Phenotypic Mutation 'totter'

• Allele: totter
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 85,315,382 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Cacna1a
• Gene Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
• Synonym(s): Cacnl1a4, Ccha1a, SCA6, alpha1A, smrl, nmf352
• Chromosomal Location: 85,065,268-85,366,875 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016] ; PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000112436] [ENSMUSP00000114055]
• AlphaFold: P97445
• SMART Domains: Protein: ENSMUSP00000112436; Gene: ENSMUSG00000034656; AA Change: Y1539C

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	99	373	1.5e-69	PFAM
Pfam:Ion_trans	488	727	1.2e-54	PFAM
Pfam:PKD_channel	578	721	6.6e-8	PFAM
low complexity region	920	959	N/A	INTRINSIC
low complexity region	977	987	N/A	INTRINSIC
low complexity region	1074	1093	N/A	INTRINSIC
low complexity region	1143	1168	N/A	INTRINSIC
Pfam:Ion_trans	1194	1472	4.9e-64	PFAM
Pfam:Ion_trans	1516	1773	2.8e-64	PFAM
Pfam:GPHH	1775	1844	5.6e-39	PFAM
Ca_chan_IQ	1899	1933	1.8e-12	SMART
AT_hook	2053	2065	2.02e0	SMART
low complexity region	2101	2113	N/A	INTRINSIC
low complexity region	2153	2179	N/A	INTRINSIC
low complexity region	2213	2236	N/A	INTRINSIC
low complexity region	2253	2282	N/A	INTRINSIC
low complexity region	2314	2325	N/A	INTRINSIC
low complexity region	2342	2357	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
  (Using ENSMUST00000121390)
• SMART Domains: Protein: ENSMUSP00000114055; Gene: ENSMUSG00000034656; AA Change: Y1492C

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	91	314	4.5e-58	PFAM
PDB:4DEX|B	317	427	5e-45	PDB
Pfam:Ion_trans	476	668	6.4e-46	PFAM
Pfam:PKD_channel	530	675	7.7e-8	PFAM
low complexity region	873	912	N/A	INTRINSIC
low complexity region	930	940	N/A	INTRINSIC
low complexity region	1027	1046	N/A	INTRINSIC
low complexity region	1096	1121	N/A	INTRINSIC
Pfam:Ion_trans	1183	1414	2.8e-54	PFAM
Pfam:Ion_trans	1504	1714	3.2e-60	PFAM
Ca_chan_IQ	1852	1886	1.8e-12	SMART
AT_hook	2006	2018	2.02e0	SMART
low complexity region	2054	2066	N/A	INTRINSIC
low complexity region	2106	2132	N/A	INTRINSIC
low complexity region	2166	2189	N/A	INTRINSIC
low complexity region	2206	2235	N/A	INTRINSIC
low complexity region	2267	2278	N/A	INTRINSIC
low complexity region	2295	2310	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
  (Using ENSMUST00000122053)
• Predicted Effect: unknown
• Meta Mutation Damage Score: 0.5931
• Is this an essential gene?: Probably essential (E-score: 0.924)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:36 PM by Anne Murray
• Record Created: 2018-05-08 12:46 PM by Jamie Russell
• Record Posted: 2018-12-06
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jami Keef, Lauren Prince, Jamie Russell, Sohini Mukherjee, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007578 (variant 1), NM_001252059 (variant 2), NM_001252060 (variant 3), NM_001252061 (variant 4); MGI:109482

Alleles Listed at MGI

All Mutations and Alleles(66) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(28) Radiation induced(1) Spontaneous(8) Targeted(25)

Phenotypic Description

Figure 1. Totter mice exhibit wobbling when walking.

Figure 2. Totter mice exhibited decreased time on the rotarod during a rotarod performance test . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The totter phenotype was identified among G3 mice of the pedigree R6195, some of which showed wobbling when walking (Figure 1) and reduced time on the rotarod during a rotarod performance test (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of reduced rotarod time phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 78 mutations (X-axis) identified in the G1 male of pedigree R6195. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 78 mutations. Both of the above phenotypes were linked to three mutations on chromosome 8: F2rl3, Gab1, and Cacna1a. The mutation in Cacna1a was presumed causative as the totter phenotypes mimic other known alleles of Cacna1a (see MGI for a list of Cacna1a alleles). The Cacna1a mutation is an A to G transition at base pair 84,588,753 (v38) on chromosome 8, or base pair 250,124 in the GenBank genomic region NC_000074 encoding Cacna1a. The strongest association was found with a recessive model of inheritance to the rotarod phenotype, wherein three variant homozygotes departed phenotypically from 18 homozygous reference mice and 20 heterozygous mice with a P value of 4 x 10^-5 (Figure 2).  

The mutation corresponds to residue 4,897 in the mRNA sequence NM_007578 within exon 30 of 47 total exons and residue 4,756 in the mRNA sequence NM_001252059 within exon 29 of 46 total exons.

4881 CTAATGATGAAGTTCTACGGAGCCTCGGTGGCC 1534 -L--M--M--K--F--Y--G--A--S--V--A- (variants 1, 3, 4) 4740 CTAATGATGAAGTTCTACGGAGCCTCGGTGGCC 1487 -L--M--M--K--F--Y--G--A--S--V--A- (variant 2)

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to cysteine substitution at position 1,539 (Y1539C) in variants 1, 3, and 4 CACNA1A protein (PolyPhen-2 score = 0.989) and a Y1492C substitution in variant 2 of the CACNA1A protein (PolyPhen-2 score = 0.979).

Protein Prediction

Figure 4. The CACNA1A protein. A, Domain structure of CACNA1A. B, Transmembrane organization of the voltage-dependent calcium (Ca 2+ ) channel (VDCC) subunit. Cylinders represent α-helical transmembrane segments (numbered 1-6 for each repeat) with green cylinders indicating the pore-lining segments and yellow cylinders indicating the S4 voltage sensors (positively charged residues are represented by the + signs). The residue affected by the totter mutation results in a tyrosine to cysteine substitution at position 1539 in the extracellular segment between transmembrane 1 and 2 in Repeat IV of the CACNA1A protein.

Cacna1a encodes CACNA1A (alternatively, α1A or CACNL1A4), a voltage-dependent calcium (Ca²⁺) channel (VDCC) subunit. The VDCCs are heterooligomers composed of a pore-forming α1 subunit, an intracellular β subunit, a membrane-spanning γ subunit, and a membrane-anchored α2δ subunit (for information about the α2δ subunits, see the record for hera). Channel activity is directed by the α1 subunit, while the other subunits regulate VDCC activity. VDCCs are divided into three families, each containing different α1 subunits: the high voltage-activated L-type (Ca_v1) family (α1S, α1C, α1D, and α1F); the non-L-type high voltage-activated (Ca_v2) family, including the P/Q/O-type (Ca_v2.1; α1A), the N-type (Ca_v2.2; α1B), and the R-type (Ca_v2.3; α1E); and the low voltage-activated T-type (Ca_v3) family (α1G, α1H, and α1I). CACNA1A is a transmembrane pore-forming subunit of the Ca_v2.1 VDCC.

CACNA1A has four repeats (repeat I through repeat IV) that each contains six transmembrane domains with a pore loop connected transmembrane domains five and six (1). CACNA1A has three nuclear localization signals within the C-terminus (2). A synaptic protein interaction motif (termed synprint) in the intracellular loop connecting domains II and III mediates calcium-dependent interaction with SNARE proteins, syntaxin 1A/1B, and synaptotagmin (3). In human CACNA1A, amino acids 2,042 to 2,061 within the C-terminal tail mediates synaptic vesicle docking (4). Interaction between the synaptic proteins and CACNA1A is essential for depolarization-evoked neurotransmitter release (5). In addition to the synprint motif, a conserved motif in the II/III loop interacts with ankyrin-B (6). Ankyrin-CACNA1A interaction promotes proper targeting of CACNA1A.

CACNA1A is phosphorylated at several threonines and serines along the length of the protein by cAMP-dependent protein kinase and other kinases (e.g., protein kinase C, protein kinase A, calmodulin-dependent protein kinase II, and casein kinase II) (7;8). cAMP-dependent phosphorylation regulates calcium flux through the channel (9).

The C-terminus of CACNA1A interacts with several proteins that regulate its localization and abundance at the presynaptic membrane as well as the function of CACNA1A. CACNA1A binds the scaffolding protein RIM1/2 (Rab3-interacting molecule 1/2) (10), APBA1 (amyloid beta (A4) precursor protein binding, family A, member 1) (11), RIM binding proteins (12), CAMKII (calcium/calmodulin-dependent protein kinase II) (13), CASK (calcium/calmodulin-dependent serine protein kinase) (11;14), and the neuronal calcium-binding protein VILIP-2 (visinin-like protein-2) (15). Calmodulin binds to the C-terminus of CACNA1A in a Ca²⁺-dependent manner, subsequently causing an increase in the rate and extent of voltage-dependent inactivation (16). CACNA1A also has a secondary Ca_Vβ4 interaction site (17) as well as PXXP motifs (18).

CACNA1A undergoes alternative splicing in an age-, gender-, and species-dependent manner (19-22). The CACNA1A variants exhibit differential neuronal distribution, localization, and biophysical properties. Alternative splicing at the final coding exon of human CACNA1A (exon 47) generates two protein isoforms in the brain: MPI and MPc (23). MPI has a polyglutamine tract that is associated with spinocerebellar ataxia type 6, and MPc splices to an immediate stop codon. Mice that exclusively expressed MPc exhibited non-progressive neurological phenotypes such as early-onset ataxia and absence seizures (23). The basic properties of the channel were unchanged in the MPc conditional knockout mice, but the mice showed reduced interactions with Ca_Vβ4 and Rim binding protein 2 (23). Exons 43 and 44 are also alternatively spliced in human CACNA1A resulting in either the inclusion or exclusion of exons 43 and 44 (14;22).

In humans, CACNA1A is cleaved to generate a 75-kD fragment containing the C-terminus (termed α1ACT) (2;24;25). The α1ACT peptide begins at amino acid 1,960 within the IQ-like domain of full-length α1A. Expression of α1ACT is due to use of a cryptic internal ribosomal entry site in the CACNA1A transcript (24). The α1ACT peptide was localized to the nucleus of HEK293 cells (2;25). α1ACT binds to AT-rich enhancer element (TTATAA) in the 3’-untranslated regions of target genes (e.g., BTG1); α1ACT promotes expression of genes that function in neural and Purkinje cell development (24).

The totter mutation results in a tyrosine to cysteine substitution at position 1,539 (Y1539C) in variants 1, 3, and 4 CACNA1A protein; Tyr1539 is within an extracellular loop between transmembrane domains 1 and 2 in repeat IV.

Expression/Localization

CACNA1A is predominantly expressed in neuronal tissues, including the cerebral cortex, trigeminal ganglia, and cerebellum. CACNA1A (and Ca_V2.1 channels) are localized in presynaptic terminals and somatodendritic membranes in the brain (26).

Background

Figure 5. Voltage-dependent calcium channels at the presynaptic synapse of the neuromuscular junction. See text in figure for details.

Ca²⁺ signaling is essential for development, proliferation, neuronal transmission, learning and memory, muscle contraction, cell motility, cell growth, and cell death as well as regulation of enzyme activity, permeability of ion channels, and activity of ion pumps [reviewed in (27)]. VDCCs mediate Ca²⁺ entry into muscle, glial cells, neurons, and endocrine cells. At resting membrane potential, VDCCs are closed. The VDCCs are opened/activated by depolarized membrane potential. Calcium enters the cell rapidly upon channel opening. Voltage-dependent Ca²⁺ channels in endocrine cells mediate Ca²⁺ influx which initiates secretion of hormones.

Ca_V2.1 channels initiate action potential-evoked neurotransmitter release at central nervous system synapses. Calcium diffuses to a nearby calcium sensor associated with a docked synaptic vesicle and initiates its fusion and discharge. Ca_V2.1 channels also putatively function in neural excitability at the postsynapse (28). Ca_V2.1 channels function in glutamate release and extrasynaptic gamma-aminobutyric acid (GABA) exocytosis in the cerebellum (29).

Mutations in human CACNA1A are linked to early infantile epileptic encephalopathy-42 [OMIM: #617106; (30)], type 2 episodic ataxia [OMIM: #108500; (31;32)], familial hemiplegic migraine-1 (with or without progressive cerebellar ataxia) [OMIM: #141500; (32;33)], and spinocerebellar ataxia-6 [SCA6; OMIM: #183086; (34;35)]. Clinical features of all of the conditions are similar, with progressive ataxia being a prominent feature of them all. SCA6 is caused to expansion of a polyglutamine tract in the C-terminal tail of CACNA1A. The poly-glutamine tract is normally 4 to 19 glutamines in length, but patients with SCA6 often have an expansion of the tract up to 20 to 33 glutamines (35). Anti-Ca_v2.1 antibodies are observed in Lambert-Eaton myasthenic syndrome, a neuromuscular autoimmune disease in which patients exhibit proximal muscle weakness, dry mouth, impotence, and ataxia (36;37).

Cacna1a-deficient mice (38;39) and Cacna1a mutant mice [e.g., tottering (39;40), Cacn1a^tg-4J (41), Cacna1a^Tg-5J (41), rolling Nagoya (42-44), leaner (45;46), rocker (47;48), and wobbly (49)] models] exhibit tremors, ataxia, wobbly gaits, dystonia, splayed stance of hindlimbs, uncoordinated behavior, abnormal balance, absence seizures, reduced body sizes/weights, reduced litter sizes with fewer than expected homozygotes born, weakness, and cerebellum and thymus atrophy [MGI and (38-44;47;49-57)].

Putative Mechanism

The muscle weakness observed in Cacna1a-deficient mice and Cacna1a mutant mice is due to aberrant neuromuscular (acetylcholine) synaptic transmission (44;58) and reduced numbers of postsynaptic AMPA receptors in parallel fiber-Purkinje cell synapses (48). The mutant mice also showed ectopic expression of tyrosine hydroxylase expression in the cerebellum, indicative of delayed neuronal maturation (59-61). The totter mutation may affect the voltage dependence of activation of Ca_v2.1 channels.

Primers

PCR Primer
totter_pcr_F: TTGCTGCAAATAAAGGCACG
totter_pcr_R: AGACTTTTGCTGGGGACGAG

Sequencing Primer
totter_seq_F: CACTTGGGAAGGCTGAGCTG
totter_seq_R: AGGTCTTGGGGCCCAGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 445 nucleotides is amplified (chromosome 8, + strand):

1   ttgctgcaaa taaaggcacg agctgtggct catggcattt tgtgcaatgg cagcacttgg
61  gaaggctgag ctgggaggat tgctgtcatt ctgaggccag ccagtgttac agggagacgc
121 tatctcaggg cccaggcctt tgctgctgtc gccctctctg ggctctgaga tcagacctgc
181 agcctggctc tcagccaagc cgctgacttc tctgcctgtc cttgtccctc tagttctacg
241 gagcctcggt ggcctatgaa aacgcccttc gcgtgttcaa cattgtcttc acctccctct
301 tctctctcga atgtgtgctc aaagtcatgg cttttgggat tctggtacgt ggggcctgag
361 ggtagtgggt ggggggagta cacagggtcc agggtgcggg aggtgtgtgc tctgggcccc
421 aagacctcgt ccccagcaaa agtct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Catterall, W. A. (2000) Structure and Regulation of Voltage-Gated Ca2+ Channels. Annu Rev Cell Dev Biol. 16, 521-555.

  2. Kordasiewicz, H. B., Thompson, R. M., Clark, H. B., and Gomez, C. M. (2006) C-Termini of P/Q-Type Ca2+ Channel alpha1A Subunits Translocate to Nuclei and Promote Polyglutamine-Mediated Toxicity. Hum Mol Genet. 15, 1587-1599.

  3. Sheng, Z. H., Rettig, J., Takahashi, M., and Catterall, W. A. (1994) Identification of a Syntaxin-Binding Site on N-Type Calcium Channels. Neuron. 13, 1303-1313.

  4. Lubbert, M., Goral, R. O., Satterfield, R., Putzke, T., van den Maagdenberg, A. M., Kamasawa, N., and Young, S. M.,Jr. (2017) A Novel Region in the CaV2.1 alpha1 Subunit C-Terminus Regulates Fast Synaptic Vesicle Fusion and Vesicle Docking at the Mammalian Presynaptic Active Zone. Elife. 6, 10.7554/eLife.28412.

  5. Cohen-Kutner, M., Nachmanni, D., and Atlas, D. (2010) CaV2.1 (P/Q Channel) Interaction with Synaptic Proteins is Essential for Depolarization-Evoked Release. Channels (Austin). 4, 266-277.

  6. Kline, C. F., Scott, J., Curran, J., Hund, T. J., and Mohler, P. J. (2014) Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting. J Biol Chem. 289, 5285-5295.

  7. Curtis, B. M., and Catterall, W. A. (1985) Phosphorylation of the Calcium Antagonist Receptor of the Voltage-Sensitive Calcium Channel by cAMP-Dependent Protein Kinase. Proc Natl Acad Sci U S A. 82, 2528-2532.

  8. Jahn, H., Nastainczyk, W., Rohrkasten, A., Schneider, T., and Hofmann, F. (1988) Site-Specific Phosphorylation of the Purified Receptor for Calcium-Channel Blockers by cAMP- and cGMP-Dependent Protein Kinases, Protein Kinase C, Calmodulin-Dependent Protein Kinase II and Casein Kinase II. Eur J Biochem. 178, 535-542.

  9. Nunoki, K., Florio, V., and Catterall, W. A. (1989) Activation of Purified Calcium Channels by Stoichiometric Protein Phosphorylation. Proc Natl Acad Sci U S A. 86, 6816-6820.

  10. Kaeser, P. S., Deng, L., Wang, Y., Dulubova, I., Liu, X., Rizo, J., and Sudhof, T. C. (2011) RIM Proteins Tether Ca2+ Channels to Presynaptic Active Zones Via a Direct PDZ-Domain Interaction. Cell. 144, 282-295.

  11. Maximov, A., Sudhof, T. C., and Bezprozvanny, I. (1999) Association of Neuronal Calcium Channels with Modular Adaptor Proteins. J Biol Chem. 274, 24453-24456.

  12. Hibino, H., Pironkova, R., Onwumere, O., Vologodskaia, M., Hudspeth, A. J., and Lesage, F. (2002) RIM Binding Proteins (RBPs) Couple Rab3-Interacting Molecules (RIMs) to Voltage-Gated Ca(2+) Channels. Neuron. 34, 411-423.

  13. Jiang, X., Lautermilch, N. J., Watari, H., Westenbroek, R. E., Scheuer, T., and Catterall, W. A. (2008) Modulation of CaV2.1 Channels by Ca2+/calmodulin-Dependent Protein Kinase II Bound to the C-Terminal Domain. Proc Natl Acad Sci U S A. 105, 341-346.

  14. Hirano, M., Takada, Y., Wong, C. F., Yamaguchi, K., Kotani, H., Kurokawa, T., Mori, M. X., Snutch, T. P., Ronjat, M., De Waard, M., and Mori, Y. (2017) C-Terminal Splice Variants of P/Q-Type Ca(2+) Channel CaV2.1 alpha1 Subunits are Differentially Regulated by Rab3-Interacting Molecule Proteins. J Biol Chem. 292, 9365-9381.

  15. Lautermilch, N. J., Few, A. P., Scheuer, T., and Catterall, W. A. (2005) Modulation of CaV2.1 Channels by the Neuronal Calcium-Binding Protein Visinin-Like Protein-2. J Neurosci. 25, 7062-7070.

  16. Lee, A., Wong, S. T., Gallagher, D., Li, B., Storm, D. R., Scheuer, T., and Catterall, W. A. (1999) Ca2+/calmodulin Binds to and Modulates P/Q-Type Calcium Channels. Nature. 399, 155-159.

  17. Walker, D., Bichet, D., Campbell, K. P., and De Waard, M. (1998) A Beta 4 Isoform-Specific Interaction Site in the Carboxyl-Terminal Region of the Voltage-Dependent Ca2+ Channel Alpha 1A Subunit. J Biol Chem. 273, 2361-2367.

  18. Davydova, D., Marini, C., King, C., Klueva, J., Bischof, F., Romorini, S., Montenegro-Venegas, C., Heine, M., Schneider, R., Schroder, M. S., Altrock, W. D., Henneberger, C., Rusakov, D. A., Gundelfinger, E. D., and Fejtova, A. (2014) Bassoon Specifically Controls Presynaptic P/Q-Type Ca(2+) Channels Via RIM-Binding Protein. Neuron. 82, 181-194.

  19. Bourinet, E., Soong, T. W., Sutton, K., Slaymaker, S., Mathews, E., Monteil, A., Zamponi, G. W., Nargeot, J., and Snutch, T. P. (1999) Splicing of Alpha 1A Subunit Gene Generates Phenotypic Variants of P- and Q-Type Calcium Channels. Nat Neurosci. 2, 407-415.

  20. Chang, S. Y., Yong, T. F., Yu, C. Y., Liang, M. C., Pletnikova, O., Troncoso, J., Burgunder, J. M., and Soong, T. W. (2007) Age and Gender-Dependent Alternative Splicing of P/Q-Type Calcium Channel EF-Hand. Neuroscience. 145, 1026-1036.

  21. Kanumilli, S., Tringham, E. W., Payne, C. E., Dupere, J. R., Venkateswarlu, K., and Usowicz, M. M. (2006) Alternative Splicing Generates a Smaller Assortment of CaV2.1 Transcripts in Cerebellar Purkinje Cells than in the Cerebellum. Physiol Genomics. 24, 86-96.

  22. Soong, T. W., DeMaria, C. D., Alvania, R. S., Zweifel, L. S., Liang, M. C., Mittman, S., Agnew, W. S., and Yue, D. T. (2002) Systematic Identification of Splice Variants in Human P/Q-Type Channel alpha1(2.1) Subunits: Implications for Current Density and Ca2+-Dependent Inactivation. J Neurosci. 22, 10142-10152.

  23. Aikawa, T., Watanabe, T., Miyazaki, T., Mikuni, T., Wakamori, M., Sakurai, M., Aizawa, H., Ishizu, N., Watanabe, M., Kano, M., Mizusawa, H., and Watase, K. (2017) Alternative Splicing in the C-Terminal Tail of Cav2.1 is Essential for Preventing a Neurological Disease in Mice. Hum Mol Genet. 26, 3094-3104.

  24. Du, X., Wang, J., Zhu, H., Rinaldo, L., Lamar, K. M., Palmenberg, A. C., Hansel, C., and Gomez, C. M. (2013) Second Cistron in CACNA1A Gene Encodes a Transcription Factor Mediating Cerebellar Development and SCA6. Cell. 154, 118-133.

  25. Li, L., Saegusa, H., and Tanabe, T. (2009) Deficit of Heat Shock Transcription Factor 1-Heat Shock 70 kDa Protein 1A Axis Determines the Cell Death Vulnerability in a Model of Spinocerebellar Ataxia Type 6. Genes Cells. 14, 1253-1269.

  26. Westenbroek, R. E., Sakurai, T., Elliott, E. M., Hell, J. W., Starr, T. V., Snutch, T. P., and Catterall, W. A. (1995) Immunochemical Identification and Subcellular Distribution of the Alpha 1A Subunits of Brain Calcium Channels. J Neurosci. 15, 6403-6418.

  27. Berridge, M. J., Lipp, P., and Bootman, M. D. (2000) The Versatility and Universality of Calcium Signalling. Nat Rev Mol Cell Biol. 1, 11-21.

  28. Womack, M. D., Chevez, C., and Khodakhah, K. (2004) Calcium-Activated Potassium Channels are Selectively Coupled to P/Q-Type Calcium Channels in Cerebellar Purkinje Neurons. J Neurosci. 24, 8818-8822.

  29. Lonchamp, E., Dupont, J. L., Doussau, F., Shin, H. S., Poulain, B., and Bossu, J. L. (2009) Deletion of Cav2.1(alpha1(A)) Subunit of Ca2+-Channels Impairs Synaptic GABA and Glutamate Release in the Mouse Cerebellar Cortex in Cultured Slices. Eur J Neurosci. 30, 2293-2307.

  30. Epi4K Consortium. (2016) De Novo Mutations in SLC1A2 and CACNA1A are Important Causes of Epileptic Encephalopathies. Am J Hum Genet. 99, 287-298.

  31. Riant, F., Lescoat, C., Vahedi, K., Kaphan, E., Toutain, A., Soisson, T., Wiener-Vacher, S. R., and Tournier-Lasserve, E. (2010) Identification of CACNA1A Large Deletions in Four Patients with Episodic Ataxia. Neurogenetics. 11, 101-106.

  32. Ophoff, R. A., Terwindt, G. M., Vergouwe, M. N., van Eijk, R., Oefner, P. J., Hoffman, S. M., Lamerdin, J. E., Mohrenweiser, H. W., Bulman, D. E., Ferrari, M., Haan, J., Lindhout, D., van Ommen, G. J., Hofker, M. H., Ferrari, M. D., and Frants, R. R. (1996) Familial Hemiplegic Migraine and Episodic Ataxia Type-2 are Caused by Mutations in the Ca2+ Channel Gene CACNL1A4. Cell. 87, 543-552.

  33. Kraus, R. L., Sinnegger, M. J., Glossmann, H., Hering, S., and Striessnig, J. (1998) Familial Hemiplegic Migraine Mutations Change alpha1A Ca2+ Channel Kinetics. J Biol Chem. 273, 5586-5590.

  34. Ishikawa, K., Tanaka, H., Saito, M., Ohkoshi, N., Fujita, T., Yoshizawa, K., Ikeuchi, T., Watanabe, M., Hayashi, A., Takiyama, Y., Nishizawa, M., Nakano, I., Matsubayashi, K., Miwa, M., Shoji, S., Kanazawa, I., Tsuji, S., and Mizusawa, H. (1997) Japanese Families with Autosomal Dominant Pure Cerebellar Ataxia Map to Chromosome 19p13.1-p13.2 and are Strongly Associated with Mild CAG Expansions in the Spinocerebellar Ataxia Type 6 Gene in Chromosome 19p13.1. Am J Hum Genet. 61, 336-346.

  35. Zhuchenko, O., Bailey, J., Bonnen, P., Ashizawa, T., Stockton, D. W., Amos, C., Dobyns, W. B., Subramony, S. H., Zoghbi, H. Y., and Lee, C. C. (1997) Autosomal Dominant Cerebellar Ataxia (SCA6) Associated with Small Polyglutamine Expansions in the Alpha 1A-Voltage-Dependent Calcium Channel. Nat Genet. 15, 62-69.

  36. Sanders, D. B. (2003) Lambert-Eaton Myasthenic Syndrome: Diagnosis and Treatment. Ann N Y Acad Sci. 998, 500-508.

  37. Fukuda, T., Motomura, M., Nakao, Y., Shiraishi, H., Yoshimura, T., Iwanaga, K., Tsujihata, M., and Eguchi, K. (2003) Reduction of P/Q-Type Calcium Channels in the Postmortem Cerebellum of Paraneoplastic Cerebellar Degeneration with Lambert-Eaton Myasthenic Syndrome. Ann Neurol. 53, 21-28.

  38. Jun, K., Piedras-Renteria, E. S., Smith, S. M., Wheeler, D. B., Lee, S. B., Lee, T. G., Chin, H., Adams, M. E., Scheller, R. H., Tsien, R. W., and Shin, H. S. (1999) Ablation of P/Q-Type Ca(2+) Channel Currents, Altered Synaptic Transmission, and Progressive Ataxia in Mice Lacking the Alpha(1A)-Subunit. Proc Natl Acad Sci U S A. 96, 15245-15250.

  39. Fletcher, C. F., Tottene, A., Lennon, V. A., Wilson, S. M., Dubel, S. J., Paylor, R., Hosford, D. A., Tessarollo, L., McEnery, M. W., Pietrobon, D., Copeland, N. G., and Jenkins, N. A. (2001) Dystonia and Cerebellar Atrophy in Cacna1a Null Mice Lacking P/Q Calcium Channel Activity. FASEB J. 15, 1288-1290.

  40. GREEN, M. C., and SIDMAN, R. L. (1962) Tottering--a Neuromusclar Mutation in the Mouse. and its Linkage with Oligosyndacylism. J Hered. 53, 233-237.

  41. Miki, T., Zwingman, T. A., Wakamori, M., Lutz, C. M., Cook, S. A., Hosford, D. A., Herrup, K., Fletcher, C. F., Mori, Y., Frankel, W. N., and Letts, V. A. (2008) Two Novel Alleles of Tottering with Distinct Ca(v)2.1 Calcium Channel Neuropathologies. Neuroscience. 155, 31-44.

  42. Oda, S. (1973) The Observation of Rolling Mouse Nagoya (Rol), a New Neurological Mutant, and its Maintenance (Author's Transl). Jikken Dobutsu. 22, 281-288.

  43. Tamaki, Y., Oda, S., and Kameyama, Y. (1986) Postnatal Locomotion Development in a Neurological Mutant of Rolling Mouse Nagoya. Dev Psychobiol. 19, 67-77.

  44. Kaja, S., van de Ven, R. C., van Dijk, J. G., Verschuuren, J. J., Arahata, K., Frants, R. R., Ferrari, M. D., van den Maagdenberg, A. M., and Plomp, J. J. (2007) Severely Impaired Neuromuscular Synaptic Transmission Causes Muscle Weakness in the Cacna1a-Mutant Mouse Rolling Nagoya. Eur J Neurosci. 25, 2009-2020.

  45. Lorenzon, N. M., Lutz, C. M., Frankel, W. N., and Beam, K. G. (1998) Altered Calcium Channel Currents in Purkinje Cells of the Neurological Mutant Mouse Leaner. J Neurosci. 18, 4482-4489.

  46. Dove, L. S., Abbott, L. C., and Griffith, W. H. (1998) Whole-Cell and Single-Channel Analysis of P-Type Calcium Currents in Cerebellar Purkinje Cells of Leaner Mutant Mice. J Neurosci. 18, 7687-7699.

  47. Zwingman, T. A., Neumann, P. E., Noebels, J. L., and Herrup, K. (2001) Rocker is a New Variant of the Voltage-Dependent Calcium Channel Gene Cacna1a. J Neurosci. 21, 1169-1178.

  48. Kodama, T., Itsukaichi-Nishida, Y., Fukazawa, Y., Wakamori, M., Miyata, M., Molnar, E., Mori, Y., Shigemoto, R., and Imoto, K. (2006) A CaV2.1 Calcium Channel Mutation Rocker Reduces the Number of Postsynaptic AMPA Receptors in Parallel Fiber-Purkinje Cell Synapses. Eur J Neurosci. 24, 2993-3007.

  49. Xie, G., Clapcote, S. J., Nieman, B. J., Tallerico, T., Huang, Y., Vukobradovic, I., Cordes, S. P., Osborne, L. R., Rossant, J., Sled, J. G., Henderson, J. T., and Roder, J. C. (2007) Forward Genetic Screen of Mouse Reveals Dominant Missense Mutation in the P/Q-Type Voltage-Dependent Calcium Channel, CACNA1A. Genes Brain Behav. 6, 717-727.

  50. Noebels, J. L., and Sidman, R. L. (1979) Inherited Epilepsy: Spike-Wave and Focal Motor Seizures in the Mutant Mouse Tottering. Science. 204, 1334-1336.

  51. Raike, R. S., Pizoli, C. E., Weisz, C., van den Maagdenberg, A. M., Jinnah, H. A., and Hess, E. J. (2013) Limited Regional Cerebellar Dysfunction Induces Focal Dystonia in Mice. Neurobiol Dis. 49, 200-210.

  52. Saegusa, H., Wakamori, M., Matsuda, Y., Wang, J., Mori, Y., Zong, S., and Tanabe, T. (2007) Properties of Human Cav2.1 Channel with a Spinocerebellar Ataxia Type 6 Mutation Expressed in Purkinje Cells. Mol Cell Neurosci. 34, 261-270.

  53. Mark, M. D., Maejima, T., Kuckelsberg, D., Yoo, J. W., Hyde, R. A., Shah, V., Gutierrez, D., Moreno, R. L., Kruse, W., Noebels, J. L., and Herlitze, S. (2011) Delayed Postnatal Loss of P/Q-Type Calcium Channels Recapitulates the Absence Epilepsy, Dyskinesia, and Ataxia Phenotypes of Genomic Cacna1a Mutations. J Neurosci. 31, 4311-4326.

  54. Saito, H., Okada, M., Miki, T., Wakamori, M., Futatsugi, A., Mori, Y., Mikoshiba, K., and Suzuki, N. (2009) Knockdown of Cav2.1 Calcium Channels is Sufficient to Induce Neurological Disorders Observed in Natural Occurring Cacna1a Mutants in Mice. Biochem Biophys Res Commun. 390, 1029-1033.

  55. Unno, T., Wakamori, M., Koike, M., Uchiyama, Y., Ishikawa, K., Kubota, H., Yoshida, T., Sasakawa, H., Peters, C., Mizusawa, H., and Watase, K. (2012) Development of Purkinje Cell Degeneration in a Knockin Mouse Model Reveals Lysosomal Involvement in the Pathogenesis of SCA6. Proc Natl Acad Sci U S A. 109, 17693-17698.

  56. Watase, K., Barrett, C. F., Miyazaki, T., Ishiguro, T., Ishikawa, K., Hu, Y., Unno, T., Sun, Y., Kasai, S., Watanabe, M., Gomez, C. M., Mizusawa, H., Tsien, R. W., and Zoghbi, H. Y. (2008) Spinocerebellar Ataxia Type 6 Knockin Mice Develop a Progressive Neuronal Dysfunction with Age-Dependent Accumulation of Mutant CaV2.1 Channels. Proc Natl Acad Sci U S A. 105, 11987-11992.

  57. Eikermann-Haerter, K., Dilekoz, E., Kudo, C., Savitz, S. I., Waeber, C., Baum, M. J., Ferrari, M. D., van den Maagdenberg, A. M., Moskowitz, M. A., and Ayata, C. (2009) Genetic and Hormonal Factors Modulate Spreading Depression and Transient Hemiparesis in Mouse Models of Familial Hemiplegic Migraine Type 1. J Clin Invest. 119, 99-109.

  58. Plomp, J. J., van den Maagdenberg, A. M., Ferrari, M. D., Frants, R. R., and Molenaar, P. C. (2003) Transmitter Release Deficits at the Neuromuscular Synapse of Mice with Mutations in the Cav2.1 (alpha1A) Subunit of the P/Q-Type Ca2+ Channel. Ann N Y Acad Sci. 998, 29-32.

  59. Mori, Y., Wakamori, M., Oda, S., Fletcher, C. F., Sekiguchi, N., Mori, E., Copeland, N. G., Jenkins, N. A., Matsushita, K., Matsuyama, Z., and Imoto, K. (2000) Reduced Voltage Sensitivity of Activation of P/Q-Type Ca2+ Channels is Associated with the Ataxic Mouse Mutation Rolling Nagoya (Tg(Rol)). J Neurosci. 20, 5654-5662.

  60. Sawada, K., Sakata-Haga, H., Ando, M., Takeda, N., and Fukui, Y. (2001) An Increased Expression of Ca(2+) Channel Alpha(1A) Subunit Immunoreactivity in Deep Cerebellar Neurons of Rolling Mouse Nagoya. Neurosci Lett. 316, 87-90.

  61. Sawada, K., Komatsu, S., Haga, H., Oda, S., and Fukui, Y. (1999) Abnormal Expression of Tyrosine Hydroxylase Immunoreactivity in Purkinje Cells Precedes the Onset of Ataxia in Dilute-Lethal Mice. Brain Res. 844, 188-191.