Phenotypic Mutation 'totter' (pdf version)
Alleletotter
Mutation Type missense
Chromosome8
Coordinate84,588,753 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Cacna1a
Gene Name calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonym(s) Cacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
Chromosomal Location 84,388,440-84,640,246 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007578 (variant 1), NM_001252059 (variant 2), NM_001252060 (variant 3), NM_001252061 (variant 4); MGI:109482

Mapped Yes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000112436] [ENSMUSP00000114055]
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: Y1539C

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
(Using ENSMUST00000121390)
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: Y1492C

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
(Using ENSMUST00000122053)
Predicted Effect unknown
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 17376154 19854154
Motor: Rotarod Weight - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(66) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(28) Radiation induced(1) Spontaneous(8) Targeted(25)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Mode of Inheritance Unknown
Local Stock Live Mice
Repository
Last Updated 2018-12-06 3:21 PM by Anne Murray
Record Created 2018-05-08 12:46 PM by Jamie Russell
Record Posted 2018-12-06
Phenotypic Description
Figure 1. Totter mice exhibit wobbling when walking.

Figure 2. Totter mice exhibited decreased time on the rotarod during a rotarod performance test. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The totter phenotype was identified among G3 mice of the pedigree R6195, some of which showed wobbling when walking (Figure 1) and reduced time on the rotarod during a rotarod performance test (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of reduced rotarod time phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 78 mutations (X-axis) identified in the G1 male of pedigree R6195. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 78 mutations. Both of the above phenotypes were linked to three mutations on chromosome 8: F2rl3, Gab1, and Cacna1a. The mutation in Cacna1a was presumed causative as the totter phenotypes mimic other known alleles of Cacna1a (see MGI for a list of Cacna1a alleles). The Cacna1a mutation is an A to G transition at base pair 84,588,753 (v38) on chromosome 8, or base pair 250,124 in the GenBank genomic region NC_000074 encoding Cacna1a. The strongest association was found with a recessive model of inheritance to the rotarod phenotype, wherein three variant homozygotes departed phenotypically from 18 homozygous reference mice and 20 heterozygous mice with a P value of 4 x 10-5 (Figure 2).  

 

The mutation corresponds to residue 4,897 in the mRNA sequence NM_007578 within exon 30 of 47 total exons and residue 4,756 in the mRNA sequence NM_001252059 within exon 29 of 46 total exons.

 

4881 CTAATGATGAAGTTCTACGGAGCCTCGGTGGCC

1534 -L--M--M--K--F--Y--G--A--S--V--A- (variants 1, 3, 4)

 

4740 CTAATGATGAAGTTCTACGGAGCCTCGGTGGCC

1487 -L--M--M--K--F--Y--G--A--S--V--A- (variant 2)

 

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to cysteine substitution at position 1,539 (Y1539C) in variants 1, 3, and 4 CACNA1A protein (PolyPhen-2 score = 0.989) and a Y1492C substitution in variant 2 of the CACNA1A protein (PolyPhen-2 score = 0.979).

 

Protein Prediction
Figure 4. The CACNA1A protein. A, Domain structure of CACNA1A. B, Transmembrane organization of the  voltage-dependent calcium (Ca2+) channel (VDCC) subunit. Cylinders represent α-helical transmembrane segments (numbered 1-6 for each repeat) with green cylinders indicating the pore-lining segments and yellow cylinders indicating the S4 voltage sensors (positively charged residues are represented by the + signs). The residue affected by the totter mutation results in a tyrosine to cysteine substitution at position 1539 in the extracellular segment between transmembrane 1 and 2 in Repeat IV of the CACNA1A protein.

Cacna1a encodes CACNA1A (alternatively, α1A or CACNL1A4), a voltage-dependent calcium (Ca2+) channel (VDCC) subunit. The VDCCs are heterooligomers composed of a pore-forming α1 subunit, an intracellular β subunit, a membrane-spanning γ subunit, and a membrane-anchored α2δ subunit (for information about the α2δ subunits, see the record for hera). Channel activity is directed by the α1 subunit, while the other subunits regulate VDCC activity. VDCCs are divided into three families, each containing different α1 subunits: the high voltage-activated L-type (Cav1) family (α1S, α1C, α1D, and α1F); the non-L-type high voltage-activated (Cav2) family, including the P/Q/O-type (Cav2.1; α1A), the N-type (Cav2.2; α1B), and the R-type (Cav2.3; α1E); and the low voltage-activated T-type (Cav3) family (α1G, α1H, and α1I). CACNA1A is a transmembrane pore-forming subunit of the Cav2.1 VDCC.

 

CACNA1A has four repeats (repeat I through repeat IV) that each contains six transmembrane domains with a pore loop connected transmembrane domains five and six (1). CACNA1A has three nuclear localization signals within the C-terminus (2). A synaptic protein interaction motif (termed synprint) in the intracellular loop connecting domains II and III mediates calcium-dependent interaction with SNARE proteins, syntaxin 1A/1B, and synaptotagmin (3). In human CACNA1A, amino acids 2,042 to 2,061 within the C-terminal tail mediates synaptic vesicle docking (4). Interaction between the synaptic proteins and CACNA1A is essential for depolarization-evoked neurotransmitter release (5). In addition to the synprint motif, a conserved motif in the II/III loop interacts with ankyrin-B (6). Ankyrin-CACNA1A interaction promotes proper targeting of CACNA1A.

 

CACNA1A is phosphorylated at several threonines and serines along the length of the protein by cAMP-dependent protein kinase and other kinases (e.g., protein kinase C, protein kinase A, calmodulin-dependent protein kinase II, and casein kinase II) (7;8). cAMP-dependent phosphorylation regulates calcium flux through the channel (9).

 

The C-terminus of CACNA1A interacts with several proteins that regulate its localization and abundance at the presynaptic membrane as well as the function of CACNA1A. CACNA1A binds the scaffolding protein RIM1/2 (Rab3-interacting molecule 1/2) (10), APBA1 (amyloid beta (A4) precursor protein binding, family A, member 1) (11), RIM binding proteins (12), CAMKII (calcium/calmodulin-dependent protein kinase II) (13), CASK (calcium/calmodulin-dependent serine protein kinase) (11;14), and the neuronal calcium-binding protein VILIP-2 (visinin-like protein-2) (15). Calmodulin binds to the C-terminus of CACNA1A in a Ca2+-dependent manner, subsequently causing an increase in the rate and extent of voltage-dependent inactivation (16). CACNA1A also has a secondary CaVβ4 interaction site (17) as well as PXXP motifs (18).

 

CACNA1A undergoes alternative splicing in an age-, gender-, and species-dependent manner (19-22). The CACNA1A variants exhibit differential neuronal distribution, localization, and biophysical properties. Alternative splicing at the final coding exon of human CACNA1A (exon 47) generates two protein isoforms in the brain: MPI and MPc (23). MPI has a polyglutamine tract that is associated with spinocerebellar ataxia type 6, and MPc splices to an immediate stop codon. Mice that exclusively expressed MPc exhibited non-progressive neurological phenotypes such as early-onset ataxia and absence seizures (23). The basic properties of the channel were unchanged in the MPc conditional knockout mice, but the mice showed reduced interactions with CaVβ4 and Rim binding protein 2 (23). Exons 43 and 44 are also alternatively spliced in human CACNA1A resulting in either the inclusion or exclusion of exons 43 and 44 (14;22).

 

In humans, CACNA1A is cleaved to generate a 75-kD fragment containing the C-terminus (termed α1ACT) (2;24;25). The α1ACT peptide begins at amino acid 1,960 within the IQ-like domain of full-length α1A. Expression of α1ACT is due to use of a cryptic internal ribosomal entry site in the CACNA1A transcript (24). The α1ACT peptide was localized to the nucleus of HEK293 cells (2;25). α1ACT binds to AT-rich enhancer element (TTATAA) in the 3’-untranslated regions of target genes (e.g., BTG1); α1ACT promotes expression of genes that function in neural and Purkinje cell development (24).

 

The totter mutation results in a tyrosine to cysteine substitution at position 1,539 (Y1539C) in variants 1, 3, and 4 CACNA1A protein; Tyr1539 is within an extracellular loop between transmembrane domains 1 and 2 in repeat IV.

Expression/Localization

CACNA1A is predominantly expressed in neuronal tissues, including the cerebral cortex, trigeminal ganglia, and cerebellum. CACNA1A (and CaV2.1 channels) are localized in presynaptic terminals and somatodendritic membranes in the brain (26).

Background
Figure 5. Voltage-dependent calcium channels at the presynaptic synapse of the neuromuscular junction. See text in figure for details.

Ca2+ signaling is essential for development, proliferation, neuronal transmission, learning and memory, muscle contraction, cell motility, cell growth, and cell death as well as regulation of enzyme activity, permeability of ion channels, and activity of ion pumps [reviewed in (27)]. VDCCs mediate Ca2+ entry into muscle, glial cells, neurons, and endocrine cells. At resting membrane potential, VDCCs are closed. The VDCCs are opened/activated by depolarized membrane potential. Calcium enters the cell rapidly upon channel opening. Voltage-dependent Ca2+ channels in endocrine cells mediate Ca2+ influx which initiates secretion of hormones.

 

CaV2.1 channels initiate action potential-evoked neurotransmitter release at central nervous system synapses. Calcium diffuses to a nearby calcium sensor associated with a docked synaptic vesicle and initiates its fusion and discharge. CaV2.1 channels also putatively function in neural excitability at the postsynapse (28). CaV2.1 channels function in glutamate release and extrasynaptic gamma-aminobutyric acid (GABA) exocytosis in the cerebellum (29).

 

Mutations in human CACNA1A are linked to early infantile epileptic encephalopathy-42 [OMIM: #617106; (30)], type 2 episodic ataxia [OMIM: #108500; (31;32)], familial hemiplegic migraine-1 (with or without progressive cerebellar ataxia) [OMIM: #141500; (32;33)], and spinocerebellar ataxia-6 [SCA6; OMIM: #183086; (34;35)]. Clinical features of all of the conditions are similar, with progressive ataxia being a prominent feature of them all. SCA6 is caused to expansion of a polyglutamine tract in the C-terminal tail of CACNA1A. The poly-glutamine tract is normally 4 to 19 glutamines in length, but patients with SCA6 often have an expansion of the tract up to 20 to 33 glutamines (35). Anti-Cav2.1 antibodies are observed in Lambert-Eaton myasthenic syndrome, a neuromuscular autoimmune disease in which patients exhibit proximal muscle weakness, dry mouth, impotence, and ataxia (36;37).

 

Cacna1a-deficient mice (38;39) and Cacna1a mutant mice [e.g., tottering (39;40), Cacn1atg-4J (41), Cacna1aTg-5J (41), rolling Nagoya (42-44), leaner (45;46), rocker (47;48), and wobbly (49)] models] exhibit tremors, ataxia, wobbly gaits, dystonia, splayed stance of hindlimbs, uncoordinated behavior, abnormal balance, absence seizures, reduced body sizes/weights, reduced litter sizes with fewer than expected homozygotes born, weakness, and cerebellum and thymus atrophy [MGI and (38-44;47;49-57)].

Putative Mechanism

The muscle weakness observed in Cacna1a-deficient mice and Cacna1a mutant mice is due to aberrant neuromuscular (acetylcholine) synaptic transmission (44;58) and reduced numbers of postsynaptic AMPA receptors in parallel fiber-Purkinje cell synapses (48). The mutant mice also showed ectopic expression of tyrosine hydroxylase expression in the cerebellum, indicative of delayed neuronal maturation (59-61). The totter mutation may affect the voltage dependence of activation of Cav2.1 channels.

Primers PCR Primer
totter(F):5'- TTGCTGCAAATAAAGGCACG -3'
totter(R):5'- AGACTTTTGCTGGGGACGAG -3'

Sequencing Primer
totter_seq(F):5'- CACTTGGGAAGGCTGAGCTG -3'
totter_seq(R):5'- AGGTCTTGGGGCCCAGAG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJami Keef, Lauren Prince, Jamie Russell, Sohini Mukherjee, and Bruce Beutler