Phenotypic Mutation 'Cpg5' (pdf version)
List |< first << previous [record 82 of 511] next >> last >|
AlleleCpg5
Mutation Type missense
Chromosome9
Coordinate106,224,689 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Tlr9
Gene Name toll-like receptor 9
Chromosomal Location 106,222,598-106,226,883 bp (+)
MGI Phenotype Mice homozygous for a knock-out allele exhibit impaired immune system response to LPS, CpG, and Leishmania bazillensis infection.
Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Mapped Yes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Ref Sequences
L393P in Ensembl: ENSMUSP00000082207 (fasta)
Gene Model not available
PDB Structure
Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 363 386 N/A BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
Blast:LRR 471 494 N/A BLAST
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 N/A BLAST
Pfam:TIR 872 1012 1.1e-13 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.40; Specificity: 0.98)
(Using Ensembl: ENSMUSP00000082207)
Phenotypic Category immune system, MCMV susceptibility, TLR signaling defect: TNF production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 0.99
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.86
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 0.99
IGL02851:Tlr9 APN 9 106224730 nonsense probably null 0.00
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 0.99
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
Cpg7 UTSW 9 106225349 missense probably benign 0.01
Meager UTSW 9 106224139 missense probably damaging 1.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.02
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign 0.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.11
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.65
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 unclassified probably null
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
MMRRC Submission 030344-UCD
Last Updated 05/13/2016 3:09 PM by Peter Jurek
Record Created unknown
Record Posted 03/06/2008
Phenotypic Description
The CpG5 phenotype was identified in a screen of ENU-induced G3 mutants for altered response to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from heterozygous CpG5 mice produce normal amounts of tumor necrosis factor (TNF)-α in response to all TLR ligands tested, except oligodeoxynucleotides containing CpG motifs (CpG ODNs). Upon stimulation with CpG ODN, heterozygous CpG5 macrophages produce reduced amounts of TNF-α. In addition, naïve B cells from whole blood of heterozygous CpG5 mice fail to proliferate upon stimulation with CpG ODN in vitro, a response recently demonstrated to be specific for CpG ODN among other TLR agonists (1).
 
Homozygous CpG5 mice will be tested in both the TNF bioassay and the B cell proliferation assay. Results should indicate whether CpG5 is dominant or semidominant; it has been tentatively classified as semidominant.
 
Although not all of the same phenotypes have been examined, those tested are identical between CpG1, CpG2, CpG3 and CpG5 mice. Sequence analysis revealed that all four strains contain mutations in Tlr9. However, the positions of the mutations differ, with the CpG1, CpG3 and CpG5 mutations located in the sixteenth, sixth and ­­fourteenth extracellular leucine-rich repeats (LRR), respectively, and the CpG2 mutation located in the cytoplasmic Toll/IL-1R (TIR) domain. In addition to CpG1, CpG2, CpG3 and CpG5, another strain of mice, designated effete, also exhibits impaired TNF-α responses to CpG ODN treatment. The mutant has no TLR9 mutation; the causative mutation is under investigation.

 

Nature of Mutation
A Tlr9 mutation corresponding to a T to C transition at position 1284, in exon 2 of 2 total exons, was identified for CpG5.
 
1268 GCCGATCTGCCCAAACTCCACACTCTGCATCTT
388  -A--D--L--P--K--L--H--T--L--H--L-
 
The mutated nucleotide is indicated in red lettering, and corresponds to the missense error L393P in the polypeptide chain.
Protein Prediction
Figure 1. Protein and domain structure of TLR9. (A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG5 mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The CpG5 mutation (red asterisk) results in a leucine to proline change at position 393 of the TLR9 protein in the predicted fourteenth LRR. This image is interactive. Click on the image to view other mutations found in TLR9. Click on each mutation for more specific information.

The CpG5 mutation results in a leucine to proline change at position 393 of the TLR9 protein. L393 is the first leucine residue of the predicted fourteenth LRR module of the TLR9 ectodomain (Figure 1) (2).

Please see the record for CpG1 for information about Tlr9.

 

Putative Mechanism
The CpG5 mutation substitutes leucine with proline at position 393 of the TLR9 protein, which is the predicted first leucine of the fourteenth LRR module in the ectodomain. No tertiary structural data presently exist for TLR9, making it difficult to hypothesize how the CpG5 mutation could affect either ligand binding or receptor dimerization.  Recently, the crystal structure of the related TLR3 heterodimer bound to double-stranded (ds) RNA has been elucidated (see record for CpG1).  The ligand-bound TLR3 heterodimer forms an M-shape with the dsRNA binding to the concave surfaces of the TLR3 heterodimer at two locations on each ectodomain (3). It has been hypothesized that TLR7, 8 and 9 ligands may also bind to the concave surface of the ectodomain at a site made up by insertions at LRR 2, 5, 8 and 11 (4).  The CpG5 mutation might somehow disrupt ligand binding and/or receptor dimerization, or destroy proper folding or localization of the receptor.  The CpG5 phenotype supports any and all of these possibilities.
Primers Primers cannot be located by automatic search.
Genotyping
CpG5 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. The same primers are used for PCR amplification and for sequencing.
 
Primers
CpG1(F): 5’-AACTCTTCCTGGTTCCAAGGTCTG -3’
CpG1(R): 5’-GGGTATGAATGTCATTGTGTGCC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:30
4) 68°C             1:00
5) repeat steps (2-4) 40X
6) 68°C             7:00
7) 4°C               ∞
 
The following sequence of 850 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Tlr9) is amplified:
 
1812             aactcttcc tggttccaag gtctggtcaa cctctcggtg ctggacctaa
1861 gcgagaactt tctctatgaa agcatcaccc acaccaatgc ctttcagaac ctaacccgcc
1921 tgcgcaagct caacctgtcc ttcaattacc gcaagaaggt atcctttgcc cgcctccacc
1981 tggcaagttc ctttaagaac ctggtgtcac tgcaggagct gaacatgaac ggcatcttct
2041 tccgcttgct caacaagtac acgctcagat ggctggccga tctgcccaaa ctccacactc
2101 tgcatcttca aatgaacttc atcaaccagg cacagctcag catctttggt accttccgag
2161 cccttcgctt tgtggacttg tcagacaatc gcatcagtgg gccttcaacg ctgtcagaag
2221 ccacccctga agaggcagat gatgcagagc aggaggagct gttgtctgcg gatcctcacc
2281 cagctccgct gagcacccct gcttctaaga acttcatgga caggtgtaag aacttcaagt
2341 tcaccatgga cctgtctcgg aacaacctgg tgactatcaa gccagagatg tttgtcaatc
2401 tctcacgcct ccagtgtctt agcctgagcc acaactccat tgcacaggct gtcaatggct
2461 ctcagttcct gccgctgact aatctgcagg tgctggacct gtcccataac aaactggact
2521 tgtaccactg gaaatcgttc agtgagctac cacagttgca ggccctggac ctgagctaca
2581 acagccagcc ctttagcatg aagggtatag gccacaattt cagttttgtg acccatctgt
2641 ccatgctaca gagccttagc ctggcacaca atgacattca taccc
 
Primer binding sites are underlined; the mutated T is shown in red text.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsNengming Xiao, Bruce Beutler
List |< first << previous [record 82 of 511] next >> last >|
Edit History
01/07/2011 9:00 AM (current)
12/08/2010 3:32 PM
06/23/2010 11:10 AM
06/23/2010 11:10 AM
04/29/2010 11:18 AM
02/25/2010 3:00 PM