Phenotypic Mutation 'hamel2'

• Allele: hamel2
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 54,393,097 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Fnip1
• Gene Name: folliculin interacting protein 1
• Synonym(s): A730024A03Rik
• Chromosomal Location: 54,329,025-54,409,061 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016] ; PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glycine changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000049026] [ENSMUSP00000121399]
• AlphaFold: Q68FD7
• SMART Domains: Protein: ENSMUSP00000049026; Gene: ENSMUSG00000035992; AA Change: G511V

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	41	159	1.7e-29	PFAM
Pfam:FNIP_M	316	549	9.9e-92	PFAM
Pfam:FNIP_C	975	1161	7.6e-73	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000046835)
• SMART Domains: Protein: ENSMUSP00000121399; Gene: ENSMUSG00000035992; AA Change: G487V

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	17	139	3.9e-36	PFAM
Pfam:FNIP_M	288	526	5.1e-87	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000143650)
• Meta Mutation Damage Score: 0.9195
• Is this an essential gene?: Probably essential (E-score: 0.790)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:36 PM by Diantha La Vine
• Record Created: 2018-05-08 10:27 PM by Bruce Beutler
• Record Posted: 2018-06-15
• Science Writers: Anne Murray
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_173753; MGI:105128

Alleles Listed at MGI

All Mutations and Alleles(7) : Chemically induced (ENU)(2) Chemically induced (other)(1) Gene trapped(2) Targeted(2)

Phenotypic Description

Figure 1. Hamel2 mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Hamel2 mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Hamel2 mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Hamel2 mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Hamel2 mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Hamel2 mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Hamel2 mice exhibit reduced B220 expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hamel2 phenotype was identified among G3 mice of the pedigree R6009, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2) with concomitant increased frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), and CD8+ T cells (Figure 5) in the peripheral blood. The frequency of peripheral blood B1 cells was also increased (Figure 6). The expression of B220 was reduced on peripheral blood B cells (Figure 7).

Nature of Mutation

Figure 8. Linkage mapping of the increased B1 cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R6009. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Fnip1:  a G to T transversion at base pair 54,502,271 (v38) on chromosome 11, or base pair 64,127 in the GenBank genomic region NC_000077.  The strongest association was found with a recessive model of inheritance to the normalized B1 cell frequency, wherein one variant homozygote departed phenotypically from 30 homozygous reference mice and 36 heterozygous mice with a P value of 5.116 x 10^-56 (Figure 8).

The mutation corresponds to residue 1,650 in the mRNA sequence NM_173753 within exon 14 of 18 total exons.

1634 CTTGGAGATTTGTATGGCGCTATTGGATCTCCT 506  -L--G--D--L--Y--G--A--I--G--S--P-

The mutated nucleotide is indicated in red. The mutation results in a glycine to valine substitution at position 511 (G511V) in the FNIP1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 9. Alignment of the five conserved domains of FNIP1.  There are five blocks of conserved amino acid sequence with at least 35% similarity between FNIP1 orthologs in Homo sapiens, Xenopus tropicalis, Danio rerio, Drosophila melanogaster, and Caenorhabditis elegans.  The mouse sequences within the conserved regions are homologous to the human sequence with the exception that the mouse FNIP1 is one amino acid shorter (1165 aa) than the human (1166 aa).  The hamel2 mutation results in a glycine to valine substitution at position 511. Other mutations found in FNIP1 are noted. Click on each mutation for more information. Adapted from (1).

Fnip1 encodes the 1,165 amino acid folliculin (FLCN)-interacting protein 1 (FNIP1) protein. BLAST and SMART analysis revealed no known functional domains in FNIP1; however, there are five blocks of conserved amino acid sequence with at least 35% similarity between FNIP1 orthologs in Homo sapiens, Xenopus tropicalis, Danio rerio, Drosophila melanogaster, and Caenorhabditis elegans. Amino acids 300 to 1166 of FNIP1 (containing all but the first conserved block) are essential for binding to the C-terminus of FLCN; full-length FNIP1 is required for maximum binding (1). In addition to FLCN [and putatively FNIP2 (2;3)], FNIP1 interacts with HSP90, as well as with the alpha, beta, and gamma subunits of 5’-AMP-activated protein kinase (AMPK) (1).

The hamel2 mutation results in a glycine to valine substitution at position 511 (G511V) in the FNIP1 protein.

Please see the record hamel for more information about Fnip1.

Putative Mechanism

The FLCN/FNIP complex negatively regulates AMPK, subsequently leading to alterations in AMPK-mTOR signaling (4). Modulation of the interaction between FLCN and FNIP1 by rapamycin and nutrient load suggests that FLCN and FNIP1 proteins are both involved in energy and/or nutrient sensing through AMPK and mTOR signaling pathways (1). mTOR signaling regulates the differentiation, activation, and function of several immune cell types including mast cells, neutrophils, natural killer cells, γδ T cells, macrophages, dendritic cells (DCs), T cells and B cells [(5-8); reviewed in (9)].

Fnip1 knockout (KO) mice are viable and fertile, but they display a marked reduction in spleen size as well as an almost complete lack of conventional splenic CD19⁺ cells, B220^lowCD19^high peritoneal B1 cells, and B cells in the bone marrow with a concomitant accumulation of B220^lowCD43⁺CD25−pro-B cells (10). Thymus size, thymocyte numbers, and peripheral T cells as well as bone marrow monocyte, granulocyte, and erythrocyte lineages were normal in the Fnip1 KO animals. The reduced cell numbers were due to increased cell death of peripheral pro-B and pre-B cells in the KO; overexpression of antiapoptoic protein Bcl2 in the B cell compartment led to increased B220⁺IgM⁺ B cells in the bone marrow. Taken together, these results show that FNIP1 is essential for the survival of B-cells in the bone marrow. The defect in pro-B cell development was not caused by changes in V(D)J recombination or the failure to express a functional B cell receptor.

An ENU-induced Fnip1 mutant with a 32 bp deletion in exon 9, which resulted in coding of a premature stop codon at amino acid 293 exhibited changes in skeletal muscle, hypertrophic cardiomyopathy, and increased liver glycogen content (11). The Fnip1 mutant mice also showed a block at the pre-B cell stage in the bone marrow. Mature B cells were not detected in the bone marrow or the spleen and B1 B lymphocytes were not found in the peritoneal and pleural cavities. This study determined that FNIP1 mediates B cell development at the large pre-B to small pre-B cell transition; no changes to the signals from the pre-BCR and IL-7 receptor were detected in the Fnip1 mutant animals. Reduced Fnip1 expression also led to metabolic imbalance, which triggered apoptosis in response to pre-BCR stimulation, nutrient deprivation, or oncogene activation. FNIP1 was proposed to act as a molecular switch that permits pre-B cell differentiation and survival and FNIP1 ensures that maturing B cells have adequate metabolic capacity to finish maturing (11).

FNIP1 is necessary for B cell development (4). The phenotypes observed in the hamel2 mice indicate loss of FNIP1^hamel2.

Primers

PCR Primer
hamel2_pcr_F: ACAGCTGTTTAGAAACACAGC
hamel2_pcr_R: TGGTAGTAATCACTGTGCCTGG

Sequencing Primer
hamel2_seq_F: AACAAAACCTGTTCACCTTTCTC
hamel2_seq_R: CTGTGCCTGGCATAACAATG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 404 nucleotides is amplified (chromosome 11, + strand):

1   acagctgttt agaaacacag ctaaaaaaac aaaaacaaaa cctgttcacc tttctccctg
61  gttaaaacct ctcatcttat cctactttct tgaataatca gtcatctttt aaagtactta
121 agagtaaatt atgaacttgt atgaggaggt ttctcatgat tgaaagactg tttagctgtg
181 tatttcttaa ctgatctttt ttattgcagg agatttgtat ggcgctattg gatctcctgt
241 acggttagca agaactgtag tcgttggcaa acgacaagac ctggtccaga gactgcttta
301 ttttcttact tacttcatca gatgctctga acttcaagaa acccatcttt tagaaaatgg
361 agaagatgaa gccattgtta tgccaggcac agtgattact acca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Baba, M., Hong, S. B., Sharma, N., Warren, M. B., Nickerson, M. L., Iwamatsu, A., Esposito, D., Gillette, W. K., Hopkins, R. F.,3rd, Hartley, J. L., Furihata, M., Oishi, S., Zhen, W., Burke, T. R.,Jr, Linehan, W. M., Schmidt, L. S., and Zbar, B. (2006) Folliculin Encoded by the BHD Gene Interacts with a Binding Protein, FNIP1, and AMPK, and is Involved in AMPK and mTOR Signaling. Proc Natl Acad Sci U S A. 103, 15552-15557.

  2. Hasumi, H., Baba, M., Hong, S. B., Hasumi, Y., Huang, Y., Yao, M., Valera, V. A., Linehan, W. M., and Schmidt, L. S. (2008) Identification and Characterization of a Novel Folliculin-Interacting Protein FNIP2. Gene. 415, 60-67.

  3. Takagi, Y., Kobayashi, T., Shiono, M., Wang, L., Piao, X., Sun, G., Zhang, D., Abe, M., Hagiwara, Y., Takahashi, K., and Hino, O. (2008) Interaction of Folliculin (Birt-Hogg-Dube Gene Product) with a Novel Fnip1-Like (FnipL/Fnip2) Protein. Oncogene. 27, 5339-5347.

  4. Siggs, O. M., Stockenhuber, A., Deobagkar-Lele, M., Bull, K. R., Crockford, T. L., Kingston, B. L., Crawford, G., Anzilotti, C., Steeples, V., Ghaffari, S., Czibik, G., Bellahcene, M., Watkins, H., Ashrafian, H., Davies, B., Woods, A., Carling, D., Yavari, A., Beutler, B., and Cornall, R. J. (2016) Mutation of Fnip1 is Associated with B-Cell Deficiency, Cardiomyopathy, and Elevated AMPK Activity. Proc Natl Acad Sci U S A. 113, E3706-15.

  5. Mills, R. E., and Jameson, J. M. (2009) T Cell Dependence on mTOR Signaling. Cell Cycle. 8, 545-548.

  6. Weichhart, T., and Saemann, M. D. (2009) The Multiple Facets of mTOR in Immunity. Trends Immunol. 30, 218-226.

  7. Delgoffe, G. M., and Powell, J. D. (2009) MTOR: Taking Cues from the Immune Microenvironment. Immunology. 127, 459-465.

  8. Thomson, A. W., Turnquist, H. R., and Raimondi, G. (2009) Immunoregulatory Functions of mTOR Inhibition. Nat Rev Immunol. 9, 324-337.

  9. Powell, J. D., Pollizzi, K. N., Heikamp, E. B., and Horton, M. R. (2011) Regulation of Immune Responses by mTOR. Annu Rev Immunol. .

  10. Baba, M., Keller, J. R., Sun, H. W., Resch, W., Kuchen, S., Suh, H. C., Hasumi, H., Hasumi, Y., Kieffer-Kwon, K. R., Gonzalez, C. G., Hughes, R. M., Klein, M. E., Oh, H. F., Bible, P., Southon, E., Tessarollo, L., Schmidt, L. S., Linehan, W. M., and Casellas, R. (2012) The Folliculin-FNIP1 Pathway Deleted in Human Birt-Hogg-Dube Syndrome is Required for Murine B-Cell Development. Blood. 120, 1254-1261.

  11. Park, H., Staehling, K., Tsang, M., Appleby, M. W., Brunkow, M. E., Margineantu, D., Hockenbery, D. M., Habib, T., Liggitt, H. D., Carlson, G., and Iritani, B. M. (2012) Disruption of Fnip1 Reveals a Metabolic Checkpoint Controlling B Lymphocyte Development. Immunity. 36, 769-781.