Allele | Longs_peak | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 11 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 53,775,936 bp (GRCm38) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Irf1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | interferon regulatory factor 1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Irf-1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 53,770,014-53,778,374 bp (+) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRF1 encodes interferon regulatory factor 1, a member of the interferon regulatory transcription factor (IRF) family. IRF1 serves as an activator of interferons alpha and beta transcription, and in mouse it has been shown to be required for double-stranded RNA induction of these genes. IRF1 also functions as a transcription activator of genes induced by interferons alpha, beta, and gamma. Further, IRF1 has been shown to play roles in regulating apoptosis and tumor-suppressoion. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygous disruption of this gene leads to reduced CD8+ T cell number and altered response to viral infection and may cause alterations in cytokine levels, CD4+ cell subset homeostasis, blood vessel healing, DNA repair, and susceptibility to induced lymphomas, arthritis and autoimmune encephalitis. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_008390, NM_001159396, NM_001159393; MGI: 96590 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Tryptophan changed to Arginine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000019043] [ENSMUSP00000104548] [ENSMUSP00000104550] [ENSMUSP00000122101] [ENSMUSP00000116656] [ENSMUSP00000118314] [ENSMUSP00000114315] [ENSMUSP00000118795] [ENSMUSP00000128262] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000019043 Gene: ENSMUSG00000018899 AA Change: W247R
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000104548 Gene: ENSMUSG00000018899 AA Change: W247R
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000104550 Gene: ENSMUSG00000018899 AA Change: W247R
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000122101 Gene: ENSMUSG00000018899
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000116656 Gene: ENSMUSG00000018899
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000118314 Gene: ENSMUSG00000018899
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000114315 Gene: ENSMUSG00000018899
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000118795 Gene: ENSMUSG00000018899
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(12) : Chemically induced (ENU)(1) Chemically induced (other)(1) Gene trapped(4) Targeted(5) Transgenic(1) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-12-18 8:01 AM by Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2018-04-29 12:58 PM by Bruce Beutler | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-12-18 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The Longs_peak phenotype was identified among G3 mice of the pedigree R5828, some of which showed an increase in the CD4 to CD8 T cell ratio (Figure 1) due to increased frequencies of CD4+ T cells in CD3+ T cells (Figure 2) and concomitant reduced frequencies of CD8+ T cells in CD3+ T cells (Figure 3) in the peripheral blood. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Irf1: a T to A transversion at base pair 53,775,936 (v38) on chromosome 11, or base pair 5,923 in the GenBank genomic region NC_000077. The strongest association was found with an additive model of inheritance to the CD8+ T cell phenotype, wherein two variant homozygotes and 15 heterozygous mice departed phenotypically from 10 homozygous reference mice with a P value of 3.449 x 10-6 (Figure 3).
The mutation corresponds to residue 1,008 in the mRNA sequence NM_008390 within exon 9 of 10 total exons.
The mutated nucleotide is indicated in red. The mutation results in a tryptophan to arginine substitution at position 247 (W247R) in the IRF1 protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.267). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Interferon regulatory factor (IRF)-1 is one of nine members of the IRF family of transcription factors, which regulate the transcription of type I interferons (IFN) and IFN-inducible genes during immune system development, homeostasis and activation by microbes.
Mouse IRF1 contains 329 amino acids and functions as a transcriptional activator. As in the other IRFs, the N-terminal half of IRF1 (residues 1-113) serves as the DNA binding region, and is characterized by the presence of five tryptophans spaced ten to eighteen amino acids apart in a “tryptophan cluster” (residues 11, 26, 38, 58, and 77) (1). The DNA binding region bears similarity to that of the c-Myb oncoprotein that also contains a tryptophan cluster (2), but not to any other transcription factor classes. IRF family proteins share sequence and structural homology in their DNA binding regions, and all bind to a similar DNA motif (A/G NGAAANNGAAACT) called the IFN-stimulated response element (ISRE) (3) or IFN regulatory element (4), found within positive regulatory domain I and III (PRD I and PRD III) of the IFN-β promoter.
The C-terminal half of IRF1 contains a nuclear localization signal (amino acids 115-139) (5). A transactivation domain is also reported to exist (amino acids 185-256) (5). The C-terminal halves of all IRF family members contain either an IRF association domain 1 (IAD1) or an IAD2, with which they bind to IRF other family members, other transcription factors, or self-associate. The IAD1 is approximately 177 amino acids in length, and is conserved in all IRFs except IRF1 and IRF2 (6-8). IAD2 domains are found only in IRF1 and IRF2 (7). In IRF1, the IAD2 has been mapped in vitro using electrophoretic mobility shift (EMSA) and GST pull-down assays to two overlapping regions (amino acids 164-219 or 201-263) (5;7).
The Longs_peak mutation at position 247 of IRF1 is within the transactivation domain and IAD2.
For more information about Irf1, see the record for Endeka. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | IRF1 regulates transcription in response to diverse signals received during development and homeostasis of the myeloid and lymphoid compartments, and upon activation of innate and adaptive immune receptors by microbial infection. In particular, IRF1 is required for the development and function of dendritic cells (DC), granulocytes, NK and NKT cells, CD4+ T cells, and CD8+ T cells. IRF1 functions in innate immune signaling from Toll-like receptor (TLR) 9 to activate a select group of genes. IRF1 also acts as a tumor suppressor, and its inactivation contributes to oncogenesis. For more details on these functions, see the record for Endeka.
The targets of IRF1 continue to be investigated. IRF1 is reported to bind to ISREs in many IFN-inducible gene promoters, such as those for inducible nitric oxide synthase (iNOS) (9), cyclooxygenase-2 (Cox-2) (10), class II transactivator (CIITA) (11), and guanylate-binding protein (GBP) in IFN-stimulated macrophages (12). Transcription of IRF1 itself is also induced by IFN-β (13). Downstream of TLR9, IRF1 induces IL-12p40, IL-12p40, iNOS, IL-18, and IFN-β (11;14). The target genes of IRF1 responsible for apoptotic responses may include genes encoding Caspase 1 (15), Caspase 7 (16), and TNF-related apoptosis-inducing ligand (TRAIL) (17).
Human IRF1 is located on chromosome 5q31.1 (18), within a region frequently deleted in human leukemias and the preleukemic myelodysplastic syndromes (MDS, OMIM #153550) (19). Of the genes in the 5q31.1 region, only IRF1 was consistently deleted at one or both alleles in thirteen cases of leukemia or myelodysplasia associated with 5q31 abnormalities, providing evidence that IRF1 is the tumor suppressor mutated in these diseases (20). In another study, twelve of fourteen patients with 5q deletions and acute myeloid leukemia or MDS had loss of one allele of IRF1 (21). Loss of an IRF1 allele has also been reported to occur in gastric and esophageal cancers (22;23).
Irf1-/- mice have an increased population of pDC and a selective reduction of the CD8α+ subset of cDC (24). Splenic DC from Irf1-/- mice are impaired in their ability to produce proinflammatory cytokines such as IL-12, but express high levels of IL-10, TGF-β and the tolerogenic enzyme indoleamine 2,3 dioxygenase. Irf1-/- DC have a reduced ability to stimulate the proliferation of allogeneic T cells, and induce an IL-10-mediated suppressive activity in allogeneic CD4+CD25+ regulatory T cells. Bone marrow from Irf1-/- mice contains an increased number of immature granulocytic precursors, and a decreased number of mature granulocytes compared to wild type bone marrow cells, as determined by cell staining for Gr-1 or CD11b (25). The colony-forming ability of Irf1-/- progenitors from the bone marrow in response to treatment with G-CSF and M-CSF is also reduced. Irf1-/- mice exhibit a severe deficiency of NK cells, which lack in vitro cytotoxic activity in response to LCMV infection or poly I:C treatment in vivo and fail to produce IFN-γ upon IL-12 stimulation in vitro (26-28). NKT and intestinal intraepithelial lymphocytes (IELs) are also greatly reduced in Irf1-/- mice (27). Interestingly, Irf+/- mice display an intermediate reduction in NK, NKT and IEL numbers. Irf1-/- mice display a 10-fold reduction of mature CD8+ T cells in the thymus, spleen, lymph nodes and blood, while CD4+ T cells are present in normal numbers (29;30). Although Irf1-/- CD4+ T cells mature normally, they exclusively undergo Th2 differentiation (28;31). This is manifested by a skewed profile of cytokine production (dominated by IL-4 and lacking IFN-γ) when Irf1-/- mice are infected with Leishmania major in vivo and when Irf1-/- splenic cells are stimulated with TCR-specific peptide in vitro (28;31). The failure of Th1 differentiation is due in part to the inability of Irf1-/- mice to both produce and respond to IL-12. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer Longs_peak(F):5'- ACTCATGCAGGTTCTGTGC -3' Longs_peak(R):5'- TAATCTGGCTCTGGCTCTGC -3' Sequencing Primer Longs_peak_seq(F):5'- CATGCAGGTTCTGTGCCAGAG -3' Longs_peak_seq(R):5'- GGCTCTGCCTCCAACAG -3' |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Jin Huk Choi, Xue Zhong, and Bruce Beutler |