humans or mice disrupt the function of the death domain. For example, the dl mutation is an E to K point mutation of residue 379, within the death domain, and the Sl mutation truncates EDAR just before the death domain (1). It appears that most HED-causing mutations in human EDAR occur within either the death domain or the ligand binding domain (3;22).
Primers Primers cannot be located by automatic search.
Genotyping
Achtung2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.
 
Primers for PCR amplification
Ach2(F): 5’- TCCCAACCTCAGCTTTTAGCAGTG -3’
Ach2(R): 5’- GTCCAAGACAACTCTTCAGGACGC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Ach2_seq(F): 5’- GTGTACTAGCTCTGGACTTAACATC -3’
Ach2_seq(R): 5’- TGCACCAACTTTGTGAGCAG -3’
 
The following sequence of 684 nucleotides (from Genbank genomic region NC_000076 for linear DNA sequence of Edar) is amplified:
 
72167                                                   tccc aacctcagct
72181 tttagcagtg tactagctct ggacttaaca tcaaagtcac gttgactttt gaataccgaa
72241 ccagaactat acatccctag aataaatgtc acttgtagta aataattctc tgttctattg
72301 ttcaattcta tttgttaata ttttgttaag aatattgatt gttcttggtc tagttttgat
72361 atcagattcg gaaatatttc cttcttttct attttctgga agagactatt taggacttcc
72421 attaattctt tgagtactta ctcgatgtgt actattgagc tcccattgag cttccatttg
72481 tgacatgtaa ttctgaccaa ttcctctctt aggtctcagc cccaccgagt tgccgtttga
72541 ctgccttgag aagacaagcc gaatgctcag ctctacatac aactctgaga aggcggtcgt
72601 gaaaacatgg cgccaccttg ccgagagctt tggactgaag agggatgaga ttgggggcat
72661 gactgatggc atgcagctct ttgaccgcat cagcaccgcg ggctacagca tcccagagct
72721 gctcacaaag ttggtgcaga tcgagcggct ggatgctgtg gagtccttgt gtgcagacat
72781 attggagtgg gctggggttg taccacctgc ctccccaccc ccagctgcgt cctgaagagt
72841 tgtcttggac                                                             
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.
References
 10.  Phillips, R. J. S. (1960) New mutant, Mouse News Lett 23, 29-30.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsKarine Crozat, Sophie Rutschmann, Bruce Beutler
Edit History
2011-01-07 8:48 AM (current)
2010-10-08 1:41 PM
2010-04-06 2:37 PM
2010-04-02 2:29 PM
2010-04-02 2:24 PM
2010-04-02 2:24 PM
2010-03-31 11:50 AM
2010-02-03 9:03 AM