Phenotypic Mutation 'bat'

• Allele: bat
• Mutation Type: critical splice donor site (1 bp from exon)
• Chromosome: 4
• Coordinate: 82,983,060 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Frem1
• Gene Name: Fras1 related extracellular matrix protein 1
• Synonym(s): eyes2, heb, eye, crf11, QBRICK
• Chromosomal Location: 82,897,927-83,052,339 bp (-)
• MGI Phenotype: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis.
• Mapped: Yes
• Institutional Source: Beutler Lab
• Ref Sequences:
  Ensembl: ENSMUSP00000071627
• Gene Model: not available
• Phenotypic Category: limbs/digits/tail phenotype, renal/urinary system, skin/coat/nails, vision/eye
• Penetrance: 100% on C57BL/6J background; approximately 70% on C57BL/6J:C3H/HeJ hybrid background
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos
• MMRRC Submission: 030387-UCD
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2008-02-14
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Xin Du, Bruce Beutler

Accession Number

NCBI RefSeq: NM_177863; MGI: 2670972

Alleles Listed at MGI

All alleles(4) : Targeted, knock-out(1) Spontaneous(1) Chemically induced(2)

Phenotypic Description

Figure 1. (A) Adult bat mice display cryptophthalmos. (B) Bat embryos develop subepidermal blisters around the eyes and sides of the head from ~13.5 DPC (arrowheads). Figure is reproduced from reference ( 1 ).

Bat was identified as a visible phenotype among ENU-induced G3 mice. Homozygous bat mice display a range of defects including cryptophthalmos (skin covering the globe of the eye), occasional hindlimb syndactyly (fusion of fingers or toes), and renal anomalies (unilateral agenesis of the kidney) (1). From 13.5 dpc (days post conception), bat embryos develop subepidermal blisters (“blebs”) around the eyes and the sides of the head; postnatal bat mice do not exhibit such blebs. Light microscopic analysis reveals that blebs are characterized by a separation of the dermal and epidermal layers of the skin, and by electron microscopy, it is seen that the dissection occurs at the basement membrane underlying epidermal cells. Bat mutants have no true eyelids; eyes are permanently closed due to a pseudoblepharon (a layer of skin covering the eye), occurring either unilaterally or bilaterally. Approximately two-thirds of the homozygous stock is affected in both eyes, with the remaining one-third in only one eye (absence of a pseudoblepharon in both eyes is rarely observed). Histological analysis reveals that the corneal epithelium, conjunctiva epithelium, and eyelid epithelium are absent.

 

Unilateral renal agenesis is found in approximately 20% of adult bat homozygotes.

 

Nature of Mutation

The bat mutation mapped to Chromosome 4 and corresponds to a T to C transition in the donor splice site of intron 25 (GTACT->GCACT) of the Frem1 gene (position ­85133 in the Genbank genomic region NC_000070 for linear genomic DNA sequence of Frem1). RT-PCR analysis indicates that the mutation results in skipping of exon 25, and destroys the reading frame thereafter. Thus, 39 nucleotides from exon 26 are transcribed, encoding 12 aberrant amino acids, followed by a premature stop codon. No splicing between exons 25 and 26 is detected. Frem1 contains 36 exons.

 

     <--exon 24  <--exon 25 intron 25--> exon 26-->
80779 ACAATCCAG……ACAACAACAGGTACTTTCC……………GTGAATTCATCCACGAGCGATTTAGCCAGAAGGACTTAA 86136

1635  -T--I--Q-……-T--T--T-               -V--N--S--S--T--S--D--L--A--R--R--T--*  1649

      correct     deleted                                aberrant

 

The donor splice site of intron 25, which is destroyed by the bat mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.

Protein Prediction

Figure 2. Domain structure of FREM1. The bat mutation introduces 12 aberrant amino acids before premature termination of FREM1.

FREM1 is a 2191 amino acid protein with similarity to the extracellular matrix (ECM) protein encoded by Fras1 [Fraser syndrome 1 homolog (human)]. Sequence analysis of FREM1 reveals several predicted structural domains (Figure 2). Following an N-terminal signal sequence are twelve chondroitin sulfate proteoglycan (CSPG) repetitive elements, first described for the NG2 proteoglycan core protein (also called CSPG4) (2;3). Weak sequence similarity is found between CSPG and cadherin repeats, and comparison of the predicted structure of the CSPG repeat and known cadherin repeat structure suggests that they share the same secondary structural fold (3). CSPG repeat domains are thought to form a structural unit containing six β-strands (as in the cadherin repeat in the second domain of N-cadherin), with multiple CSPG repeats folding into a rod-like three dimensional structure (3). Based on studies of the CSPG repeat region of NG2, it has been proposed that CSPG repeats serve as attachment sites for glycosaminoglycans (2), as collagen-binding sites (4), or as binding sites for growth factors [basic fibroblast growth factor (bFGF) and platelet-derived growth factor (PDGF)-AA in the case of NG2] (5).

 

A CALX-β domain, found in the intracellular regulatory exchanger loop of Na⁺-Ca²⁺ exchange proteins, follows the twelve CSPG repeats in FREM1 (1). CALX-β domains are composed of two Ca²⁺-binding domains (CBD), one of which is thought to function as the primary Ca²⁺ sensor in Na⁺-Ca²⁺ exchange proteins (6). It is unknown whether Ca²⁺ sensing or binding is required for FREM1 function. The C terminus of FREM1 contains a C-type lectin domain. Several putative glycosaminoglycan modification sites were identified in FREM1. Unlike FRAS1, no furin, von Willebrand factor type C (VWFC), or PDZ domains are found in FREM1. In addition, no transmembrane domain is predicted for FREM1 (1).

 

Based on the presence of the CSPG repeat domain, two related Frem family genes, Frem2 and Frem3, were identified in mouse and human (1). FREM3 lacks transmembrane and C-terminal PDZ domains; FREM2 contains both of these domains.

 

The bat mutation introduces 12 aberrant amino acids before premature termination of FREM1 toward the C-terminal end of the CSPG repeat elements.

Expression/Localization

In general, Frem1 is expressed at high levels in tissues in which a differentiating epidermis is interacting with an underlying mesenchyme. Thus, Frem1 transcript is expressed during embryogenesis in developing epidermal appendages including vibrissae, cranial and trunk hair follicles, Meibomian glands, teeth, footpads, eyelash primordia, and invaginating mammary glands (1). In the limbs, Frem1 is detected in sheets of dermal cells on the apical and basal surfaces of the digits. Frem1 expression is typically restricted to the mesenchymal components of these tissues. The expression level of Frem1 appears to be highest in dermal cells underlying the epidermis in the head, limbs and eyelids. Embryonic kidneys express Frem1 from 12.5 dpc in the mesenchyme surrounding the branching ureteric tree, and in cells of the differentiating nephron by 13.5 dpc (1). The timing of expression differs among these tissues [e.g. expression turned on first (at 10.5 dpc) in eyelids and sensory vibrissae, and last (at 16.5 dpc) in limbs, paw pads and Meibomian glands], although expression levels in all tissues appear to peak during the period of embryogenesis and then disappear postnatally (except in dermal papillae).

 

FREM1 is most likely secreted from dermal cells into the basement membrane (1;7).

Background

Fraser syndrome (OMIM #219000), first described in 1962, is a rare, multi-system, congenital disorder inherited in an autosomal recessive manner, occurring in about 1 in 10,000 still births and 0.43 in 100,000 live births [reviewed in (8)]. Autozygosity mapping and gene sequencing in Fraser syndrome kindreds have revealed mutations in FRAS1 (9;10) and FREM2 (11). Fraser syndrome is characterized by defects in epidermal adhesion, which result in the formation of large blisters during embryonic development, and lead to a variety of postnatal defects. Major postnatal characteristics of Fraser syndrome include cryptophthalmos, cutaneous syndactyly of varying severity, and abnormal or ambiguous genitalia. Surgery can usually ameliorate the developmental eye defect and results in the ability to distinguish light, dark and some movement. Minor characteristics of Fraser syndrome include laryngeal stenosis (narrowing or constriction of laryngeal airway), renal dysgenesis or agenesis, skeletal defects, pulmonary hyperplasia, ear malformations with conductive deafness, orofacial clefting, gastrointestinal malformations and heart defects. Laryngeal stenosis and renal a/dysgenesis occur so frequently that their characterization as major features of Fraser syndrome has been suggested (8). The diagnosis of patients with Fraser syndrome requires the presence of two major and one minor, or one major and four minor features of the disease.

 

The mouse blebbed (bl), eye blebs (eb), head blebs (heb) and myelencephalic blebs (my) phenotypes (collectively termed “blebs phenotypes”) are caused by mutations in Fras1 (9;10), Grip1 (12), Frem1 (1) and Frem2 (11), respectively. Like humans with Fraser syndrome, these mouse mutants develop large fluid-filled epidermal blisters in utero, and are born with cryptophthalmos, renal anomalies and syndactyly. These phenotypes differ in frequency among mutants, and also between mutants on different genetic backgrounds (8). Defects in neural tube closure have also been reported in eb, my and heb mice (13-15). Interestingly, although linkage has been established in some cases, no mutations in coding sequence or intron/exon boundaries have been found in human FREM1 or GRIP1 in Fraser syndrome patients (8), perhaps suggesting that mutations of these genes in humans leads to prenatal death as a result of more severe developmental phenotypes. As mentioned above (Protein Prediction), FREM3 is a third member of the FREM family, but no mutations in FREM3 have been found in either mouse blebs mutants or human Fraser syndrome patients.

 

In all blebs mutants, and in bat mice, blisters arise at approximately 12 days of gestation. They occur over the eyes, extremities or hindbrain, and either resolve by 16 dpc or become hemorrhagic, sometimes leading to resorption of the embryo. By the time the mice are born, blisters are no longer observed, suggesting that FRAS1 and FREM proteins are transiently required during embryogenesis and that other proteins can compensate for their loss during later periods. The blisters are created by the loss of adhesion of the developing epidermis from the underlying basement membrane (BM), a zone of ECM proteins that links and anchors the epidermis and dermis and mediates signaling between the two. Studies of Fraser syndrome patients and blebs mutants demonstrate that without exception, blistering occurs below the level of the BM, and specifically below the lamina densa, one of the BM layers rich in collagen IV (1;10-12). Blistering at the same level is observed in human patients with dystrophic epidermolysis bullosa (DEB; OMIM #226600), caused by mutations of collagen VII, which anchors the BM to the dermis (16). However, blistering occurs primarily after birth (16); additionally, Fras1 and Frem1 mutants have normal deposition of collagen VII (1;10), suggesting that blistering in DEB is distinct from that in blebs mice. CSPG repeat domains in recombinant NG2 protein bind to collagens V and VI (4). Whether CSPG repeats in FRAS1 and FREM proteins bind any collagens to mediate adhesion requires further study. A more widespread epidermal blistering phenotype is seen in PDGF receptor (PDGFR)-α- and PDGF-C-deficient mice (17;18). PDGF signaling is ubiquitous and controls cell proliferation, survival, morphology and movement. Together with data indicating that CSPG repeats in NG2 can bind to PDGF-AA (5), these findings raise the possibility that FRAS1 and FREM proteins regulate signaling from growth factor receptors to regulate epidermal adhesion.

 

The putative protein domains identified in FRAS1 and FREM proteins, which include ECM-interaction (CSPG repeat, lectin and VWFC) and Ca²⁺-binding (CALX-β) domains, together with the phenotype of the blebs mutants, strongly suggest that FRAS1 and FREM proteins interact with ECM components to maintain epidermal adhesion during embryogenesis. A recent study indicates that FREM1 can interact via a canonical RGD integrin-binding motif with αv- and α8-containing integrins during cell adhesion in vitro (19). Integrin αv- and α8-deficient mice do not have skin defects (20;21), suggesting that integrin-binding is not the primary mechanism for FREM1 action. Notably, integrin α8-null mice display renal dysgenesis or agenesis (21); FREM1-integrin α8 interactions may contribute to renal development.

Putative Mechanism

Recent studies provide evidence that FRAS1, FREM1 and FREM2 proteins interact in a complex in the basement membrane (12;22). FRAS1, FREM1 and FREM2 can be coimmunoprecipitated from the conditioned medium of 293F cells transfected with FREM1 when they are cocultured with cells expressing both FRAS1 and FREM2 (22). However, FREM1 fails to co-precipitate with FRAS1 when cells expressing FREM1 are cocultured with cells expressing FRAS1 alone. These results suggest that FRAS1 and FREM2, putative transmembrane spanning proteins, can be shed into the media, possibly via furin cleavage. Although the domains required for interaction are unknown, FREM2 appears to bind to both FRAS1 and FREM1 and mediate complex formation.

 

The expression pattern of FREM1 is approximately complementary to that of FRAS1 and FREM2, with all three proteins at the edge of the basement membrane, but FREM1 on the dermal side and FRAS1 and FREM2 on the epidermal side (1;22). FRAS1 expression at the basement membrane is reduced in both Frem1^-/- and Frem2^my/my mutant embryos (22); a reduction of FREM1 at the basement membrane is also observed in Fras1^-/- mice (23). In Grip1^eb/eb mutants, localization of all three of FRAS1, FREM1 and FREM2 is reduced at the basement membrane (12;22). Together with the results from coimmunoprecipitation experiments, these data suggest that FRAS1, FREM1 and FREM2 interact to facilitate each other’s deposition at the basement membrane.

 

Figure 3. Putative mechanism of FREM1. FRAS1, FREM1 and FREM2 may interact in a complex in the basement membrane. Around 10.5 dpc, deposition of FRAS1 and FREM2 to the basement membrane is mediated by GRIP1 while FREM1 is independently secreted from the dermis. FRAS1 and FREM2 can be shed into the media, possibly via furin cleavage. FREM2 appears to bind to both FRAS1 and FREM1 and mediate complex formation. Around 17.5 dpc, expression of collagen VII rapidly increases in the basement membrane, and may serve to mediate epidermal adhesion after FRAS1 and FREM protein expression declines.

A model for FRAS1, FREM1, FREM2 and GRIP1 function in skin development has been proposed (24): around 10.5 dpc, deposition of FRAS1 and FREM2 to the basement membrane is mediated by GRIP1 (12) while FREM1 is independently secreted from the dermis into the basement membrane (7;22) (Figure 3). FRAS1 and FREM2 may be released into the basement membrane by furin cleavage. FREM2 mediates complex formation between FREM1 and FRAS1, and the complex persists for several days of embryonic development (until about 16 dpc) (7). Later on, around 17.5 dpc, expression of collagen VII rapidly increases in the basement membrane, and may serve to mediate epidermal adhesion after FRAS1 and FREM protein expression declines (7;16).

 

The mechanisms by which FRAS1 and FREM proteins regulate renal development are yet unknown, but probably do not involve defective adhesion or blister formation. As mentioned above, FREM1 interacts with integrin α8 in vitro, and integrin α8-null mice exhibit renal agenesis, raising the possibility of an interaction between FREM1 and integrin α8 during kidney development (19;21).

 

The Frem1^bat allele encodes a mutant FREM1 protein truncated prematurely near the C-terminal end of the CSPG repeat domains. Twelve aberrant amino acids are inserted just before the premature stop codon. Interestingly, in contrast to Frem1^-/- mice, FRAS1 is localized normally in homozygous bat mice (1;22). This suggests that the protein encoded by Frem1^bat retains some function, but this residual function is not sufficient to mediate normal epidermal development. Alternatively, FRAS1 expression at the basement membrane is not absolutely required for normal epidermal adhesion. The CALX-β domain is lacking in the bat-mutant FREM1 protein, potentially indicating a functional role for this domain during development. A point mutation in one of five CALX-β domains of FREM2 has been reported in Fraser syndrome patients, although how the mutation affects protein function is not understood (11).

Primers

Primers cannot be located by automatic search.

Genotyping

Bat genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

 

Primers

Bat(F): 5’- AACAAGACAGGCTTCGGCAGAAATC -3’

Bat(R): 5’- AGCACTCACCAAACGGGCCTACCTAC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:15

4) 72°C             0:30

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

The following sequence of 479 nucleotides (from Genbank genomic region NC_000070 for linear genomic sequence of Frem1) is amplified:

 

84789         aa caagacaggc ttcggcagaa atcaacagat aaggactcca agcgatctct

84841 gggttgagga gttcactatt gttgagccag gaaagccctg tgtagcatag ggagagaagt

84901 ccttgtgtaa cgctacgttg gtgattcagg tggatcagct ggacaaggca gcgccccgta

84961 tcacacactt gcactcccct actcaagtgg ggctcttgaa aaatggctgc tatgggattt

85021 acatcacttc ccgtgtgctg aaggcatcag accctgacac agaggatgac cagatcatct

85081 ttaagatttt acgaggccca ttgtacggac gtctggagaa cacaacaaca ggtactttcc

85141 atcttttttg ggggggcggg tgtactttcc atctcagtcc ttgtaagtcc tcattttaaa

85201 ctactagttg ctggcagagc taaagaggaa ctcaggtaag tgtaggtagg cccgtttggt

85261 gagtgct

 

Primer binding sites are underlined; the mutated T is highlighted in red.

References

   1.  Smyth, I., Du, X., Taylor, M. S., Justice, M. J., Beutler, B., and Jackson, I. J. (2004) The extracellular matrix gene Frem1 is essential for the normal adhesion of the embryonic epidermis, Proc. Natl. Acad. Sci U. S. A 101, 13560-13565.

   2.  Nishiyama, A., Dahlin, K. J., Prince, J. T., Johnstone, S. R., and Stallcup, W. B. (1991) The primary structure of NG2, a novel membrane-spanning proteoglycan, J Cell Biol. 114, 359-371.

   3.  Staub, E., Hinzmann, B., and Rosenthal, A. (2002) A novel repeat in the melanoma-associated chondroitin sulfate proteoglycan defines a new protein family, FEBS Lett 527, 114-118.

   4.  Tillet, E., Ruggiero, F., Nishiyama, A., and Stallcup, W. B. (1997) The membrane-spanning proteoglycan NG2 binds to collagens V and VI through the central nonglobular domain of its core protein, J Biol. Chem. 272, 10769-10776.

   5.  Goretzki, L., Burg, M. A., Grako, K. A., and Stallcup, W. B. (1999) High-affinity binding of basic fibroblast growth factor and platelet-derived growth factor-AA to the core protein of the NG2 proteoglycan, J Biol. Chem. 274, 16831-16837.

   6.  Hilge, M., Aelen, J., and Vuister, G. W. (2006) Ca2+ regulation in the Na+/Ca2+ exchanger involves two markedly different Ca2+ sensors, Mol. Cell 22, 15-25.

   7.  Chiotaki, R., Petrou, P., Giakoumaki, E., Pavlakis, E., Sitaru, C., and Chalepakis, G. (2007) Spatiotemporal distribution of Fras1/Frem proteins during mouse embryonic development, Gene Expr. Patterns. 7, 381-388.

   8.  Smyth, I. and Scambler, P. (2005) The genetics of Fraser syndrome and the blebs mouse mutants, Hum. Mol. Genet 14 Spec No. 2, R269-R274.

   9.  McGregor, L., Makela, V., Darling, S. M., Vrontou, S., Chalepakis, G., Roberts, C., Smart, N., Rutland, P., Prescott, N., Hopkins, J., Bentley, E., Shaw, A., Roberts, E., Mueller, R., Jadeja, S., Philip, N., Nelson, J., Francannet, C., Perez-Aytes, A., Megarbane, A., Kerr, B., Wainwright, B., Woolf, A. S., Winter, R. M., and Scambler, P. J. (2003) Fraser syndrome and mouse blebbed phenotype caused by mutations in FRAS1/Fras1 encoding a putative extracellular matrix protein, Nat. Genet. 34, 203-208.

 10.  Vrontou, S., Petrou, P., Meyer, B. I., Galanopoulos, V. K., Imai, K., Yanagi, M., Chowdhury, K., Scambler, P. J., and Chalepakis, G. (2003) Fras1 deficiency results in cryptophthalmos, renal agenesis and blebbed phenotype in mice, Nat. Genet. 34, 209-214.

 11.  Jadeja, S., Smyth, I., Pitera, J. E., Taylor, M. S., van, H. M., Bentley, E., McGregor, L., Hopkins, J., Chalepakis, G., Philip, N., Perez, A. A., Watt, F. M., Darling, S. M., Jackson, I., Woolf, A. S., and Scambler, P. J. (2005) Identification of a new gene mutated in Fraser syndrome and mouse myelencephalic blebs, Nat. Genet. 37, 520-525.

 12.  Takamiya, K., Kostourou, V., Adams, S., Jadeja, S., Chalepakis, G., Scambler, P. J., Huganir, R. L., and Adams, R. H. (2004) A direct functional link between the multi-PDZ domain protein GRIP1 and the Fraser syndrome protein Fras1, Nat. Genet. 36, 172-177.

 13.  Swiergiel, J. J., Funderburgh, J. L., Justice, M. J., and Conrad, G. W. (2000) Developmental eye and neural tube defects in the eye blebs mouse, Dev. Dyn. 219, 21-27.

 14.  Timmer, J. R., Mak, T. W., Manova, K., Anderson, K. V., and Niswander, L. (2005) Tissue morphogenesis and vascular stability require the Frem2 protein, product of the mouse myelencephalic blebs gene, Proc. Natl. Acad. Sci. U. S. A 102, 11746-11750.

 15.  Varnum, D. S. and Fox, S. C. (1981) Head blebs: a new mutation on chromosome 4 of the mouse, J Hered 72, 293.

 16.  Christiano, A. M., Greenspan, D. S., Hoffman, G. G., Zhang, X., Tamai, Y., Lin, A. N., Dietz, H. C., Hovnanian, A., and Uitto, J. (1993) A missense mutation in type VII collagen in two affected siblings with recessive dystrophic epidermolysis bullosa, Nat. Genet 4, 62-66.

 17.  Ding, H., Wu, X., Bostrom, H., Kim, I., Wong, N., Tsoi, B., O'Rourke, M., Koh, G. Y., Soriano, P., Betsholtz, C., Hart, T. C., Marazita, M. L., Field, L. L., Tam, P. P., and Nagy, A. (2004) A specific requirement for PDGF-C in palate formation and PDGFR-alpha signaling, Nat. Genet 36, 1111-1116.

 18.  Soriano, P. (1997) The PDGF alpha receptor is required for neural crest cell development and for normal patterning of the somites, Development 124, 2691-2700.

 19.  Kiyozumi, D., Osada, A., Sugimoto, N., Weber, C. N., Ono, Y., Imai, T., Okada, A., and Sekiguchi, K. (2005) Identification of a novel cell-adhesive protein spatiotemporally expressed in the basement membrane of mouse developing hair follicle, Exp. Cell Res. 306, 9-23.

 20.  Bader, B. L., Rayburn, H., Crowley, D., and Hynes, R. O. (1998) Extensive vasculogenesis, angiogenesis, and organogenesis precede lethality in mice lacking all alpha v integrins, Cell 95, 507-519.

 21.  Muller, U., Wang, D., Denda, S., Meneses, J. J., Pedersen, R. A., and Reichardt, L. F. (1997) Integrin alpha8beta1 is critically important for epithelial-mesenchymal interactions during kidney morphogenesis, Cell 88, 603-613.

 22.  Kiyozumi, D., Sugimoto, N., and Sekiguchi, K. (2006) Breakdown of the reciprocal stabilization of QBRICK/Frem1, Fras1, and Frem2 at the basement membrane provokes Fraser syndrome-like defects, Proc. Natl. Acad. Sci. U. S. A 103, 11981-11986.

 23.  Petrou, P., Chiotaki, R., Dalezios, Y., and Chalepakis, G. (2007) Overlapping and divergent localization of Frem1 and Fras1 and its functional implications during mouse embryonic development, Exp. Cell Res. 313, 910-920.

 24.  Short, K., Wiradjaja, F., and Smyth, I. (2007) Let's stick together: the role of the Fras1 and Frem proteins in epidermal adhesion, IUBMB. Life 59, 427-435.