Allele | L1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 96,827,513 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ G (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Gja8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | gap junction protein, alpha 8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Cnx50, connexin 50, dcm, Cx50, Lop10, alpha 8 connexin, Aey5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 96,820,882-96,833,336 bp (-) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane connexin protein that is necessary for lens growth and maturation of lens fiber cells. The encoded protein is a component of gap junction channels and functions in a calcium and pH-dependent manner. Mutations in this gene have been associated with zonular pulverulent cataracts, nuclear progressive cataracts, and cataract-microcornea syndrome. [provided by RefSeq, Dec 2009] PHENOTYPE: Homozygous mutants exhibit microphthalmia, with small lenses and nuclear or total cataracts. Heterozygotes may be equally or less affected, depending on the particular mutation and the genetic background. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Serine changed to Proline | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P28236 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000049532 Gene: ENSMUSG00000049908 AA Change: S50P
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.7408 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Spontaneous(1) Chemically induced(3) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 030332-UCD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2016-05-13 3:09 PM by Stephen Lyon | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2012-02-02 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description | The L1 mutant was identified among G1 mice born to ENU-mutagenized sires by slit-lamp examination, which detects cataracts (1). Heterozygous and homozygous animals develop cataracts that affect the entire lens and also have small eyes (30% the size of wild type at the age of 3 weeks; Figure 1). Although both heterozygous and homozygous L1 animals develop similar postnatal phenotypes, examination of lens development revealed significant differences in lens defects. Mature fiber cells are severely altered in both genotypes, but the elongation of primary fiber cells is significantly perturbed only in heterozygous animals. At embryonic day (E) 15.5, a large cystic lumen was observed in the lens between posterior primary fiber cells and anterior epithelium with 100% penetrance in heterozygote L1 mice. No such defect was observed in wild type or homozygous animals. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
The L1 mutation was mapped to Chromosome 3, and corresponds to a T to C transition at position 219 of the Gja8 transcript (Figure 2), in exon 2 of 2 total exons. The first exon encodes the majority of the 5’ untranslated region of Gja8.
204 TGGGGCGATGAGCAATCTGATTTTGTATGCAAC
43 -W--G--D--E--Q--S--D--F--V--C--N-
The mutated nucleotide is indicated in red lettering.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Gja8 encodes mouse Connexin 50 (Cx50), a 440 amino acid protein member of a large family of connexin proteins (over 20 different connexins exist). These proteins are the subunits of gap junction channels which are an important means of cellular communication and allow the exchange of ions (e.g. Na+, K+, Ca2+, and Cl-), second messengers (e.g. cAMP, cGMP, and inositol trisphosphate (IP3)), nutrients and small metabolites (e.g. glucose and amino acids) between cells (2-4). Human Cx50 contains 433 residues and shares 89% identity with the mouse protein (5;6). The absence of introns in the coding sequence is a common feature for all connexins (2;5). Connexin proteins have four transmembrane domains with three intracellular regions (the N-terminus, a cytoplasmic loop and the C-terminus) and two extracellular loops (E1 and E2) (Figure 3 & 4) (4). Both the transmembrane and extracellular domains of Cx50 are highly homologous to those of other connexins. Each extracellular domain contains three characteristically spaced cysteine residues. The central and carboxy terminal cytoplasmic domains are not conserved (3;5;7;8). Connexins form hexamers known as connexons (Figure 5). Homomeric connexons are composed of six monomers of the same type of connexin whereas heteromeric connexons contain different subunit types (4;9). A gap junction channel is produced when two connexons from adjacent cells align in the extracellular space via interactions between their extracellular domains. Hundreds of gap junction channels come together to form gap junctions, which are morphologically defined as punctuate “plaques” of cell-cell contacts. In addition to the homomeric and heteromeric composition of individual connexons, gap junction channels are classified as homotypic (the docking of two identical connexons), or heterotypic (the docking of two different types of connexons) (10). Crystallography, electron microscopy and x-ray scattering analysis of various gap junction channels [reviewed in (8) and (3;7)], suggest an α-helical conformation for the four transmembrane domains of each connexin subunit. The third transmembrane domain of each subunit is thought to be the major pore-lining helix with the E1 domain contributing to the aqueous pore at the extracellular end (11). The two connexons composing the channel are rotationally staggered by approximately 30° relative to each other so that the α-helices of each connexin monomer are axially aligned with the α-helices of two adjacent monomers in the apposed connexon. The conserved cysteines in the extracellular loops of each connexin subunit form intra-monomer disulfide bonds between the two loops. These bonds stabilize the β structures formed by the extracellular domains and permit docking between connexons. The second extracellular loop primarily determines the specificity of connexon interaction (3;7;8). In some connexins, including Cx50, the C-terminal domain affects channel sensitivity to pH (12). The C-terminal domain of Cx50 has also been shown to be important in conductance of gap junction channels (13), while the N-terminal half of the protein, probably due to the E1 domain, appears to interact with monovalent cations (14). The cytoplasmic tail and loop are proposed to undergo regulatory posttranslational modifications (4). The L1 mutation substitutes a hydrophobic proline for a highly conserved hydrophilic serine at position 50, in the extracellular loop 1 (E1) of the Cx50 protein (Figure 4). Proline can disrupt α helixes and β sheets and may disrupt the β structure necessary for normal docking of connexons in the gap junction channel (15). This change may also affect the ability of Cx50 to interact appropriately with monovalent cations. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | In vertebrate species, Gja8 mRNA and protein expression has been reported to be specifically expressed in the embryonic and adult lens, particularly lens fiber cells (5;6;16;17). Localization of the Cx50 protein is on the membranes of cells particularly in areas of cell-cell contact, consistent with its role as a gap junction protein (5;6;16;17). Other studies have suggested additional areas of expression in the eye such as the corneal epithelium, ciliary body and Müller cells and astrocytes of the retina (18-21). In the ciliary body, Cx50 protein is found only in the nonpigmented epithelium (NPE) at apical and basolateral membranes while Cx43 is found in the apposing pigmented epithelium (PE) (20). Retinal expression of Cx50 was confirmed through Western blotting, RT-PCR and immunocytochemistry. Expression in the retina appears restricted to Müller cells and astrocytes of the optic nerve and along retinal projections into the CNS. In Müller cells, labeling is strongest in the endfeet and in the filamentous processes ensheathing the photoreceptors (21). Cx50 protein was also found transiently expressed in rat heart valves (22). However, examination of the antibody used in these studies on Cx50-deficient mice, suggests that it cross-reacts with an epitope other than Cx50 and that Cx50 expression is restricted to the lens fibers of the eye (17). Gja8 mRNA is observed throughout development and interestingly is expressed by embryonic day 9, preceding the development of the lens and the fiber cells (20;21;23). The significance of this expression pattern in early lens development is unknown. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
Because of its unique function and anatomy, the mammalian lens is dependent on the proper functioning of gap junction proteins. Along with Na+-K+ pumps, water channels and glucose transporters, gap junctions are critical components of the lens microcirculatory system, a flow of ionic current that is directed inwards at the poles and outwards at the equator and allows for nutrient and waste transport and maintenance of appropriate membrane potential. Gap junctions couple the metabolically active lens epithelium with lens fibers that have lost their organelles to help support homeostasis of the lens fibers. Moreover, gap junctions are differentially distributed on more equatorial fiber cells thus directing the microcirculatory current (2;26;27). Loss of transparency of the lens due to disruption of this microcirculatory system or the lens architecture causes cataracts, the most common cause of blindness in humans. Clinical descriptions of cataracts are based on the physical appearance and location of opacities within the lens. Whole cataracts affect the entire lens while nuclear cataracts affect the center of the lens and the primary lens fibers. Cortical cataracts originate in the lens cortex and lamellar cataracts are present in only one layer of the lens. The term “zonular” refers to opacities that are confined to one or more discrete zones of the lens other than the poles. The term “pulverulent” refers to powdery dustlike opacities that can be either zonular or widely dispersed throughout the lens. Cataracts are often caused by mutations in crystallins (see L1N, L10, L23), channel proteins involved in the transport of water and metabolites, and connexins, the components of gap junction channels (2;24;28). The lens expresses three connexins: Cx43, Cx46 and Cx50 (4). Lens fiber cells are coupled by intercellular gap junction channels formed by Cx46 and Cx50 connexin subunits, while Cx43 is expressed in lens epithelial cells. Mice with mutations in connexins Cx46 and Cx50 develop cataracts with varying phenotypes. Cx46-deficient animals display nuclear cataracts while Cx50-null mice exhibit both microphthalmia and nuclear cataracts (16;29;30). At postnatal day 14, the eyes of Cx50 knockout mice weigh 32% less than those of controls, whereas lens mass is reduced by 46%. Deletion of Cx50 does not alter the amount or distribution of Cx46 or Cx43. In addition, intercellular passage of tracers reveals the persistence of communication between all cell types in the Cx50-knockout lens. However, an increase in insoluble crystallin proteins is detected in these animals (16;29). Mice lacking both Cx46 and Cx50 display severe cataracts resulting from cell swelling and degeneration of inner fibers while normal peripheral fiber cells continue to form throughout life. Neither an increase of degraded crystallins nor an increase of water-insoluble crystallins is found in double mutant lenses. However, a substantial reduction of γ-crystallin proteins, but not α- and β-crystallins, is detected. These observations suggest that the presence of both Cx46 and Cx50 in fiber cells is critical for maintenance of the lens architecture (31). Targeted replacement of the Gja8 coding region with the Gja3 (Cx46) coding sequence corrects defects in cellular differentiation and prevents cataracts, but does not restore normal growth (27;32). A major difference observed between animals that exhibit loss of Cx46 and Cx50 is that in the absence of Cx50 there is a reduction in lens growth (16;29;30). Interestingly, mitosis was decreased in Cx50-defiecient mice, indicating that there is a role in epithelial mitosis for Cx50-mediated gap junction communication (4). Although the Gja8 knockout has a recessive phenotype, point mutations in the mouse Gja8 gene can produce dominant and semi-dominant cataract phenotypes with distinct characteristics (33-35). For instance, Gja8Aey5 results in a nuclear cataract caused by lack of degradation of fiber cell nuclei deep within the lens (35). Like the L1 mutation, some of these mutations perturb the first extracellular domain of Cx50 (1;34-36). The dominant nature of such mutations suggests that mutant Cx50 proteins form atypical and/or dysfunctional gap junction channels in the eye. This hypothesis is strengthened by the finding that transgenic overexpression of Cx50 in the lens also leads to cataracts perhaps by disrupting connexons containing Cx46 (37). Studies of Cx50 and other connexin mutants in mice suggest a strict requirement for certain types of gap junction channels (homotypic or heterotypic) exists in the development and homeostasis of the lens. Each of the approximately 20 connexin isoforms produces channels with distinct unitary conductances, molecular permeabilities, and electrical and chemical gating sensitivities (2;27). Channels formed from Cx50, in particular, exhibit a unique sensitivity to extracellular monovalent cations (14), which may be critical for its role in lens homeostasis. In humans, GJA8 is located on chromosome 1q21.1, and mutations are commonly linked to congenital cataracts. Cataract-microcornea syndrome (CCMC, OMIM #116150) has a distinct set of phenotypes within the group of autosomal dominant congenital cataracts. Three human mutations of GJA8 are associated with CCMC while six others are associated with zonular pulverulent cataract 1 (CZP1, OMIM #116200). These mutations are located throughout the Cx50 protein, although the majority of the mutations occur in the highly conserved transmembrane and extracellular domains that form functional critical structures in gap junction channels (38). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism |
Cx50 knockout phenotypes suggest that Cx50 plays a major role in the normal growth of the lens, thus affecting overall eye size. Lens cell division is significantly retarded during the first postnatal week and additional studies suggest other connexins cannot replace the critical role that Cx50 has in postnatal lens cell division (16;17;29;30;32;39;40). While knockout animals have a mild nuclear cataract phenotype, this phenotype is significantly affected by genetic modifiers and the lenses of knockout animals still retain functional gap junctions (16;29;39). The L1 mutation affects the highly conserved E1 domain of Cx50 which plays an important function in connexon interaction between cells and affects the properties of the resulting gap junction channel (3;7;8;14) (Figure 7). Similar to Cx50-null animals, L1 animals also develop cataracts (whole instead of nuclear) and microphthalmia. The L1 mutation is dominant and heterozygote animals display a different phenotype than do homozygous animals. Although mature fiber cells are severely altered in both homozygous and heterozygous animals, the elongation of primary fiber cells during embryonic development is altered only in heterozygous animals. Further examination of the L1 mutation in Cx46 and Cx50-deficient backgrounds revealed that mutant Cx50 subunits interact with wild type Cx50 subunits to form connexons and gap junctions that impair primary fiber cell elongation. Only heterozygous L1 animals displayed defects in primary fibers while Gja8L1/-animals did not. The presence or absence of Cx46 protein did not affect primary fiber formation in L1 heterozygotes, but the absence of Cx46 protein in these animals surprisingly resulted in normal secondary fibers. This result suggests that mutant Cx50 subunits interact with Cx46 to disrupt the formation of postnatal secondary fibers. It is likely that Cx50-S50P connexin subunits are able to interact with wild type Cx46 and Cx50 proteins to form atypical connexons that have altered functions and interfere with normal lens development and maintenance (1). An additional study addressing the biophysical properties of L1 mutant Cx50-containing channels showed that channels comprising Cx50-S50Psubunits alone fail to induce electrical coupling, likely because these channels fail to localize to the plasma membrane at cell-cell contacts. In an in vitro assay, the mixed expression of Cx50-S50P and wild type Cx46 to create heteromeric connexons, resulted in functional intercellular channels with unique voltage-gating properties compared to wild typechannels. Mutated Cx50-S50P protein was able to colocalize with wild-type Cx46 in both transfected HeLa cells in vitro and mouse lens sections in vivo, further supporting the hypothesis that this altered form of Cx50 is able to form atypical connexons with wild-type connexin proteins perhaps interfering with the formation of appropriate gap junction channels (36). In order for the lens to remain transparent and to maintain the appropriate refractive index for the transmission and focusing of light on the retina, high concentrations of lens proteins, metabolites, ions need to be arranged among lens fiber cells (41). In addition to the role of connexin-mediated gap junction communication in maintaining lens growth and transparency, it has been found that gap junction communication can influence intracellular protein distribution in differentiated lens fiber cells before undergoing cell maturation (41). Cx50 was sufficient (in Cx46 knockout lenses) to facilitate the uniform distribution of GFP as well as fiber cell denucleation; Cx46 alone was less efficient (41). Loss of both Cx50 and Cx46 resulted in an abolishment in GFP exchange in inner differentiated fiber cells, inhibition of fiber cell elongation, disruption of denucleation, and degeneration in the lens core (41). The mechanism as to how Cx50-mediated gap junction communication mediates GFP transport remains unknown, however, it has been proposed that gap junction communication influences the formation of the macromolecular exchange pathway (41). The L1 mutation may be leading to an improper distribution of proteins within the cell subsequently leading to cataract formation. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping |
L1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
Primers for PCR amplification
L1(F): 5’-CGGCACAGATGAGGCACTTGATAG -3’
L1(R): 5’-TGTGGCAGACATAGGTCCTTAGCAG -3’
PCR program
1) 94°C 2:00
2) 94°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C ∞
Primers for sequencing
L1_seq(F): 5’- GAGATCATCTCAGAGTTGCACTG -3’
L1_seq(R): 5’- CATAGGTCCTTAGCAGTGTGCC -3’
The following sequence of 638 nucleotides (from Genbank genomic region NC_000069 for linear genomic sequence of Gja8) is amplified:
5433 cggcacag atgaggcact tgatagaagc
5461 tgttggatac tatgattgtt ccatcagttc caaaaggaaa gtcactccaa gagctaggaa
5521 agagatcatc tcagagttgc actgtggcca attagatttt gccttctgct tccttggtag
5581 tgagcaatgg gcgactggag tttcctggga aacatcttgg aagaggtgaa tgagcactcc
5641 actgtcatcg gcagagtctg gctcacagtg ctcttcatct tccgcatcct catcctcggg
5701 acagcagcgg agtttgtgtg gggcgatgag caatctgatt ttgtatgcaa cacccagcag
5761 ccaggctgtg agaatgtctg ctacgatgag gcctttccca tctcacacat ccgcctctgg
5821 gtgctgcaga tcatcttcgt ctccactcca tcgctgatgt acgtggggca cgcggtacac
5881 cacgttcgca tggaggagaa gcgaaaggac cgtgaagctg aggagctctg tcagcagtcg
5941 cgcagcaacg ggggtgagag ggtaccaatc gccccagacc aggccagcat ccggaagagc
6001 agcagcagta gcaaaggcac caagaagttc cggctggagg gcacactgct aaggacctat
6061 gtctgccaca
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Nora G. Smart, Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Victoria Webster | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Chun-hong Xia, Xin Du, Xiaohua Gong, Bruce Beutler |