Phenotypic Mutation 'L23'

• Allele: L23
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 65,102,243 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Crygd
• Gene Name: crystallin, gamma D
• Synonym(s): Aey4, DGcry-1, Cryg-1
• Chromosomal Location: 65,101,031-65,102,611 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Heterozygotes for a spontaneous mutation exhibit a dense nuclear cataract and mild microphthalmia by 2-months of age, followed by posterior capsular rupture into the posterior vitreous by 3-months. In homozygotes, the microphthalmia is more pronounced. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Aspartic acid
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P04342
• SMART Domains: Protein: ENSMUSP00000045327; Gene: ENSMUSG00000067299; AA Change: V76D

Domain	Start	End	E-Value	Type
XTALbg	3	82	3.23e-45	SMART
XTALbg	89	170	4.09e-47	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000045028)
• SMART Domains: Protein: ENSMUSP00000122528; Gene: ENSMUSG00000067299; AA Change: V73D

Domain	Start	End	E-Value	Type
XTALbg	1	79	1.77e-42	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000146122)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Possibly nonessential (E-score: 0.269)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: None
• MMRRC Submission: 030338-UCD
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2012-01-20
• Science Writers: Nora G. Smart
• Illustrators: Victoria Webster
• Authors: Kaijun Wang, Xin Du, Xiaohua Gong, Bruce Beutler

Accession Number

NCBI RefSeq: NM_007776; MGI: 88524

Alleles Listed at MGI

All alleles(7) : Gene trapped(1) Spontaneous(2) Chemically induced(4)

Phenotypic Description

The L23 phenotype (also known as Crygd^V76D), was identified by slit-lamp examination (which detects cataracts) of G1 mice born to ENU-mutagenized sires (1).  Heterozygous mice develop whole cataracts and have slightly small lenses, whereas homozygous mice have severely deformed lenses that undergo posterior rupture.

 

By 1 week of age, L23 homozygous lenses contain vacuoles and retain fiber cell nuclei.  Heterozygous lens fibers are slow to eliminate their nuclei and still have nuclear remnants at 3 weeks of age.  Abnormal γ-crystallin aggregates are present in the nuclei of homozygous lens fiber cells.  Total levels of water-soluble γ-crystallins are reduced by 12% in heterozygous lenses and 50% in homozygous lenses relative to wild type (1).  Additionally, homozygous lenses are insensitive to cold-induced cataracts (see Background).  Heterozygous lenses have similar but less severe phenotypes.

Nature of Mutation

The L23 mutation was mapped to Chromosome 1, and corresponds to a T to A transversion at position 265 of the Crygd transcript, in exon 2 of 3 total exons.

 

249 GGTTTCAGTGACTCTGTCCGCTCCTGCCGCCTC

71  -G--F--S--D--S--V--R--S--C--R--L-

 

The mutated nucleotide is indicated in red lettering, and corresponds to the missense error V76D in the polypeptide chain.

Protein Prediction

Figure 1. Comparison of the homologous mouse and human γD-crystallins . (A) Human γD-crystallin is 84% homologous to (B) mouse γD-crystallin. Both proteins have 4 Greek Key (GK) motifs within two crystallin domain repeats. ( C) Mouse γ-crystallin (see L10 ), highlighting the 4 GKs. The N- and C-terminal aa locations for each of the Greek Key motifs are located under each GK section of the diagram. The L23 mutation (V76D) is within GK 2, and is indicated with a red asterisk. Three highly conserved sites in GK 4 are shown as follows: a tyrosine phosphorylation site (Tyr), a N-myristoylation site (N-m), and a PKC phosphorylation site (PKC). Images are adapted from ( 3 ), Graw, et. al. Exp. Eye Res., 88, 173-189 (2009) , and Ensemble release 65, Dec. 2011 .

Figure 2. Consensus protein model of γ-crystallin (see L10) (3). The model is based on the crystal structures of rat γE-, bovine γB-, and bovine γD-crystallin (PDB ID: 1A5D, PDB ID: 4GCR, and PDB ID: IELP, respectively). The protein has 4 "Greek Key" motifs, which consist of anti-parallel β-sheets in an interlocking fashion. These motifs are indicated by Roman numerals I-IV and are in gold. Three α-helices are shown in light green. The N and C termini are shown in orange. The L23 mutation is shown by the red asterisk and is indicated in red on the loop region of Greek Key motif II. The image was realized using the PyMol Molecular Graphics System, Ver. 1.2, Schrodinger, LLC.

Crygd encodes mouse γD-crystallin, a 174 amino acid protein that is a member of the β/γ superfamily of crystallin proteins that are primarily lens structural proteins (2). Seven proteins make up the γ-crystallins.  Human γD-crystallin also has 174 residues and is 84% identical to the mouse protein (Figure 1).

 

Unlike β-crystallins which form multimeric complexes, γ-crystallins are a homogeneous group of highly symmetrical, monomeric proteins with molecular masses around 21 kDa and typically lacking terminal extensions. Along with the β-crystallins, the γ-crystallins contain four highly conserved homologous regions known as Greek key motifs.  The Greek key motifs are able to tightly fold up, allowing these crystallins to be densely packed in the eye lens. The Cryg genes in all mammals consist of three exons: the first exon codes for three amino acids, and the subsequent two each encode two Greek key motifs (2;3). 

 

A common tertiary structure is predicted among γ-crystallins with most of the hydrophobic residues buried in the center and charged residues located mainly on the surface (Figure 2, see L10) (4). Protein structures of the γ-crystallins are based on X-ray crystallographic studies of several γ-crystallins as well as on molecular modeling programs (2;3;5;6). Each Greek key motif contains about 40 amino acids that form four antiparallel b-strands: a, b, c, and d. Strands a, b, and d align to form three strands of a β-pleated sheet, with a fourth strand provided by the short c strand of the adjacent Greek key motif. The most characteristic feature of this structure is an unusual fold-over on the β hairpin formed by strands a and b and also involving the beginning of strand d. This structure requires certain conserved amino acids, particularly a glycine, which is the only residue able to adopt dihedral angles. The Greek key motifs are highly conserved with some conservative amino acid variability that is more pronounced in the third motif of all γ-crystallins. The fourth Greek key motif contains several predicted sites that are at the same location in most γ-crystallins: a tyrosine phosphorylation site (amino acids 147-154), an N-myristoylation site (amino acids 158-163) and a PKC phosphorylation site (amino acids 166-168) (3). The N- and C-terminal domains are covalently linked to the rest of the protein by a six- to eight-amino acid connecting peptide, with the domain orientation determined by a patch of hydrophobic residues located at the interface between the domains (5;7). The small size and structure of γ-crystallins make them highly soluble and stable proteins.

The L23 mutation results in the replacement of the 76th amino acid residue, valine, with an aspartic acid in the second Greek key motif. This amino acid substitution does not appear to alter the tertiary structure of the protein, but the substituted aspartic acid forms two potential hydrogen bonds with Arg77 and Ser78 and alters the electrostatic potential of the protein. The isoelectric point (pI) of the mutant protein is shifted from 6.72 for wild type to 6.41 (1).

Expression/Localization

The ocular lens contains high levels of all crystallin proteins mostly in the cytoplasm of lens fibers, but the expression patterns of specific crystallin genes vary in the lens throughout embryonic development and adult life. The transcripts of α- and β-crystallins (see L1N) are first detected at the early elongation stage of primary fibers during embryonic development; γ-crystallin transcripts do not appear until the late elongation phase (mid-late gestation). All areas of the lens exhibit crystallin mRNA until the beginning of secondary fiber formation at embryonic day 18 (E18).  At that time, α- and β-crystallin mRNA are found in the equatorial part of the lens, unlike γ-crystallin transcripts which are localized in the lens core by postnatal day 1 (8). After birth, the concentration of αA-crystallin transcripts remains high until 6 months of age, while the concentration of γ-crystallin transcripts decreases gradually (8;9). Closer examination of γ-crystallin expression revealed lower levels of Crygb and Crygc mRNA and higher levels of Cryga, Crygd, Cryge, and Crygf during early stages of lens development. After 30-40 days of postnatal development, the levels of Cryga, Cryge, and Crygf mRNAs decline rapidly, and the Crygb, Crygc, and Crygd mRNAs became the major γ-crystallin proteins in the lens (9).

 

Both mRNA and protein expression of all the Cryg genes have been detected at low levels in the retina. γ-crystallins are localized particularly to the inner retina, outer plexiform layer, and the photoreceptors during postnatal development (10). 

Background

Figure 3. Normal development of the mammalian lens. Letters A through E illustrate key features in lens development. (A) The early surface ectoderm layer and the optic vesicle orginate from the diencephalon (not shown). (B) The ectoderm invaginates, forming the lens placode as it touches the optic vesicle. (C) Further movement of the ectodermal layer continues to form the primitive lens (i.e. the lens pit). The early retina begins as the presumptive neuroretina. (D) Complete closure of the lens placode results in the formation of the lens vescicle. The optic vescicle has now formed the optic cup. (E) The lens vescicle is closed by elongation of the primary fibers and the neuroretina is formed. The optic stalk will later become the optic nerve. (F) The cellular structure of the lens. The epithelium caps the front of the lens. Cubidal epithelial cells migrate toward the lens equator, where they begin a process of elongation ( i.e. differentiation) and eventual loss of intracellular organelles and the cell nucleus to form mature fibers. Once denucleation has occured, the lens fibers remain in place throught the life of the organism. Abbreviations: SE, surface ectoderm; OV, optic vesicle; LPL, lens placode; LP, lens pit; PNR, presumptive neuroretina; LV, lens vesicle; OC, optic cup; PF, primary fibers; NR, neuroretina; OS, optic stalk. Modified from: Mathias, R. T., White, T. W., and Gong, X. (2010) Lens Gap Junctions in Growth, Differentiation, and Homeostasis. Physiol. Rev. . 90 , 179-206 and Francis, P. J., Berry, V., Moore, A. T., and Bhattacharya, S. (1999) Lens Biology: Development and Human Cataractogenesis. Trends Genet. . 15 , 191-196 .

Figure 4. Normal (middle row) and abnormal (bottom row) development of mammalian lens fibers. (top) Cross-section of the normal lens. (middle row) Normal lens fibers develop from the differentiation zone through a process of denucleation and loss of organelles. Mature lens fibers filed with properly formed crystallin proteins provide a clear lens with a high refractive index to facillitate vision. (bottom row) Abnormal lense fiber development occurs upon several mutations in the α-, β-, and γ-crystallin families. The abnormal process contains a collection of possible mechanisms contributing to abnormal lens development ( i.e . the retention of nuclei and organelles, the formation of vacuoles, and abnormal aggregation of crystallin proteins) and potential cataract formation.

The ocular lens is a unique organ, able to focus light on the retina as a result of physiological properties and architecture that eliminate light scattering.  Normal development of the mouse lens begins by E9.5-10 when the developing optic vesicles have approached the surface ectoderm, which begins to thicken and form the lens placode (Figure 3).  At E10.5, the lens placode begins to invaginate to form the lens vesicle.  At E11-13, the lens is characterized by elongation of cells from the posterior wall of the lens vesicle to form primary lens fibers, leading to obliteration of the vesicle cavity.  These primary fibers are maintained throughout life and constitute the nucleus of the adult lens.  The lens of the adult eye is an avascular tissue surrounded by the lens capsule, an extracellular matrix (ECM) secreted by lens cells.  Beneath the capsule, a single layer of cuboidal epithelial cells covers the anterior surface and is bathed in aqueous humour.  Further enlargement of the lens continues by proliferation and elongation of the epithelial cells at the lens equator to form secondary fibers, a process that continues throughout adult life.  Lens fibers face the posterior chamber of the eye and are bathed in vitreous humour.  Bioactive molecules such as fibroblast growth factor (FGF), present in the vitreous humour, initiate the change from lens epithelial cell to lens fiber [reviewed in (11)]. The fiber cells adopt a flattened hexagonal profile that facilitates packing into an ordered array promoting lens transparency.  Additionally, the fiber cells lose their intracellular organelles and undergo dramatic changes in the expression of cytoplasmic and membrane proteins (Figure 4).  The high expression of soluble and stable cytoplasmic crystallins creates a high index of refraction.  The crystallin concentration is highest in the lens nucleus and creates a radial gradient in refractive index that corrects for the curved shape of the lens (11-14).  The avascular lens is maintained through a flow of ionic current that is directed inwards at the poles and outwards at the equator and allows for nutrient and waste transport and maintenance of appropriate membrane potential. Na⁺-K⁺ pumps, water channels, glucose transporters and gap junctions are all critical components of the lens microcirculatory system (14-16).

Loss of transparency of the lens due to disruption of the microcirculatory system or the lens architecture is manifested macroscopically in cataracts, the most common cause of blindness in humans.  Clinical descriptions of cataracts are based on the physical appearance and location of opacities within the lens.  Whole cataracts affect the entire lens while nuclear cataracts affect the center of the lens and the primary lens fibers.  Cortical cataracts originate in the lens cortex and lamellar cataracts are present in only one layer of the lens.  The term “zonular” refers to opacities that are confined to one or more discrete zones of the lens other than the poles.  The term “pulverulent” refers to powdery dustlike opacities that can be either zonular or widely dispersed throughout the lens.  Other terms have also been used to describe specific cataract phenotypes including cerulean, which describes a bluish coloring, and aculeiform, which refers to needle-like crystals in the lens. For a full list of clinical cataract phenotypes, please refer to (17).  Cataracts are often caused by mutations in crystallins (please see L10, L1N), channel proteins involved in the transport of water and metabolites, and connexins, the components of gap junction channels (please see L1) (2;11;15).  Cataracts can also occur in normal lenses at room temperature or lower.  These are known as cold cataracts and involve the aggregation of lens proteins, especially crystallins. (18).

The crystallin proteins in the lens are divided into three main families, α-, β-, and γ-crystallins with the β/γ-crystallins forming a superfamily.  Crystallins appear to have evolved from preexisting proteins that were recruited to new structural roles in the lens.  The α-crystallins, αA and αB, resemble heat-shock proteins and have chaperone functions, maintaining the stability and solubility of other proteins in the lens fibers (19).  The β/γ-crystallins show similarities to bacterial spore coat protein and to Physarum species stress-induced proteins and act solely as structural protein in the lens.  Additional crystallins, known as the taxon-specific crystallins, also exist.  These are often structurally related to metabolic enzymes such as lactate dehydrogenase and aldose reductase (2).

 

The γ-crystallin family consists of seven genes.  Six of these genes (Cryga-Crygf) are located in a cluster on mouse chromosome 1 or the long arm of human chromosome 2, q33-35 (20).  The seventh Cryg gene (Crygs) maps to mouse chromosome 16 and human chromosome 3.  In mice, mutations in all of the Cryg genes have been shown to cause mostly semidominant cataracts of varying phenotypes and severity depending on the nature of the mutation (3;21).  Ten of these mutations can be found in the Cryge locus and six in the Crygd gene suggesting that these two genes are hot spots for cataract mutations (1;3;22;23). Crygd^Lop12 results in a truncated 156 amino acid γD-crystallin.  This mutation is not predicted to affect the tertiary structure of the protein, but Lop12 mutant lenses contain increased levels of insoluble crystallins and display nuclear cataracts (23).  The Crygd^ENU4011 mutation replaces a highly conserved leucine at position 45 with a proline.  The mutation is predicted to prevent the second Greek key motif from forming.  Animals with this mutation also display nuclear cataracts. Crygd^ENU910 results in an isoleucine to phenylalanine switch at position 90 in the protein.  Although the pI of the mutated protein is higher than wild type, no change in tertiary structure occurs. Animals with this mutation have mild cataracts.  Crygd^K10 results in a truncated protein missing the fourth Greek key motif, and mutant animals display totalataracts (3).  Finally, the Crygd^Aey4 allele contains an identical missense mutation as L23, suggesting that this is a hot spot for ENU-induced mutagenesis in the mouse genome.  Homozygous Aey4 animals, which are on a C3H strain background, exhibit similar phenotypes as heterozygous L23 mice, which are on a C57BL6/J background.  These observations suggest that different mouse strains carry genetic modifiers that influence cataracts caused by the γD-V76D mutation (22).

 

Mutations in CRYG genes also result in inherited cataracts in humans.  Missense mutations of CRYGC and CRYGD cause dominant cataracts and some of these are due to altered solubility or aggregation of the mutant proteins (OMIM #604219) (1;24;25).  Recently, another missense mutation of CRYGD resulting in protein truncation and loss of the fourth Greek key motif, was found to cause cataract-microcornea syndrome (CCMC, OMIM #116150) (26).

Putative Mechanism

The substitution of the 76th valine with aspartic acid in the γD-crystallin protein results in mutant protein that is less water-soluble and forms aggregates with other γ-crystallins in the nuclei of lens fiber cells in homozygous L23 lenses and to a lesser extent, in heterozygous lenses. Increased levels of water-insoluble proteins correlate with a reduction of cold cataracts in these animals. Aside from the increased level of water-insoluble proteins, L23 mutant lenses also display a reduction in levels of the connexin proteins, Cx46 and Cx50. Decreased levels of these proteins may affect gap junction communication and lens homeostasis perhaps resulting in the posterior rupture seen in homozygous lenses (please see L1). Cataracts in the L23 mutants are probably caused by the presence of insoluble lens structural proteins, and also by light scattering due to sustained cell nuclei or nuclear remnants (1). 

 

Several cataract causing mutations in γD-crystallin result in mutant proteins with little change in the tertiary structure but significant changes in solubility properties including inverse solubility with temperature. The inverted temperature dependence of solubility has been associated with hydrophobic intermolecular interactions (25). It is possible that the loss of cold cataracts in L23 mutant animals could be due to a similar solubility property of the γD-V76D mutant protein. The shift in isoelectric point of γD-V76D may also alter the solubility of this protein in the lens environment leading to the phenotypes observed in L23 mutant animals. Acidification of γ-crystallins associated with an increase in insolubility occurs during ageing and may contribute to age-related cataracts (27). 

Primers

Primers cannot be located by automatic search.

Genotyping

L23 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

L23(F): 5’- GGCATCCTCATTTTGGGAAGGGAC -3’

L23(R): 5’- GCCACAAATACGTAGGGGCCAATAG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 35X

6) 72°C             3:00

7) 4°C               ∞

 

Primers for sequencing

L23_seq(F): 5’- GATCACCTTCTATGAGGACCG -3'

L23_seq(R): 5’- TGTAACTGGGTAACACCTTGC -3’

 

The following sequence of 528 nucleotides (from Genbank genomic region NC_000067 for linear genomic sequence of Crygd) is amplified:

 

   27                                      ggca tcctcatttt gggaagggac ctgccctggg

 61 ggccaggcca catcaggcct ctgagccctg ccttgccttg ccttacagat caccttctat

121 gaggaccgcg gcttccaggg ccgccactat gagtgcagca ccgaccactc caacctgcag

181 ccctacttca gccgctgcaa ctctgtgcgc gtggacagtg gctgctggat gctctatgag

241 cagcccaact tcacgggctg ccagtacttc ctgcgtcgcg gggactaccc tgactaccag

301 cagtggatgg gtttcagtga ctctgtccgc tcctgccgcc tcatccccca cgtgagtcca

361 gattctcaag actgaggcac tgaagaccct gactgcagtt gccagtataa ggttaaatgt

421 tgaaagcaga gctgagcctg cttgtaaaga aaaacccata gctagaatta attaggtcaa

481 tagttcccac aacatccaaa aagcaaggtg ttacccagtt acaactattc tattggcccc

541 tacgtatttg tggc

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1.  Wang, K., Cheng, C., Li, L., Liu, H., Huang, Q., Xia, C. H., Yao, K., Sun, P., Horwitz, J., and Gong, X. (2007) GammaD-crystallin associated protein aggregation and lens fiber cell denucleation, Invest Ophthalmol. Vis. Sci. 48, 3719-3728.

   2.  Wistow, G. J. and Piatigorsky, J. (1988) Lens crystallins: the evolution and expression of proteins for a highly specialized tissue, Annu. Rev. Biochem. 57, 479-504.

   3.  Graw, J., Neuhauser-Klaus, A., Klopp, N., Selby, P. B., Loster, J., and Favor, J. (2004) Genetic and allelic heterogeneity of Cryg mutations in eight distinct forms of dominant cataract in the mouse, Invest Ophthalmol. Vis. Sci. 45, 1202-1213.

   4.  Liu, H., Du, X., Wang, M., Huang, Q., Ding, L., McDonald, H. W., Yates, J. R., III, Beutler, B., Horwitz, J., and Gong, X. (2005) Crystallin {gamma}B-I4F mutant protein binds to {alpha}-crystallin and affects lens transparency, J. Biol. Chem. 280, 25071-25078.

   5.  Ebersbach, H., Fiedler, E., Scheuermann, T., Fiedler, M., Stubbs, M. T., Reimann, C., Proetzel, G., Rudolph, R., and Fiedler, U. (2007) Affilin-novel binding molecules based on human gamma-B-crystallin, an all beta-sheet protein, J. Mol. Biol. 372, 172-185.

   6.  Basak, A., Bateman, O., Slingsby, C., Pande, A., Asherie, N., Ogun, O., Benedek, G. B., and Pande, J. (2003) High-resolution X-ray crystal structures of human gammaD crystallin (1.25 A) and the R58H mutant (1.15 A) associated with aculeiform cataract, J. Mol. Biol. 328, 1137-1147.

   7.  Flaugh, S. L., Kosinski-Collins, M. S., and King, J. (2005) Interdomain side-chain interactions in human gammaD crystallin influencing folding and stability, Protein Sci. 14, 2030-2043.

   8.  Treton, J. A., Jacquemin, E., Courtois, Y., and Jeanny, J. C. (1991) Differential localization by in situ hybridization of specific crystallin transcripts during mouse lens development, Differentiation 47, 143-147.

   9.  Goring, D. R., Breitman, M. L., and Tsui, L. C. (1992) Temporal regulation of six crystallin transcripts during mouse lens development, Exp. Eye Res. 54, 785-795.

 10.  Jones, S. E., Jomary, C., Grist, J., Makwana, J., and Neal, M. J. (1999) Retinal expression of gamma-crystallins in the mouse, Invest Ophthalmol. Vis. Sci. 40, 3017-3020.

 11.  Tholozan, F. M. and Quinlan, R. A. (2007) Lens cells: more than meets the eye, Int. J. Biochem. Cell Biol. 39, 1754-1759.

 12.  Zhou, L., Chen, T., and Church, R. L. (2002) Temporal expression of three mouse lens fiber cell membrane protein genes during early development, Mol. Vis. 8, 143-148.

 13.  Bassnett, S. (2005) Three-dimensional reconstruction of cells in the living lens: the relationship between cell length and volume, Exp. Eye Res. 81, 716-723.

 14.  Donaldson, P., Kistler, J., and Mathias, R. T. (2001) Molecular solutions to mammalian lens transparency, News Physiol Sci. 16, 118-123.

 15.  Gerido, D. A. and White, T. W. (2004) Connexin disorders of the ear, skin, and lens, Biochim. Biophys. Acta 1662, 159-170.

 16.  White, T. W. (2002) Unique and redundant connexin contributions to lens development, Science 295, 319-320.

 17.  Reddy, M. A., Francis, P. J., Berry, V., Bhattacharya, S. S., and Moore, A. T. (2004) Molecular genetic basis of inherited cataract and associated phenotypes, Surv. Ophthalmol. 49, 300-315.

 18.  Lo, W. K. (1989) Visualization of crystallin droplets associated with cold cataract formation in young intact rat lens, Proc. Natl. Acad. Sci. U. S. A 86, 9926-9930.

 19.  Horwitz, J. (1992) Alpha-crystallin can function as a molecular chaperone, Proc. Natl. Acad. Sci. U. S. A 89, 10449-10453.

 20.  Hulsebos, T. J., Cerosaletti, K. M., Fournier, R. E., Sinke, R. J., Rocchi, M., Marzella, R., Jenkins, N. A., Gilbert, D. J., and Copeland, N. G. (1995) Identification of the human beta A2 crystallin gene (CRYBA2): localization of the gene on human chromosome 2 and of the homologous gene on mouse chromosome 1, Genom. 28, 543-548.

 21.  Klopp, N., Favor, J., Loster, J., Lutz, R. B., Neuhauser-Klaus, A., Prescott, A., Pretsch, W., Quinlan, R. A., Sandilands, A., Vrensen, G. F., and Graw, J. (1998) Three murine cataract mutants (Cat2) are defective in different gamma-crystallin genes, Genom. 52, 152-158.

 22.  Graw, J., Loster, J., Soewarto, D., Fuchs, H., Reis, A., Wolf, E., Balling, R., and Hrabe de, A. M. (2002) V76D mutation in a conserved gD-crystallin region leads to dominant cataracts in mice, Mamm. Genome 13, 452-455.

 23.  Smith, R. S., Hawes, N. L., Chang, B., Roderick, T. H., Akeson, E. C., Heckenlively, J. R., Gong, X., Wang, X., and Davisson, M. T. (2000) Lop12, a mutation in mouse Crygd causing lens opacity similar to human Coppock cataract, Genom. 63, 314-320.

 24.  Heon, E., Liu, S., Billingsley, G., Bernasconi, O., Tsilfidis, C., Schorderet, D. F., and Munier, F. L. (1998) Gene localization for aculeiform cataract, on chromosome 2q33-35, Am. J. Hum. Genet. 63, 921-926.

 25.  Pande, A., Annunziata, O., Asherie, N., Ogun, O., Benedek, G. B., and Pande, J. (2005) Decrease in protein solubility and cataract formation caused by the Pro23 to Thr mutation in human gamma D-crystallin, Biochemistry 44, 2491-2500.

 26.  Hansen, L., Yao, W., Eiberg, H., Kjaer, K. W., Baggesen, K., Hejtmancik, J. F., and Rosenberg, T. (2007) Genetic heterogeneity in microcornea-cataract: five novel mutations in CRYAA, CRYGD, and GJA8, Invest Ophthalmol. Vis. Sci. 48, 3937-3944.

 27.  Ueda, Y., Duncan, M. K., and David, L. L. (2002) Lens proteomics: the accumulation of crystallin modifications in the mouse lens with age, Invest Ophthalmol. Vis. Sci. 43, 205-215.