Phenotypic Mutation 'achtung' (pdf version)
List |< first << previous [record 7 of 511] next >> last >|
Alleleachtung
Mutation Type missense
Chromosome13
Coordinate12,478,497 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Edaradd
Gene Name EDAR (ectodysplasin-A receptor)-associated death domain
Synonym(s) 5830469M23Rik, 1810032E07Rik
Chromosomal Location 12,471,209-12,520,450 bp (-)
MGI Phenotype Spontaneous mutations may lead to a kinked tail, reduced fertility, abnormal respiration and sparse hair. Chemically-induced mutants may show developmental defects in teeth, hair and ectoderm-derived glands, reduced viability and fertility, respiratory disorders, and lipid, myelin and brain defects.
Accession Number

NCBI RefSeq: NM_133643; MGI: 1931001

Mapped Yes 
Amino Acid Change Isoleucine changed to Phenylalanine
Institutional SourceBeutler Lab
Ref Sequences
I105F in Ensembl: ENSMUSP00000039292 (fasta)
I105F in Ensembl: ENSMUSP00000136158 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 92 100 N/A INTRINSIC
Pfam:Death 116 192 2.4e-9 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
(Using Ensembl: ENSMUSP00000039292)
Phenotypic Category craniofacial, limbs/digits/tail phenotype, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(7) : Gene trapped(2) Spontaneous(2) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Edaradd APN 13 12483599 splice site 0.00
IGL01344:Edaradd APN 13 12478490 missense probably damaging 1.00
IGL01533:Edaradd APN 13 12478582 splice acceptor site probably benign 0.00
gizmo UTSW 13 unclassified
R1917:Edaradd UTSW 13 12500618 splice acceptor site probably benign
R1918:Edaradd UTSW 13 12500618 splice acceptor site probably benign
R1919:Edaradd UTSW 13 12500618 splice acceptor site probably benign
R4649:Edaradd UTSW 13 12508423 missense probably damaging 1.00
R5654:Edaradd UTSW 13 12478280 missense possibly damaging 0.87
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
Repository

none

Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 02/07/2008
Phenotypic Description

The achtung phenotype was identified among G3 ENU-mutagenized mice. Achtung mice are characterized by a lack of fur behind the ears, an unusually stiff posturing of the tail, a crook at the tip of the tail, and abnormally short teeth. The animals resemble achtung2, gizmo or tabby/Sleek/downless mice, which have mutations in components of the EDAR signaling pathway. Achtung is allelic to gizmo.

Nature of Mutation
The achtung mutation corresponds to an A to T transversion at position 813 of the Edaradd transcript on Chromosome 13, in exon 6 of 6 total exons.
 
798 CCCCGGGCCCCCACCATCAGCGACTTGCTCAAC
100 -P--R--A--P--T--I--S--D--L--L--N-
 
The mutated nucleotide is indicated in red lettering, and causes an isoleucine to phenylalanine substitution at residue 105 of the EDARADD protein.
Protein Prediction
Figure 1. Domain structure of EDARADD. The TRAF-binding consensus sequence PIQDT  is indicated. The amino acid altered by the achtung mutation is located close to the N-terminal edge of the death domain (DD), which is predicted to have a predominantly helical secondary structure. This image is interactive. Click on the image to view other mutations found in EDARADD (red). Click on the mutations for more specific information.    
The EDARADD protein consists of 208 amino acids, and functions as an adapter for signaling from the ectodysplasin-A receptor (EDAR), a tumor necrosis factor receptor (TNFR) superfamily member (1;2). Within the superfamily, two close relatives of EDAR, the X-linked ectodysplasin-A2 receptor (XEDAR) protein and the autosomally encoded TROY protein are also known.
 
Near its C terminus, EDARADD contains a death domain most similar to the death domain of MyD88 (35% sequence identity) (Figure 1) (1;2). The death domain was first identified in proteins involved in cell death induction, but is now known to function as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. EDARADD binds to EDAR through such death domain interactions (1;2), but there appears to be no connection to apoptotic signaling from this pathway. Secondary structure prediction suggests that the EDARADD death domain has a primarily helical structure consistent with the helical regions of MyD88, FADD, p75 neurotrophin receptor, and Fas death domains (2). In its N-terminal region, EDARADD contains a TRAF-binding consensus sequence (Pro-Ile-Gln-Asp-Thr) which several non-death domain-containing TNFRs use to bind TRAFs 1, 2, 3 and 5 (3). Deletion of this sequence from EDARADD abolished its interaction with TRAFs 1, 2 and 3 in GST pulldown experiments (1). Human and mouse EDARADD are 80% identical overall, 96% identical in the death domain, and 100% identical in the TRAF-binding consensus sequence.
 
The achtung mutation results in the substitution of isoleucine 105 by phenylalanine. This residue is located at the N-terminal end of the death domain.
Expression/Localization
In situ hybridization in mouse tissue sections and whole-mount embryos detects Edaradd transcript in the basal layer of the epidermis (detected at postnatal day 2) and in epithelial cells during formation of hair follicles and teeth (detected at timepoints during mid-gestation) (1;2). Edar and Edaradd are coexpressed in these cell types. PCR analysis of cDNA from a panel of human tissues also detects coexpression of EDARADD and EDAR in pancreas, lung, thymus, prostate, testis and fetal skin (2). EDARADD is localized in the cytoplasm.
Background
Mutations in EDA (4), EDAR (5) and EDARADD (1) cause hypohidrotic (or anhidrotic) ectodermal dysplasia (HED) in humans, as well as the Tabby (6;7), downless or Sleek (8), and crinkled (1;2) phenotypes, respectively, when the orthologous genes are mutated in mice. EDA, EDAR and EDARADD form the ligand, receptor and adaptor proteins, respectively, of a TNF-related signaling pathway specific to the development of so-called skin appendages, ectoderm-derived tissues including hair follicles, nails, teeth and exocrine glands in mammals.
 
Humans with HED typically have missing or sparse hair, missing or misshapen teeth, and absent or reduced ability to sweat. The reduced ability to sweat can cause hyperthermia, and results in a 30% mortality rate in children up to age 2 if the condition is not recognized (9). HED patients also have dry skin, eyes, airways and mucous membranes. Recently, ocular surface abnormalities (corneal lesions, inflammation) likely due to a lack of Meibomian glands were reported in both human HED patients and in Tabby mice (10;11). In humans, HED may be transmitted in an autosomal dominant (OMIM #129490), autosomal recessive (OMIM #224900), or X-linked recessive (OMIM #305100) manner. Human mutations of the X-linked EDA gene cause the majority of cases of HED. Male patients display a similar severity of phenotype, but heterozygous females with EDA mutations vary considerably in their symptoms due to varying levels of X-inactivation of the chromosome containing the mutated gene (12;13). Mutations in EDAR account for approximately 25% of cases, and can cause both autosomal dominant or recessive forms of HED (14;15). More rare EDARADD mutations (only two reported to date) also result in both autosomal dominant and recessive HED (1;16).
 
The four mutant mouse phenotypes Tabby (Tb), downless (dl), Sleek (Sl) and crinkled (cr), first reported in the 1950s, are characterized by lack of hair on the tail and behind the ears, lack of or abnormal morphology of incisors, a reduced number of vibrissae, and occasionally a kinked tail tip [(17-20) and reviewed in (21)]. Further study demonstrated that sweat glands (normally on the footpads), lacrimal, Meibomian and submandibular glands, and three of four types of mouse hair, are lacking in these mutants (21). As in humans, Eda is an X-linked gene in mice, and female Agouti (A) mice (normally with light/yellow hair) heterozygous for Tb, in contrast to hemizygous males, grow “tabby” colored fur (containing striping of variable degree) in a mosaic pattern, giving an appearance of transverse stripes of light-colored normal and dark hair (17;22). Loss of yellow pigment results in black hair in areas of skin containing the mutation in these mice (22). The underlying mechanism by which EDA affects pigmentation in A mice is unknown, and interestingly, no pigmentation defects have been reported in humans with EDA mutations. Cr mice, in addition to the phenotypes mentioned above, also have reduced viability (approximately 40% die before 10 days of age), are smaller than their wild type littermates, and sometimes develop respiratory disorders (23). Myelin abnormalities have been observed in the brains of cr mice, along with abnormal morphology and disordered layers in the cerebellum (24).
 
The ligand for EDAR, EDA, is a trimeric type II transmembrane protein (extracellular C terminus) with extracellular collagen and TNF domains (25). Cleavage by furin near the collagen segment releases soluble EDA to bind to EDAR (26). The gene encoding EDA is alternatively spliced to form several different transcripts [at least six in humans (27) and nine in mice (28)]. The two longest isoforms, EDA-A1 (391 aa) and EDA-A2 (389 aa), account for approximately 80% of the total EDA transcripts in mouse keratinocytes (28), and appear to be the functional forms (27). EDA-A1 and EDA-A2 differ by only two amino acids in the receptor-binding region of the protein: E308 and V309 are lacking in EDA-A2 (29). Strikingly, this two amino acid difference accounts for an absolute specificity of EDA-A1 and EDA-A2 for different receptors, EDAR and XEDAR, respectively (29).

Figure 2. EDA Pathway. Ectodysplasin-A (EDA) is a trimeric type II membrane protein of the tumor necrosis factor family that signals during the development of ectodermal organs. EDA is cleaved by furin, releasing soluble EDA-1 that binds to EDAR. The EDARADD adapter is recruited to EDAR via death domain (DD) interactions. TRAF6, TAK1, and TAB2 are also recruited to the complex. IKK activation occurs upon polyubiquitination of NEMO by TRAF6 or phosphorylation of IKK by activated NIK. Once, activated IKK phosphorylates IκB, leading to ubiquitination and degradation of IκB, and release of NF-κB for translocation to the nucleus where it activates target genes. CYLD may inhibit this pathway by deubiquitinating TRAF6. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.
Like signaling from TNFR and the Toll-like receptors, signaling from EDAR is mediated by the TRAF6/TAK1/TAB2 complex, and ultimately activates NF-κB to stimulate gene transcription. EDA binds to EDAR as a trimer, leading to the recruitment of its specific adapter, EDARADD, through receptor/adapter death domain interactions (1). EDARADD can interact with TRAFs 1, 2 and 3 in GST pulldown experiments (1), but only TRAF6 has been detected in developing hair follicles (ectodermal expression of other TRAFs has not been tested) (30). EDARADD has recently been shown to coimmunoprecipitate from 293 cells with TRAF6, TAB2 and TAK1 (31). In addition, TRAF6-deficient mice develop a similar, but not identical phenotype, to that of Tb or dl mice, with lack of hair on the tail and behind the ears, and defects in teeth, hair follicles, and exocrine glands (30). These data support the conclusion that EDARADD recruits a complex containing TRAF6, TAB2, and TAK1.
 
Transfection of EDAR into 293E cells results in dose-dependent activation of NF-κB, and this response is drastically reduced when cells are transfected with mutant forms of EDAR containing the dl mutation or lacking the death domain (29;32). Overexpression of EDARADD also leads to NF-κB activation, but a mutant containing only the death domain blocks EDAR-dependent NF-κB activation (1;2). In vivo, loss-of-function mutations in the human or mouse IKK complex subunit IKKγ/NEMO result in HED (along with immunodeficiency) due to impaired NF-κB signaling (see panr2) (33;34). Furthermore, mice expressing a constitutively active form of IκBα develop a phenotype similar to Tb and dl (35). Together, the data suggest that the TRAF6/TAK1/TAB2 complex activates the IKK complex to phosphorylate IκB, which then releases NF-κB for translocation to the nucleus and activation of gene expression (1;31;33;36). Interestingly, although XEDAR signaling can also activate NF-κB in vitro (29), EDARADD does not serve as its adapter (2). XEDAR has no role in skin appendage development, as XEDAR-deficient mice have normal ectodermal-derived organs (37). TROY, the third EDAR family member, is also expressed in skin, including hair follicles, and activates NF-κB when overexpressed in 293T cells (38). An ENU-induced mutation of Troy in the mouse, which abolishes the ability of the corresponding recombinant protein to activate NF-κB in transfected cells, has normal hair follicles, hair shafts, hair type composition and sweat glands (39).
 
The downstream targets of EDAR signaling are reported to include proteins of the Wnt, Sonic hedgehog (Shh), bone morphogenetic protein (BMP) and lymphotoxin- β (LTβ) pathways, which were identified by comparative gene expression analysis of Tabby and wild type skin [reviewed in (39)]. The specific role of these pathways in skin appendage development and the mechanisms by which they interface with EDAR signaling are not well understood.
Putative Mechanism
Isoleucine 105 lies at the N-terminal border of the EDARADD death domain. No structural data are currently available for EDARADD. However, two mutations causing one case of autosomal dominant (L112R) and one case of autosomal recessive (E142K) HED have been reported (1;16). Both residues are in the death domain. Both mutations blocked EDARADD binding to EDAR in coimmunoprecipitation assays using tagged proteins (16). When tested in NF-κB transactivation assays in HEK293 cells, EDARADD mutant proteins containing either mutation had a dramatically reduced ability to activate NF-κB, with EDARADD L112R showing only as much activity as the empty vector (1;16). It is predicted that the achtung mutation also abrogates the ability to bind EDAR and activate NF-κB, but these, and the ability to interact with downstream signaling partners such as TRAF6, TAK1 or TAB2, have not been tested.
Primers Primers cannot be located by automatic search.
Genotyping
Achtung genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.
 
Primers for PCR amplification
Ach(F): 5’- TTCTGCACTATTCCAAGGAAGGAATCG -3’
Ach(R): 5’- CTGAAAACCTTAGGAGCAGGTACGC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Ach_seq(F): 5’- TATTCCAAGGAAGGAATCGTGGAATC -3’
Ach_seq(R): 5’- ATCAGTTGGCCCACAGTC -3’
 
The following sequence of 670 nucleotides (from Genbank genomic region NC_000079 for linear DNA sequence of Edaradd) is amplified:
 
41683                                               ttctgcac tattccaagg
41701 aaggaatcgt ggaatcgtgt gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt gtgtgacact
41761 tagatgatgt caccaaaatg gtaggaaaat aaaaggagta ttgctcgtgc gtgcgcgcgt
41821 gcgggaggtg cgcatggccc ctgggtaacc tgtgacctct ctgtcatcct gcaggtgtca
41881 gcagaaacca gccctgtaag gacgggaagg gcagctgctc ttgcccttcc tgctcccccc
41941 gggcccccac catcagcgac ttgctcaacg atcaggactt gctagatacg atcaggataa
42001 agctggatcc atgtcaccca accgtgaaga actggaggaa ttttgccagc aaatggggca
42061 tgccctatga tgaactgtgc ttcctggaac agaggcccca gagccccacg ctggagttct
42121 tattccgaaa cagccagagg actgtgggcc aactgatgga gctctgccgg ctgtaccaca
42181 gggccgatgt ggagaagatc ctgcgcaggt gggtggatga ggagtggccc caccggggac
42241 actccgacag ctccatgcac ttctagaatc ccctctcctc tggcattggc cctactgctc
42301 gttggaccag catggctcct gcggagagcg tacctgctcc taaggttttc ag

 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
References
 18.  Phillips, R. J. S. (1960) New mutant, Mouse News Lett 23, 29-30.
 20.  Falconer, D. S. (1949) cr-crinkled, Mouse News Lett 1S, 4.

 23.  Falconer, D. S., Fraser, A. S., and King, J. W. B. (1951) The genetics and development of "crinkled", a new mutant in the house mouse, J Genet 50, 324-344.

 

Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsPia Viviani, Xin Du, Bruce Beutler
List |< first << previous [record 7 of 511] next >> last >|
Edit History
01/07/2011 8:47 AM (current)
07/15/2010 2:09 PM
07/15/2010 2:07 PM
07/15/2010 2:06 PM
07/15/2010 2:02 PM
04/06/2010 2:36 PM
04/02/2010 2:32 PM
04/02/2010 2:31 PM
04/02/2010 2:30 PM
04/02/2010 2:22 PM
04/02/2010 2:22 PM
04/02/2010 2:20 PM
04/02/2010 2:20 PM
03/31/2010 11:53 AM
02/03/2010 9:03 AM