Phenotypic Mutation 'madcow'

• Allele: madcow
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 11,576,034 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Cars2
• Gene Name: cysteinyl-tRNA synthetase 2, mitochondrial
• Synonym(s): 2410044A07Rik, 2310051N18Rik, D530030H10Rik
• Chromosomal Location: 11,564,017-11,600,781 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of cysteine to tRNA molecules. A splice-site mutation in this gene has been associated with a novel progressive myoclonic epilepsy disease with similar symptoms to MERRF syndrome. [provided by RefSeq, Mar 2015] ; PHENOTYPE: Mice homozygous for an ENU-induced allele develop induced hyperactivity followed by head bobbing and tremors. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000046453; Gene: ENSMUSG00000056228; AA Change: S305T

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:tRNA-synt_1e	50	351	4.1e-116	PFAM
Pfam:tRNA-synt_1g	63	207	1.5e-7	PFAM
Pfam:tRNA-synt_1g	280	370	4.2e-7	PFAM
Blast:DALR_2	391	461	3e-37	BLAST

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000049461)
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably essential (E-score: 0.955)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 034369-UNC
• Last Updated: 2019-04-18 11:53 AM by Bruce Beutler
• Record Created: unknown
• Record Posted: 2011-01-19
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Celine Eidenschenk, Xin Du, Yee Ting Chong, Weiwei Fan, Bethany Frazen, Heather Elledge, Anastasia Kralli, Ronald M. Evans, Ulrich Mueller, Paul Schimmel, Xiang-Lei Yang, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_024248; MGI: 1919191

Alleles Listed at MGI

All alleles(11) : Gene trapped(11)

Phenotypic Description

Madcow was derived from the Stamper stock, a pedigree that also gave rise to a coat color phenotype (stamper-coat) ascribed to Hps6, and a developmental phenotype (zigzag) ascribed to Lfng.  Homozygous madcow mice develop a neurological phenotype with age, appearing in females by 4-5 months and in males by 8 months. Initially mice display hyperactivity, particularly when mildly stimulated by handling or transfer to a new cage environment (see video).  After several months head-bobbing and tremor are also evident.  No other defects are apparent in these animals, and madcow mice have a normal life-span and are able to breed.

Figure 1. Locomotor activity test. Horizontal (A, B) and vertical movements (C) were measured in twenty-four 5 minute intervals. (A) Graph depicting horizontal movements of madcow and wild type C57BL/6J mice in the first 5 minutes. (B) Graph depicting horizontal movements for the fill 2 hours. (C) Vertical activity is rearing. P values were generated using ANOVA tables. *P<0.05; **P<0.01; ***P<0.001; n=16.

In order to quantify the madcow behavioral defect, both horizontal and vertical activity of both wild-type and mutant animals were measured following transfer to a new cage environment (Figure 1).  During the first 5 minutes of observation post-transfer, both madcow males and females displayed significantly increased horizontal activity starting at the age of 5 months (Figure 1A).  The behavioral difference between wild type and mutant animals increased with age, peaking at 9 months.  The difference in horizontal activity level between the two groups tapered off over a 2 hour period, but remained significant in mice that were 9 or 10 months of age (Figure 1B).  In general, homozygous madcow mice displayed no differences in vertical activity (rearing, jumping) relative to wild-type animals (Figure 1C).  Histological analysis of the brain, using hematoxylin and eosin staining in 9 month-old homozygous madcow mice, revealed no abnormalities.

Figure 2. Madcow mice have no hearing defects. Madcow and control mice of the indicated ages were assessed for auditory brainstem response (ABR; A), distortion product otoacoustic emission (DPOAE; B), and responses to single tones (C). No differences were found between madcow and C57BL/6J wild type animals.

Because hyperactivity can be caused by hearing defects, the auditory threshold were characterized by measuring the auditory brainstem response (ABR). Click stimuli were applied to the same groups of mice of both sexes at 2 and 6 months old starting with 90 dB and then decreasing the intensity. Auditory thresholds in both wild type and madcow mice were at about 40-50 dB with no significant differences between the two groups at either time point (Figure 2A).  Also assessed were the auditory threshold for single tones at frequencies between 6 and 32 kHz, and the functionality of the mechanosensitive outer hair cells by measuring the distortion product otoacoustic emission (DPOAE).  Again, no differences were found between madcow and wild type animals using these tests (Figure 2B,C), suggesting that madcow animals do not have a hearing defect.

Madcow animals display no immunological phenotypes as assayed by several immunological screens (TLR Signaling Screen; Ex Vivo Macrophage Screen for Control of Viral Infection; MCMV Susceptibility and Resistance Screen; In vivo natural killer (NK) cell and CD8⁺ cytotoxic T lymphocyte (CTL) cytotoxicity screen).  Blood analysis by flow cytometry was normal.

Nature of Mutation

Figure 3. Identification of the madcow mutation. (A) Madcow was confined to Chromosome 8 with a peak LOD score of 6.68 at marker d8Mit124. (B) Trace file showing the T to A transversion in the Cars2 gene.

The madcow mutation was mapped by scoring the behavior of 27 F2 mice generated by outcrossing the madcow stock to mice of the C3H/HeN strain and backcrossing the F1 animals to mice of the madcow stock.  The mutation was initially assigned to the proximal 25.72 Mb of chromosome 8 with a LOD score of 6.68 (Figure 3A). The identification and analysis of additional SNPs in the region allowed us confine the mutation to a critical region from 10.5 Mb to 13.06 Mb.  All 15 protein-encoding exons and splice junctions in the region were sequenced using a semiautomated method described previously (1), to a greater than 98% coverage.  A single mutation was found, corresponding to a T to A transversion at position 1007 of theCars2 transcript, in exon 9 of 15 total exons (Figure 3B). 

992 ACAGAAGAAAAGATGTCCAAATCCCTAAAAAAC

300 -T--E--E--K--M--S--K--S--L--K--N-

The mutated nucleotide is indicated in red lettering, and results in a serine to threonine change at amino acid 305 of the CARS2 protein.

Protein Prediction

Cysteinyl-tRNA synthetase 2 (CARS2 or CysRS2) is a predicted mitochondrial-specific member of the class I aminoacyl-tRNA synthetase (ARS) protein family.  Aminoacyl-tRNA synthetases catalyze the specific attachment of each of the 20 amino acids (aa) to a cognate transfer RNA (tRNA) (see Background).  The ARSs are grouped into 16 cytoplasmic and 17 mitochondrial-specific enzymes with 3 enzymes functioning in both compartments.  One ARS (glutamyl-prolyl-tRNA synthetase) attaches glutamic acid and proline to both tRNA^glu and tRNA^pro, respectively.  The nomenclature for human ARSs generally involves the use of the single-letter amino acid code followed by ‘ARS’ or ‘RS’.  Mitochondrial-specific ARSs have a ’2’ added at the end (2).  The ARSs are also often named by listing the first three letters of the amino acid catalyzed by the enzyme and ’RS’.   

ARSs are also subdivided into class I and class II enzymes based on the architectures of their active sites (Table 1).  The catalytic domains of class I enzymes are characterized by a Rossmann dinucleotide binding fold consisting of a five-stranded parallel β-sheet connected by α-helices while class II enzymes have a core made up of a seven-stranded β-structure with flanking α-helices (3).  Class I enzymes usually exist in monomeric or dimeric form, while class II ARSs are dimeric or tetrameric.  Class I and II enzymes are further subdivided into subclasses (a, b, and c) based on sequence similarity, and amino acid chemical types.  Subclass a includes synthetases for many of the hydrophobic amino acids, subclass b contains synthetases for carboxyl side-chain amino acids and amidated derivatives, and subclass c includes synthetases for aromatic amino acids (4).  Although class I and class II enzymes do not appear to have any structural relationship, it has been postulated that the genes encoding both classes arose from a series of duplications from an ancestral gene where complementary strands of the gene coded for class I and II proteins.  The conserved catalytic domains of the class I and II synthetases display complementarity that is specific to each subclass (a,b or c), and bind to opposite sides of  the acceptor helix domains of tRNAs (5;6).     

 

Table 1. Categorization of aminoacyl tRNA synthetases

	Class I		Class II
Ia	MetRS (MARS)	IIa	SerRS (SARS)
	ValRS (VARS)		ThrRS (TARS)
	LeuRS (LARS)		AlaRS (AARS)
	IleRS (IARS)		GlyRS (GARS)
	CysRS (CARS)		ProRS (PARS) (EPRS in some species)
	ArgRS (RARS)		HisRS (HARS)
Ib	GluRS (EARS) (EPRS in some species)	IIb	AspRS (DARS)
	GlnRS (QARS)		AsnRS (NARS)
	LysRS-I (for some species) (KARS)		LysRS-II (KARS)
Ic	TyrRS (YARS)	IIc	PheRS (FARS)
	TrpRS (WARS)

 

Figure 4. Domain structure of CARS2, a predicted mitochondrial-specific member of the class Ia ARS protein family. CARS2 contains a catalytic domain and an anticodon binding domain. The catalytic domain contains a mitochondrial targeting (MT tag) sequence at its N-terminus. The HIGH motif also located in the catalytic domain.The madcow mutation results in a serine to threonine change at amino acid 305 of the KMSKS motif. Binding ATP positions this loop in a closed conformation.

Besides their catalytic domains, aminoacyl-tRNA synthetases contain an anticodon binding domain, which mostly interacts with the anticodon region of the tRNA and ensures binding of the correct tRNA to the protein. In addition, some ARSs have additional RNA binding domains and editing domains that cleave incorrectly paired aminoacyl-tRNA molecules (2;4) (Figure 4).

CARS2 is a member of subclass a and is predicted to be the synthetase used to attach cysteines to cognate tRNAs in the mitochondria (7). CARS2 contains a mitochondrial targeting sequence at its N-terminus.  Mitochondrial targeting sequence have no real consensus, but are enriched in positively charged, hydrophobic and hydroxylated residues, and often have the potential to form amphipathic α-helices (8).  Most mitochondrial ARSs are more similar to bacterial ARSs than to their cytoplasmic counterparts, which often contain additional domains (9;10). However, the few mitochondrial enzymes investigated have different biochemical and enzymological properties such as decreased solubility, decreased specific activity and ability to aminoacylate tRNAs of the same specificity from a large range of organisms, as compared to bacterial ARSs (10;11). 

Figure 5. Crystal structure of bacterial CARS. A, Structure of CARS alone or bound with cysteine. The dipartite Rossmann fold is shown in purple, the CP domain is in green, the SC fold is shown in cyan and the C-terminal domain is in yellow. The HIGH and KMSKS motifs are depicted in pink. The active site zinc ion is shown as a blue sphere. The amino acid altered by the madcow mutation is indicated. UCSF Chimera structure is based on PDB ILI7, Hauenstein et al, Nat. Struct. Mol. Biol. 11, 1134-1141 (2004). B, Structure of tRNA-bound CARS. CARS domains and motifs are color-coded as in A. The anticodon binding (AB) domain, which becomes ordered upon tRNA binding, is shown in orange. The tRNA is in gray. β-strands are represented by flat arrows and α-helices by coils. UCSF Chimera structure is based on PDB 1U0B, Hauenstein et al, Nat. Struct. Mol. Biol. 11, 1134-1141 (2004). Click on each 3D structure to view it rotate.

The crystal structure of E. coli CARS  (PDB ID 1LI7 ; 1U0B ) reveals the typical catalytic Rossmann-fold of class I synthetases at the N-terminus, a small connective polypeptide insertion (the CP domain) that connects the two halves of the Rossmann fold, a  stem-contact fold (the SC fold) that contacts the tRNA stem, a helical bundle domain conserved in all subclass 1a tRNA synthetases, and a unique mixed α/β anticodon-binding domain that provides the specificity determinants for all three anticodon nucleotides and beomes ordered upon tRNA binding (12;13) (Figure 5).  Binding tRNA also orders residues in the CP domain to form a short helix-loop segment that may help orient the tRNA acceptor end into the active site (13).  The CP domain is folded into a four-stranded antiparallel β-sheet motif common to all class Ia and b tRNA synthetase structures.  Class I ARSs contain two conserved motifs that are critical for enzyme function.  The HIGH motif (named for its component amino acids) is located within the first half of the Rossman fold and helps to correctly position the adenine base of ATP and provide interactions with the phosphates.  The KMSKS motif is located on a flexible loop in the SC-fold domain directly following the final C-terminal β-strand of the Rossman fold.  Binding ATP, positions this loop in a closed conformation in which the second lysine is positioned to stabilize the α-phosphate in the first transition state of aminoacylation (14-16).  This motif also binds at the inside corner of the L-shaped tRNA molecule, and positions of the tRNA on the enzyme’s surface (17;18).  The SC-fold domain consists of a β-α-α-β-α structure.  The C-terminal helical domain is smaller than other class Ia ARSs and consists of four antiparallel α-helices.  Cysteine binds at the base of the active site cleft in a position similar to the amino acid binding sites of other class I tRNA synthetases and makes interactions with amino acids in both the first and second halves of the Rossman fold.  Five strictly conserved histidine residues are present at the base of the amino acid binding cleft (12).  CARS does not have the editing domain found in many ARSs that is able to catalyze the hydrolysis of incorrectly attached amino acids (19), but the interaction of the cysteine thiol group with a tightly bound zinc molecule found at the base of the amino acid binding site provides binding specificity (12;20).

Unlike bacterial CARS, eukaryotic CARS exists in dimeric form, although the significance of this is unknown (21;22).  Human CARS contains extension domains as compared with its prokaryotic homologs:  a 30 amino-acid N-terminal peptide, a 100 amino acid insertion domain in place of the CP domain located between the two halves of the Rossmann fold, and a 100 amino acid C-terminal extension.  Only the C-terminal polypeptide is conserved among eukaryotic CARS proteins, and is used to selectively improve recognition and binding of the anticodon sequence (23).

Figure 6. Structures of tRNAcys species. (A) E. coli and H. sapiens cytoplasmic tRNA cys structures. The bases that are important in CARS recognition are highlighted. The G15-C48 pairing in human tRNA cys recognition by CARS is not critical as it is in bacteria. (B) Structure of human mitochondrial tRNA cys .

Aminoacyl synthetases must be able to recognize specific tRNAs.  Generally, tRNAs have a globular ‘hinge’ region located at the junction between two duplex helical arms that form an L shape (Figure 6).  Bacterial CARS recognizes tRNA^cys by elements in its globular core including the presence of some unusual properties specific to tRNA^cyssuch as a G15-G48 pairing between the 3’-terminal nucleotide of the variable loop and a nucleotide of the D loop.  Other unusual features of tRNA^cys include a unique C-C pairing that stacks above the G-G pair and the base triples that stack below this pair (24).  CARS recognizes tRNA^cys by the presence of four nucleotides: the 5'-GCA-3' anticodon (25) and U73 in the acceptor stem (26;27), all of which are strictly conserved among tRNA^cys species.  U73 allows CARS to attach the cysteine to either the 2’ or 3’-hydroxyl group of the terminal ribose, unlike other class I ARSs that attach the amino acid substrate to the 2’-hydroxyl group (28).  The mixed α/β C-terminal domain of CARS makes specific hydrogen bonding interactions with all three bases of the GCA anticodon (13).  Other interactions include the a-helical bundle domain and the D and anticodon stems, which form the vertical arm of the L-shaped tRNA.  The contacts in this region are almost exclusively with the sugar-phosphate backbone of the tRNA.   tRNA recognition by human CARS differs from that of E. coli CARS in that human CARS does not depend on the nature of the 15–48 base pair as a selective determinant for aminoacylation (26).  Mitochondrial (mt)-tRNAs are atypical with biased sequences, size variations in loops and stems, and absence of residues forming classical tertiary interactions, raising questions about how mt-ARSs specifically bind to mt-tRNAs (9;11).

Some species of archaebacteria do not have a CARS enzyme, and are also missing enzymes that typically synthesize cysteine.  Instead, cysteine is directly synthesized on tRNA^cys using two enzymes, O-phosphoseryl-tRNA synthetase (SepRS) and O-phosphoseryl-tRNA:cysteinyl-tRNA synthase (SepCysS).  During this process, SepRS aminoacylatestRNA^cyswith O-phosphoserine, followed by conversion of the O-phosphoserine to cysteine by SepCysS (29).  A similar reaction occurs in all species during the formation of selenocysteinyl-tRNA^sec.  Selenocysteine (Sec) is present in the active sites of enzymes in removing reactive oxidative species.  tRNA^sec is first misacylated by SARS to form Ser-tRNA^sec, followed by phosphorylation of the serine by O-phosphoseryl-tRNA kinase (PSTK).  The phosphoseryl (Sep) is then converted into Sec by Sep-tRNA:Sec-tRNA synthase (SepSecS) (29;30).  In vitro, CARS is able to use Sec to aminoacylate tRNA^cys.  It is likely that the tRNA^sec-dependent means of Sec synthesis restricts the formation of misacylated tRNA^cys (29). 

The madcow mutation results in a conservative alteration of amino acid 305 from a serine to a threonine.  KMSKS is considered necessary for CARS2 to engage ATP and position tRNA to allow aminoacylation (2), and the serine residue altered by the madcow mutation in this motif is thought to interact transiently with the pyrophosphaste moiety of ATP during the aminoacylation reaction (16).

Expression/Localization

According to BioGPS, the gene is highly expressed in human in immune cells such NK cells, dendritic cells (DCs), B cells, T cells and monocytes.  In mouse, it is expressed in many tissues but most highly in the heart.  There are fairly high expression levels in erythrocyte, monocyte and myeloid precursors, liver, kidney and immune cells. Expression levels are low in the brain.  Gene expression in the mouse kidney occurred at embryonic day (E)18.5 and in adults, but not at post natal day (P)1 (31).  In situ hybridization studies found Cars2 mRNA to be at low levels in 8 week-old C57BL/6J male mouse cortex, hippocampal regions, and olfactory bulb (please see the Allen Brain Atlas). 

CARS2 is predicted to localize to the mitochondrion based on the presence of a mitochondrial targeting sequence (7). 

Background

Aminoacyl tRNA synthetases play a critical role in protein biosynthesis by covalently attaching amino acids to the appropriate transfer RNA (tRNA) in a process known as tRNA charging or activation.  tRNAs have a site for amino acid attachment, and an anticodon site that is complementary to the mRNA triplet that codes for a specific amino acid.  In a two-step reaction as shown below, ARSs join amino acids by their carboxyl group to the 3’-end of tRNAs to make an aminoacyl-tRNA molecule: 

1.   amino acid + ATP → aminoacyl-AMP + PPi

2.   aminoacyl-AMP + tRNA → aminoacyl-tRNA + AMP

Class I and II enzymes aminoacylate at the 2’ and 3’-hydroxyl group of an adenosine nucleotide, respectively, due to the structures of their active sites.  The 2’-O-aminoacyl eventually migrates to the 3’ position via transesterification (28).  Aminoacyl-tRNAs then travel inside the ribosome, where mRNA codons are matched through complementary base pairing to specific tRNA anticodons.  The amino acids that the tRNAs carry are then used to assemble a protein.  Termination of the polypeptide occurs at stop codons, which do not have cognate tRNAs.  Instead, releasing factors recognize nonsense codons allowing the release of the polypeptide chain.  The catalytic efficiency of ARSs is often enhanced by editing domains (see Protein Prediction), specialized N- or C-terminal tRNA binding domains that help dock tRNAs, and association with RNA-binding trans-acting factors or elongation factor subunits that facilitate tRNA trafficking (32). 

Some of the ARS proteins have a secondary functions ranging from transcriptional control to angiogenic signaling (2;32) (Table 2).  ARSs can catalyze a secondary chemical reaction using ATP or ADP instead of tRNA to synthesize diadenosine oligophosphates (Ap_nA), which can act as signaling molecules (33), and some ARSs (DARS, EPRS, IARS, KARS, LARS, MARS, QARS, and RARS) interact in a multiple synthetase complex in eukaryotic cells.  Three non-enzymatic proteins known as ARS-interacting multi-functional proteins (AIMPs) are also part of the complex.  Although the exact roles of these complexes are unknown, they likely regulate both the canonical and secondary functions of tRNA synthetases (2;32).  

Table 2.  ARS secondary functions

Species	ARS	Activity
Homo sapiens	EPRS	Silences translation
Homo sapiens	HARS	Stimulates immune cells
Homo sapiens	KARS	Regulates transcription HIV packaging Inflammatory response
Homo sapiens	NARS	Stimulates immune cells
Homo sapiens	MARS	rRNA biogenesis
Homo sapiens	QARS	Inhibits apoptosis
Homo sapiens	WARS	Inhibits angiogenic signaling
Homo sapiens	YARS	Promotes angiogenic signaling Stimulates immune cells
Saccharomyces cerevisiae	GlyRS	mRNA 3’-end formation
Saccharomyces cerevisiae	LeuRS (mitochondrial)	Intron splicing
Neurospora crassa	TyrRS (mitochondrial)	Intron splicing
Escherichia coli	AlaRS	Represses its own transcription
Escherichia coli	TyrRS	Represses its own translation

Many of the secondary functions attributed to ARSs involve the immune system.  Both YARS and KARS are secreted in response to tumor necrosis factor (TNF)-α (34;35).  The cleavage of YARS by leukocyte elastase results in an N-terminal fragment that is an interleukin-8-like cytokine and has proangiogenic activity, and a C-terminal fragment that becomes an immune cell stimulant for migration and production of tissue factor, myeloperoxidase, and additional TNF-α (36;37).  KARS also regulates TNF-α production by activating MAP kinase pathways in macrophages and peripheral blood mononuclear cells (35).  KARS is also involved in the packaging of HIV, and regulates mast cell transcription via production of Ap₄A in the nucleus (33).  HARS and NARS also stimulate immune cells by interacting with cell surface chemokine receptors (38).  WARS undergoes alternative splicing that removes an N-terminal domain and generates active cytokines that inhibit the proangiogenic activities of YARS (39).  In response to interferon (IFN)-γ signaling, EPRS silences translation of ceruloplasmin, a copper-binding plasma protein with important roles in inflammation and iron homeostasis (40).  QARS can inhibit apoptosis in response to TNF-α and other stimuli (41).

Disease-causing mutations in cytoplasmic ARS-encoding genes have been found in both humans and mice.  In humans, Charcot-Marie-Tooth type neuropathies (dominant intermediate CMT, OMIM #608323; CMT2D, OMIM #601472), which cause peripheral neuronal degeneration, are caused by dominant mutations in YARS and GARS, respectively (2).  Mutations in GARS can also cause distal hereditary motor neuronopathy type V (HMN5; #600794), while a heterozygous point mutation in mouse Gars results in severe neuromuscular dysfunction by three weeks of age and a shortened life span.  The homozygous mutation is embryonic lethal.  Interestingly, a null allele of Gars in the mouse is completely recessive, suggesting that the protein defect associated with the point mutation results in dominant-negative function (42). In drosophila melanogaster,a neuronal-specific Gars mutation causes defects in the formation of dendritic terminals and axonal arbors (43).  In sticky mice, a mutation in Aars causes progressive cerebellar ataxia and rough, unkempt fur (44).  Mutations in human CARS have not been identified, although a strong association for diabetic nephropathy was identified at this locus (45).  Finally, the autoimmune diseases polymyositis and dermatomyositis are a consequence of autoantibodies directed against one or more ARSs with subsequent lymphocytic destruction of myocytes (46).

Mitochondrial tRNA synthetases are nuclear-encoded and imported into the mitochondria where they fulfill the necessary function of charging mt-tRNAs.  In humans and mice, only 13 proteins involved in oxidative phosphorylation are encoded by mitochondrial DNA (Table 3), but all of these are essential for mitochondrial function (47).  Mitochondria are known as the power plant of the cell as they generate most of the cells supply of ATP. In addition to supplying cellular energy, mitochondria are involved in a range of other processes, such as signaling, cellular differentiation, cell death, as well as the control of the cell cycle and cell growth.  Thus, complex protein-import machineries exist in mitochondria to ensure the correct import, membrane translocation and sorting of the 1000–1500 distinct mitochondrial proteins that are synthesized on cytosolic ribosomes (8).  Although the mitochondrial genome encodes a full set of mt-tRNAs, import of cytoplasmic tRNAs can occur (48).

Several disorders are associated with inherited mitochondrial defects that are caused by mutations in genes encoding mitochondrial-specific proteins or tRNAs (2;49).  Mutations in mt-tRNAs usually result in the reduction of aminoacylation efficiency causing decreased mitochondrial protein synthesis and defects in oxidative phosphorylation.  Muscle, liver and neurons are often affected in inherited mitochondrial disorders as they are highly metabolic and require large amounts of ATP production for proper cellular functioning. tRNA and mitochondrial protein-linked disorders cover a wide range of symptoms and syndromes such as myopathies, encephalopathies, cardiopathies, deafness, ophthalmoplegia, and diabetes (49).  These disorders include Myoclonic Epilepsy and Red Ragged Fibers (MERFF; OMIM #540000), the progressive neurodegenerative disorder known as Leigh syndrome (OMIM #256000), MELAS syndrome (mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes; OMIM #540000), and Leber optic atrophy (OMIM #535000) (50).  The differences in clinical phenotypes in patients with these mt-tRNA mutations reflects the often heteroplasmic nature of these diseases and the metabolic needs of different tissues.  Mutations in mt-tRNA^cys cause encephalopathy and/or myopathy(51;52).

Similar phenotypes can also be caused by mutations in mt-ARSs.  Mutations in human RARS2 cause a form of pontocerebellar hypoplasia (PCH6; OMIM #611523), associated with reduced levels of charged mt-tRNA^arg and mitochondrial respiratory chain defects (53).  In yeast, ARS deficiencies cause respiration defects (54).  However, defects in mt-ARSs do not necessarily mimic mutations in the cognate tRNA.   Mutations in human DARS2 results in leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation (LBSL; OMIM #611105) (55), while mutations in mt-tRNA^asp cause myopathy (56).  Although the enzyme activities of DARS2 proteins from human patients were decreased, mitochondrial functions appeared to be normal (55).   

Putative Mechanism

Figure 7. The madcow mutation results in reduced CARS2 function. Quantitative Northern hybridization was performed with a mitochondrial tRNA cys -specific probe to assess aminoacylation levels in vivo. Aminoacylation levels of mitochondrial tRNA cys in madcow mice are comparable to C57BL/6J controls in brain and liver, but are drastically reduced in madcow heart, and slightly reduced in madcow skeletal muscle. Aminoacylation levels were quantitated from the upper band and are shown as a percentage of total mitochondrial tRNA cys . Lanes marked with a + indicated deacylation controls.

As the madcow mutation results in an amino acid change in a motif important for catalytic function of CARS2, the extent of aminoacylation and the stability of the mitochondrial tRNA^cys transcript was tested in various tissues from homozygous madcow and control males and females of young (6-8 weeks) and old (18 months) age groups using quantitative Northern blot hybridization and measuring the amount of the aminoacylated tRNA relative to total tRNA (Figure 7). Although aminoacylation was not detectable in the brains or livers of any of the mice, aminoacylation was clearly observed in the heart and skeletal muscle of wild type mice with activity decreasing with age in the heart.  In these tissues the catalytic function of CARS2 was found to be reduced in mutant animals.  These data experimentally prove that CARS2 can aminoacylate mitochondrial tRNA^cys.

Figure 8. Normal heart and mitochondrial morphology in madcow mice. (A) Top panels display hematoxylin and eosin staining of representative heart sections from madcow (mut) and control 9 month old females. Magnification is 40x. Bottom panels display electron microscopy of heart sections from the same animals. Magnification is 64,000x. (B) Quantitative PCR performed on mitochondrial and nuclear DNA obtained from 9 month old female mice. The quantity of mitochondrial DNA is normal in madcow animals.

As CARS2 is predicted to be necessary for mitochondrial protein synthesis, mitochondrial function may be compromised in madcow mice, particularly in the heart where diminished steady-state tRNA^cys aminoacylation was observed.  Histological analysis of heart tissue from 9 month old female madcow mice disclosed no abnormalities either by light microscopy or electron microscopy (Figure 8A).  Using quantitative PCR to compare the amount of mitochondrial DNA to the amount of nuclear DNA (57), madcow mice appear to have a normal number of mitochondrial genomes in the spleen, muscle and brain (Figure 8b).  Mitochondria from the brains and hearts of madcow and control animals were then isolated and functionally assessed examining oxygen consumption rates and activities of the four mitochondrial complexes involved in respiration.  Oxygen consumption rates and mitochondrial complex activity were normal in madcow mitochondria (Figure 9A,B).

Figure 9. Normal mitochondrial function in madcow mice. (A) Oxygen consumption of mitochondria isolated from 9 month old C57BL/6J and madcow animals. (B) Activities of the four mitochondrial complexes in madcow and control animals. (C) Mitochondrially-synthesized proteins are expressed normally in madcow mice.

Finally, mitochondrially-synthesized proteins were examined by Western blot.  11 of the 13 protein encoded by the mitochondrial genome contain cysteines (Table 3), but all proteins tested were expressed normally in madcow animals (Figure 9C).  Madcow and wild type mice were subjected to several stress tests including prolonged treadmill running and low temperatures. Madcow mice performed normally when subjected to prolonged and intensive exercise on a treadmill, and were able to maintain normal body temperatures when placed at 13^oC for 7 days (57).  These results further indicate normal mitochondrial function in madcow mice.

Table 3. Mitochondrial protein cysteine content and deficiency phenotypes

Mitochondrial Proteins	Amino Acid Length (mouse)	Location of cysteines (aa)	Phenotype
NADH dehydrogenase 1 (complex I)	318	301	MITOCHONDRIAL COMPLEX I DEFICIENCY (OMIM #252010); Leber optic atrophy; Leigh syndrome
NADH dehydrogenase 2 (complex I)	345	275
NADH dehydrogenase 3 (complex I)	115	39
NADH dehydrogenase 4 (complex I)	459	199, 276, 328
NADH dehydrogenase 4L (complex I)	98	32, 69, 98
NADH dehydrogenase 5 (complex I)	607	279, 291, 330, 342, 372, 402
NADH dehydrogenase 6 (complex I)	172	16, 40 104, 147
cytochrome b (complex III)	381	40, 70, 93	MITOCHONDRIAL COMPLEX III DEFICIENCY (OMIM #124000); MELAS;  certain alleles contribute to Leber optic atrophy
cytochrome c oxidase I (complex IV)	514	304, 498	MITOCHONDRIAL COMPLEX IV DEFICIENCY (OMIM #220110); sideroblastic anemia; Leber optic atrophy; alleles may contribute to Alzheimer’s
cytochrome c oxidase II (complex IV)	227	117, 196, 200 (copper binding site)
cytochrome c oxidase III (complex IV)	261	115, 218
ATPase 6 (complex V)	226	none	NARP (neuropathy, ataxia and retinitis pigmentosa; OMIM #551500); Leigh syndrome; Leber optic atrophy
ATPase 8 (complex V)	67	none

Despite the finding of diminished mitochondrial tRNA^cys aminoacylation in heart and skeletal muscle, homozygous madcow animals fail to display any defects in mitochondrial morphology or function.  These animals also appear to synthesize normal amounts of cysteine-containing mitochondrial proteins, and show a normal capacity for prolonged exercise and adaptation to low temperature.  However, mutations in mitochondrial aminoacyl-tRNA synthetases do not necessarily cause overt mitochondrial dysfunction, as manifested by inadequate electron transport or limitations in energy transduction.  Similar to the observations of mitochondrial function in madcow mice, humans with a mutation in DARS2 display reduced enzymatic activity but no defects in mitochondrial function. Like madcow mice, these patients display neurological defects, albeit distinct from those characteristic of madcow, including progressive cerebellar ataxia, spasticity and dorsal column dysfunction, sometimes with a mild cognitive deficit or decline (55). 

The basis for the neurobehavioral defects observed in madcow mice remains to be determined.  Madcow animals display normal brain morphology and mitochondrial function, as well as hearing.  However, the brain is highly sensitive to defects in mitochondrial function, and most disease-causing mutations found in genes encoding both cytoplasmic and mitochondrial ARSs are associated with neurological phenotypes.  In many of these cases, the affected ARS proteins are not expressed preferentially in the brain (2).  As a generalization, the tissue-specific effects of a hypomorphic mutation reflect:  1) the degree to which the mutated protein exists in excess of requirement within a given tissue; and 2) the degree to which the mutation diminishes activity or functionality of the affected protein within that tissue.  In the experiments shown above, the steady state tRNA^cys aminoacylation was beneath the level of detection in brain (as in liver).  It is possible that even relatively modest impairment of CARS2 catalytic activity, caused by the S305T mutation within a restricted subset of neurons or glial cells, might compromise mitochondrial protein synthesis so as to cause the observed neurobehavioral phenotype.  By contrast, tRNA^cys aminoacylation in the heart, while beneath detection at steady state in madcow animals, likely occurs at a pace sufficient to sustain adequate mitochondrial protein synthesis in cardiomyocytes.  In skeletal muscle, the effect of the mutation is comparatively modest, in that only a 25% to 50% decrement in the steady state level of aminoacylated tRNA^cys is observed.

While the residue in the critical ATP-binding motif of CARS2 altered by the madcow mutation is invariably a serine in all eukaryotic tRNA synthetases, some bacterial species display other amino acids, including threonines, at this position in some tRNA synthetase sequences (58).  Targeted mutagenesisof the residues in the KMSKS motif of tyrosyl-tRNA synthetase suggests that nonconservative mutations of the first serine only mildly affect enzyme activity (16), and that replacement of this residue with a threonine does not affect enzyme activity in bacteria(58).  Thus, the serine to threonine change in the madcow CARS2 protein likely permits partial retention of enzymatic activity.

Temporal progression of the madcow phenotype may result from accumulation of mitochondrial mutations with increasing age (49).  This hypothesis assumes that diminished mitochondrial function caused by the madcow mutation, however slight, becomes functionally significant as mitochondria are damaged by mutation.  Alternatively, temporal progression may result from diminished Cars2 expression in specific cells of the CNS, occurring with age.  The appearance of the madcow phenotype at an earlier age in female mice may suggest sexual dimorphism in gene expression at the Cars2 locus, and is likely to be hormone-dependent.

Primers

Primers cannot be located by automatic search.

Genotyping

Madcow genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

Primers for PCR amplification

Mad(F): 5’- GCTGTGTGGACCTGTTATTGTACCCTCACTG -3’

Mad(R): 5’- GCCCCTTGAAACAAGAAGGAGCAATTCCCTG -3’

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

Primers for sequencing

Mad_seq(F): 5’- TATTGTCCTGGAAGAGCACAC -3’

Mad_seq(R): 5’- GGCTAGGTCAGACTACATGTC -3’

The following sequence of 481 nucleotides (from Genbank genomic region NC_000074 for linear DNA sequence of Cars2) is amplified:

29358                   gct gtgtggacct gttattgtac cctcactgag cagtattgtc

29401 ctggaagagc acacactgca ggtgcaggtt cctgtcctgt atcctgtggg gaaacacagg

29461 cctgtggcta cactggccca gctgtgtcta gctaggctca gggctataga cagagaagct

29521 gaactccctt ctggtgccct ggtaactgtg catgggtggg gcgggctcag ggctgcctaa

29581 aagagcctgt acctggagtg gatatttctc tttttgtttc aggtcatttg catgtgaaag

29641 gcacagaaga aaagatgtcc aaatccctaa aaaactatat caccattaag gtaacgtcaa

29701 tagacagtgc cttcctgcgt gagtggctga tggctgctag gggcctctgt agggtgaaat

29761 cacatcacta gacatgtagt ctgacctagc cctgcatggg ctgcctccag ggaattgctc

29821 cttcttgttt caaggggc

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

  1. Beutler, B., Du, X., and Xia, Y. (2007) Precis on Forward Genetics in Mice. Nat. Immunol.. 8, 659-664.

  2. Antonellis, A., and Green, E. D. (2008) The Role of Aminoacyl-tRNA Synthetases in Genetic Diseases. Annu. Rev. Genomics Hum. Genet.. 9, 87-107.

  3. Eriani, G., Delarue, M., Poch, O., Gangloff, J., and Moras, D. (1990) Partition of tRNA Synthetases into Two Classes Based on Mutually Exclusive Sets of Sequence Motifs. Nature. 347, 203-206.

  4. Schimmel, P. (2008) Development of tRNA Synthetases and Connection to Genetic Code and Disease. Protein Sci.. 17, 1643-1652.

  5. Rodin, S. N., and Ohno, S. (1995) Two Types of Aminoacyl-tRNA Synthetases could be Originally Encoded by Complementary Strands of the Same Nucleic Acid. Orig. Life Evol. Biosph.. 25, 565-589.

  6. Pham, Y., Li, L., Kim, A., Erdogan, O., Weinreb, V., Butterfoss, G. L., Kuhlman, B., and Carter, C. W.,Jr. (2007) A Minimal TrpRS Catalytic Domain Supports sense/antisense Ancestry of Class I and II Aminoacyl-tRNA Synthetases. Mol. Cell. 25, 851-862. 

  7. Bonnefond, L., Fender, A., Rudinger-Thirion, J., Giege, R., Florentz, C., and Sissler, M. (2005) Toward the Full Set of Human Mitochondrial Aminoacyl-tRNA Synthetases: Characterization of AspRS and TyrRS. Biochemistry. 44, 4805-4816.

  8. Baker, M. J., Frazier, A. E., Gulbis, J. M., and Ryan, M. T. (2007) Mitochondrial Protein-Import Machinery: Correlating Structure with Function. Trends Cell Biol.. 17, 456-464.

  9. Bonnefond, L., Frugier, M., Giege, R., and Rudinger-Thirion, J. (2005) Human Mitochondrial TyrRS Disobeys the Tyrosine Identity Rules. RNA. 11, 558-562.

  10. Bonnefond, L., Frugier, M., Touze, E., Lorber, B., Florentz, C., Giege, R., Sauter, C., and Rudinger-Thirion, J. (2007) Crystal Structure of Human Mitochondrial Tyrosyl-tRNA Synthetase Reveals Common and Idiosyncratic Features. Structure. 15, 1505-1516.

  11. Fender, A., Sauter, C., Messmer, M., Putz, J., Giege, R., Florentz, C., and Sissler, M. (2006) Loss of a Primordial Identity Element for a Mammalian Mitochondrial Aminoacylation System. J. Biol. Chem.. 281, 15980-15986.

  12. Newberry, K. J., Hou, Y. M., and Perona, J. J. (2002) Structural Origins of Amino Acid Selection without Editing by Cysteinyl-tRNA Synthetase. EMBO J.. 21, 2778-2787.

  13. Hauenstein, S., Zhang, C. M., Hou, Y. M., and Perona, J. J. (2004) Shape-Selective RNA Recognition by Cysteinyl-tRNA Synthetase. Nat. Struct. Mol. Biol.. 11, 1134-1141.

  14. First, E. A., and Fersht, A. R. (1995) Analysis of the Role of the KMSKS Loop in the Catalytic Mechanism of the Tyrosyl-tRNA Synthetase using Multimutant Cycles. Biochemistry. 34, 5030-5043.

  15. Chan, K. W., and Koeppe, R. E.,2nd. (1995) Role of Lysine-195 in the KMSKS Sequence of E. Coli Tryptophanyl-tRNA Synthetase. FEBS Lett.. 363, 33-36.

  16. Austin, J., and First, E. A. (2002) Comparison of the Catalytic Roles Played by the KMSKS Motif in the Human and Bacillus Stearothermophilus Trosyl-tRNA Synthetases. J. Biol. Chem.. 277, 28394-28399.

  17. Silvian, L. F., Wang, J., and Steitz, T. A. (1999) Insights into Editing from an Ile-tRNA Synthetase Structure with tRNAile and Mupirocin. Science. 285, 1074-1077.

  18. Fukai, S., Nureki, O., Sekine, S., Shimada, A., Tao, J., Vassylyev, D. G., and Yokoyama, S. (2000) Structural Basis for Double-Sieve Discrimination of L-Valine from L-Isoleucine and L-Threonine by the Complex of tRNA(Val) and Valyl-tRNA Synthetase. Cell. 103, 793-803.

  19. Geslain, R., and Ribas de Pouplana, L. (2004) Regulation of RNA Function by Aminoacylation and Editing? Trends Genet.. 20, 604-610.

  20. Zhang, C. M., Christian, T., Newberry, K. J., Perona, J. J., and Hou, Y. M. (2003) Zinc-Mediated Amino Acid Discrimination in Cysteinyl-tRNA Synthetase. J. Mol. Biol.. 327, 911-917.

  21. Motorin, Y., and Waller, J. P. (1998) Purification and Properties of Cysteinyl-tRNA Synthetase from Rabbit Liver. Biochimie. 80, 579-590.

  22. Davidson, E., Caffarella, J., Vitseva, O., Hou, Y. M., and King, M. P. (2001) Isolation of Two cDNAs Encoding Functional Human Cytoplasmic Cysteinyl-tRNA Synthetase. Biol. Chem.. 382, 399-406.

  23. Liu, C., Gamper, H., Shtivelband, S., Hauenstein, S., Perona, J. J., and Hou, Y. M. (2007) Kinetic Quality Control of Anticodon Recognition by a Eukaryotic Aminoacyl-tRNA Synthetase. J. Mol. Biol.. 367, 1063-1078.

  24. Nissen, P., Thirup, S., Kjeldgaard, M., and Nyborg, J. (1999) The Crystal Structure of Cys-tRNACys-EF-Tu-GDPNP Reveals General and Specific Features in the Ternary Complex and in tRNA. Structure. 7, 143-156.

  25. Komatsoulis, G. A., and Abelson, J. (1993) Recognition of tRNA(Cys) by Escherichia Coli Cysteinyl-tRNA Synthetase. Biochemistry. 32, 7435-7444.

  26. Lipman, R. S., and Hou, Y. M. (1998) Aminoacylation of tRNA in the Evolution of an Aminoacyl-tRNA Synthetase. Proc. Natl. Acad. Sci. U. S. A.. 95, 13495-13500.

  27. Hou, Y. M., Motegi, H., Lipman, R. S., Hamann, C. S., and Shiba, K. (1999) Conservation of a tRNA Core for Aminoacylation. Nucleic Acids Res.. 27, 4743-4750.

  28. Shitivelband, S., and Hou, Y. M. (2005) Breaking the Stereo Barrier of Amino Acid Attachment to tRNA by a Single Nucleotide. J. Mol. Biol.. 348, 513-521.

  29. Yuan, J., Sheppard, K., and Soll, D. (2008) Amino Acid Modifications on tRNA. Acta Biochim. Biophys. Sin. (Shanghai). 40, 539-553.

  30. Palioura, S., Sherrer, R. L., Steitz, T. A., Soll, D., and Simonovic, M. (2009) The Human SepSecS-tRNASec Complex Reveals the Mechanism of Selenocysteine Formation. Science. 325, 321-325.

  31. Vats, K. R., Ishwad, C., Singla, I., Vats, A., Ferrell, R., Ellis, D., Moritz, M., Surti, U., Jayakar, P., Frederick, D. R., and Vats, A. N. (2006) A Locus for Renal Malformations Including Vesico-Ureteric Reflux on Chromosome 13q33-34. J. Am. Soc. Nephrol.. 17, 1158-1167.

  32. Park, S. G., Ewalt, K. L., and Kim, S. (2005) Functional Expansion of Aminoacyl-tRNA Synthetases and their Interacting Factors: New Perspectives on Housekeepers. Trends Biochem. Sci.. 30, 569-574.

  33. Lee, Y. N., Nechushtan, H., Figov, N., and Razin, E. (2004) The Function of Lysyl-tRNA Synthetase and Ap4A as Signaling Regulators of MITF Activity in FcepsilonRI-Activated Mast Cells. Immunity. 20, 145-151.

  34. Greenberg, Y., King, M., Kiosses, W. B., Ewalt, K., Yang, X., Schimmel, P., Reader, J. S., and Tzima, E. (2008) The Novel Fragment of Tyrosyl tRNA Synthetase, Mini-TyrRS, is Secreted to Induce an Angiogenic Response in Endothelial Cells. FASEB J.. 22, 1597-1605.

  35. Park, S. G., Kim, H. J., Min, Y. H., Choi, E. C., Shin, Y. K., Park, B. J., Lee, S. W., and Kim, S. (2005) Human Lysyl-tRNA Synthetase is Secreted to Trigger Proinflammatory Response. Proc. Natl. Acad. Sci. U. S. A.. 102, 6356-6361.

  36. Wakasugi, K., and Schimmel, P. (1999) Two Distinct Cytokines Released from a Human Aminoacyl-tRNA Synthetase. Science. 284, 147-151.

  37. Wakasugi, K., Slike, B. M., Hood, J., Ewalt, K. L., Cheresh, D. A., and Schimmel, P. (2002) Induction of Angiogenesis by a Fragment of Human Tyrosyl-tRNA Synthetase. J. Biol. Chem.. 277, 20124-20126.

  38. Howard, O. M., Dong, H. F., Yang, D., Raben, N., Nagaraju, K., Rosen, A., Casciola-Rosen, L., Hartlein, M., Kron, M., Yang, D., Yiadom, K., Dwivedi, S., Plotz, P. H., and Oppenheim, J. J. (2002) Histidyl-tRNA Synthetase and Asparaginyl-tRNA Synthetase, Autoantigens in Myositis, Activate Chemokine Receptors on T Lymphocytes and Immature Dendritic Cells. J. Exp. Med.. 196, 781-791.

  39. Wakasugi, K., Slike, B. M., Hood, J., Otani, A., Ewalt, K. L., Friedlander, M., Cheresh, D. A., and Schimmel, P. (2002) A Human Aminoacyl-tRNA Synthetase as a Regulator of Angiogenesis. Proc. Natl. Acad. Sci. U. S. A.. 99, 173-177.

  40. Sampath, P., Mazumder, B., Seshadri, V., Gerber, C. A., Chavatte, L., Kinter, M., Ting, S. M., Dignam, J. D., Kim, S., Driscoll, D. M., and Fox, P. L. (2004) Noncanonical Function of Glutamyl-Prolyl-tRNA Synthetase: Gene-Specific Silencing of Translation. Cell. 119, 195-208.

  41. Ko, Y. G., Kim, E. Y., Kim, T., Park, H., Park, H. S., Choi, E. J., and Kim, S. (2001) Glutamine-Dependent Antiapoptotic Interaction of Human Glutaminyl-tRNA Synthetase with Apoptosis Signal-Regulating Kinase 1. J. Biol. Chem.. 276, 6030-6036.

  42. Seburn, K. L., Nangle, L. A., Cox, G. A., Schimmel, P., and Burgess, R. W. (2006) An Active Dominant Mutation of Glycyl-tRNA Synthetase Causes Neuropathy in a Charcot-Marie-Tooth 2D Mouse Model. Neuron. 51, 715-726.

  43. Chihara, T., Luginbuhl, D., and Luo, L. (2007) Cytoplasmic and Mitochondrial Protein Translation in Axonal and Dendritic Terminal Arborization. Nat. Neurosci.. 10, 828-837.

  44. Lee, J. W., Beebe, K., Nangle, L. A., Jang, J., Longo-Guess, C. M., Cook, S. A., Davisson, M. T., Sundberg, J. P., Schimmel, P., and Ackerman, S. L. (2006) Editing-Defective tRNA Synthetase Causes Protein Misfolding and Neurodegeneration. Nature. 443, 50-55.

  45. Pezzolesi, M. G., Poznik, G. D., Mychaleckyj, J. C., Paterson, A. D., Barati, M. T., Klein, J. B., Ng, D. P., Placha, G., Canani, L. H., Bochenski, J., Waggott, D., Merchant, M. L., Krolewski, B., Mirea, L., Wanic, K., Katavetin, P., Kure, M., Wolkow, P., Dunn, J. S., Smiles, A., Walker, W. H., Boright, A. P., Bull, S. B., DCCT/EDIC Research Group, Doria, A., Rogus, J. J., Rich, S. S., Warram, J. H., and Krolewski, A. S. (2009) Genome-Wide Association Scan for Diabetic Nephropathy Susceptibility Genes in Type 1 Diabetes. Diabetes. 58, 1403-1410.   46. Park, S. G., Schimmel, P., and Kim, S. (2008) Aminoacyl tRNA Synthetases and their Connections to Disease. Proc. Natl. Acad. Sci. U. S. A.. 105, 11043-11049.   47. Schaefer, A. M., Taylor, R. W., and Turnbull, D. M. (2001) The Mitochondrial Genome and Mitochondrial Muscle Disorders. Curr. Opin. Pharmacol.. 1, 288-293.

  48. Rubio, M. A., Rinehart, J. J., Krett, B., Duvezin-Caubet, S., Reichert, A. S., Soll, D., and Alfonzo, J. D. (2008) Mammalian Mitochondria have the Innate Ability to Import tRNAs by a Mechanism Distinct from Protein Import. Proc. Natl. Acad. Sci. U. S. A.. 105, 9186-9191.

  49. Levinger, L., Morl, M., and Florentz, C. (2004) Mitochondrial tRNA 3' End Metabolism and Human Disease. Nucleic Acids Res.. 32, 5430-5441.

  50. Schapira, A. H. (2006) Mitochondrial Disease. Lancet. 368, 70-82.

  51. Karadimas, C., Tanji, K., Geremek, M., Chronopoulou, P., Vu, T., Krishna, S., Sue, C. M., Shanske, S., Bonilla, E., DiMauro, S., Lipson, M., and Bachman, R. (2001) A5814G Mutation in Mitochondrial DNA can Cause Mitochondrial Myopathy and Cardiomyopathy. J. Child Neurol.. 16, 531-533.

  52. Scuderi, C., Borgione, E., Musumeci, S., Elia, M., Castello, F., Fichera, M., Davidzon, G., and DiMauro, S. (2007) Severe Encephalomyopathy in a Patient with Homoplasmic A5814G Point Mutation in Mitochondrial tRNACys Gene. Neuromuscul. Disord.. 17, 258-261.

  53. Edvardson, S., Shaag, A., Kolesnikova, O., Gomori, J. M., Tarassov, I., Einbinder, T., Saada, A., and Elpeleg, O. (2007) Deleterious Mutation in the Mitochondrial Arginyl-Transfer RNA Synthetase Gene is Associated with Pontocerebellar Hypoplasia. Am. J. Hum. Genet.. 81, 857-862.

  54. Tzagoloff, A., and Shtanko, A. (1995) Mitochondrial and Cytoplasmic Isoleucyl-, Glutamyl- and Arginyl-tRNA Synthetases of Yeast are Encoded by Separate Genes. Eur. J. Biochem.. 230, 582-586.

  55. Scheper, G. C., van der Klok, T., van Andel, R. J., van Berkel, C. G., Sissler, M., Smet, J., Muravina, T. I., Serkov, S. V., Uziel, G., Bugiani, M., Schiffmann, R., Krageloh-Mann, I., Smeitink, J. A., Florentz, C., Van Coster, R., Pronk, J. C., and van der Knaap, M. S. (2007) Mitochondrial Aspartyl-tRNA Synthetase Deficiency Causes Leukoencephalopathy with Brain Stem and Spinal Cord Involvement and Lactate Elevation. Nat. Genet.. 39, 534-539.

  56. Seneca, S., Goemans, N., Van Coster, R., Givron, P., Reybrouck, T., Sciot, R., Meulemans, A., Smet, J., and Van Hove, J. L. (2005) A Mitochondrial tRNA Aspartate Mutation Causing Isolated Mitochondrial Myopathy. Am. J. Med. Genet. A.. 137, 170-175.

  57. Villena, J. A., Hock, M. B., Chang, W. Y., Barcas, J. E., Giguere, V., and Kralli, A. (2007) Orphan Nuclear Receptor Estrogen-Related Receptor Alpha is Essential for Adaptive Thermogenesis. Proc. Natl. Acad. Sci. U. S. A.. 104, 1418-1423.

  58. Kamijo, S., Fujii, A., Onodera, K., and Wakabayashi, K. (2009) Analyses of Conditions for KMSSS Loop in Tyrosyl-tRNA Synthetase by Building a Mutant Library. J. Biochem.. .