Phenotypic Mutation 'pee-wee'

• Allele: pee-wee
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 3,438,742 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Dclre1c
• Gene Name: DNA cross-link repair 1C
• Synonym(s): 9930121L06Rik, Art, Artemis
• Chromosomal Location: 3,425,168-3,465,167 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the SNM1 family of nucleases and is involved in V(D)J recombination and DNA repair. This protein has single-strand-specific 5'-3' exonuclease activity; it also exhibits endonuclease activity on 5' and 3' overhangs and hairpins. The protein also functions in the regulation of the cell cycle in response to DNA damage. Homozygous knockout mice for this gene exhibit severe combined immunodeficiency with sensitivity to ionizing radiation. Mutations in this gene in humans can cause Athabascan-type severe combined immunodeficiency (SCIDA) and Omenn syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014] ; PHENOTYPE: Homozygous mutant mice exhibit a combined immunodeficiency phenotype. While immunoglobulin rearrangement is completely blocked in B cells, the block of V(D)J rearrangement in T cells is partial. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000054300] [ENSMUSP00000098031] [ENSMUSP00000100053] [ENSMUSP00000110718]
• AlphaFold: Q8K4J0
• SMART Domains: Protein: ENSMUSP00000054300; Gene: ENSMUSG00000026648; AA Change: D165G

Domain	Start	End	E-Value	Type
Lactamase_B	10	193	7.78e0	SMART
Pfam:DRMBL	239	345	1.6e-22	PFAM
low complexity region	383	400	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	593	601	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000061852)
• SMART Domains: Protein: ENSMUSP00000098031; Gene: ENSMUSG00000026648; AA Change: D165G

Domain	Start	End	E-Value	Type
Lactamase_B	10	193	7.78e0	SMART
Pfam:DRMBL	239	345	6.5e-23	PFAM
low complexity region	476	484	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000100463)
• SMART Domains: Protein: ENSMUSP00000100053; Gene: ENSMUSG00000026648; AA Change: D165G

Domain	Start	End	E-Value	Type
Lactamase_B	10	193	7.78e0	SMART
Pfam:DRMBL	239	345	8.8e-23	PFAM
low complexity region	383	400	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
internal_repeat_1	518	534	4.97e-8	PROSPERO
internal_repeat_1	525	541	4.97e-8	PROSPERO
low complexity region	545	559	N/A	INTRINSIC
low complexity region	652	662	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000102988)
• SMART Domains: Protein: ENSMUSP00000110718; Gene: ENSMUSG00000026648; AA Change: D35G

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	25	70	1e-19	BLAST
Pfam:DRMBL	109	215	1.1e-22	PFAM
low complexity region	253	270	N/A	INTRINSIC
low complexity region	333	347	N/A	INTRINSIC
low complexity region	463	471	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000115066)
• SMART Domains: Protein: ENSMUSP00000116883; Gene: ENSMUSG00000026648

Domain	Start	End	E-Value	Type
Pfam:DRMBL	1	96	1.6e-21	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9717
• Is this an essential gene?: Possibly nonessential (E-score: 0.287)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:35 PM by Anne Murray
• Record Created: 2018-05-25 2:30 PM by Jamie Russell
• Record Posted: 2018-06-15
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue ZHong, Lauren Prince, Jamie Russell, Roberto Pontes, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_146114, NM_175683, NM_001110214, NM_001302674, NM_001302684; MGI:2441769

Alleles Listed at MGI

All Mutations and Alleles(11) : Chemically induced (ENU)(1) Gene trapped(1) Spontaneous(1) Targeted(7) Transgenic(1)

Phenotypic Description

Figure 1. Pee-wee mice are smaller and have rough coats.

Figure 2. Pee-wee mice exhibit reduced body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Pee-wee mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Pee-wee mice exhibit reduced CD4+ to CD8+ T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Pee-wee mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Pee-wee mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Pee-wee mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Pee-wee mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Pee-wee mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Pee-wee mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Pee-wee mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Pee-wee mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Pee-wee mice exhibit decreased frequencies of peripheral NK T cells. Flow cytometric analysis of peripheral blood was utilized to determine NK T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Pee-wee mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Pee-wee mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Pee-wee mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 17. Pee-wee mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 18. Pee-wee mice exhibit increased frequencies of peripheral central memory CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 19. Pee-wee mice exhibit increased frequencies of peripheral effector memory CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 20. Pee-wee mice exhibit increased frequencies of peripheral effector memory CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 21. Pee-wee mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 22. Pee-wee mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 23. Pee-wee mice exhibit increased expression of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 24. Pee-wee mice exhibit reduced expression of B220 on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 25. Pee-wee mice exhibit reduced systolic blood pressures compared to wild-type littermates. Normalized average data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The pee-wee phenotype was identified among G3 mice of the pedigree R6148, some of which showed reduced body sizes (Figure 1) and body weights (Figure 2) compared to wild-type littermates. The pee-wee mice showed a reduction in the B to T cell ratio (Figure 3) and a decrease in the CD4⁺ to CD8⁺ T cell ratio (Figure 4) as well as reduced frequencies of B cells (Figure 5), B1 cells (Figure 6), T cells (Figure 7), CD4+ T cells (Figure 8), CD4+ T cells in CD3+ T cells (Figure 9), CD8+ T cells (Figure 10), naïve CD4 T cells in CD4 T cells (Figure 11), naïve CD8 T cells in CD8 T cells (Figure 12), and NK T cells (Figure 13) with concomitant increased frequencies of CD44+ T cells (Figure 14), CD44+ CD4 T cells (Figure 15), CD44+ CD8 T cells (Figure 16), CD8+ T cells in CD3+ T cells (Figure 17), central memory CD4 T cells in CD4 T cells (Figure 18), effector memory CD4 T cells in CD4 T cells (Figure 19), effector memory CD8 T cells in CD8 T cells (Figure 20), all in the peripheral blood. Expression of CD44 was increased on peripheral blood T cells (Figure 21), CD4+ T cells (Figure 22), and CD8+ T cells (Figure 23). Expression of B220 was reduced on peripheral blood B cells (Figure 24). Some mice also showed reduced systolic blood pressures (Figure 25).

Nature of Mutation

Figure 26. Linkage mapping of the reduced reduced naive CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R6148. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Dclre1c: an A to G transition at base pair 3,437,705 (v38) on chromosome 2, or base pair 13,628 in the GenBank genomic region NC_000068. The strongest association was found with a recessive model of inheritance to the normalized peripheral blood naïve CD8 T cell frequency, wherein four variant homozygotes departed phenotypically from 15 homozygous reference mice and 32 heterozygous mice with a P value of 9.281 x 10^-45 (Figure 26). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

The mutation corresponds to residue 581 in the mRNA sequences NM_146114 within exon 7 of 14 total exons.

565 CAAAGTGTGTATTTAGACACGACTTTCTGTGAC 160 -Q--S--V--Y--L--D--T--T--F--C--D-

The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid to glycine substitution at position 165 (D165G) in the Artemis protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 27. Protein domains of Artemis. See the text for more details. The pee-wee mutation results in an aspartic acid to glycine substitution at position 165. Other mutations found in Artemis are noted. Click on each mutation for more information. The three basal phosphorylation sites in Artemis are indicated; a further 11 DNA-PKcs–mediated phosphorylation sites in the CTR are not designated. Abbreviations: MβL, metallo-β-lactamase domain; B-CASP, metallo-β-lactamase-associated CPSF ARTEMIS SNM1 PSO2 domain; CTR, C-terminal region.

Dclre1c encodes Artemis, a member of the metallo-β-lactamase protein superfamily (1). The metallo-β-lactamase proteins have two conserved domains: a metallo-β-lactamase domain (amino acids 10-193 in Artemis, SMART) and a β-CASP (metallo-β-lactamase-associated CPSF ARTEMIS SNM1 PSO2) domain (amino acids 239-345 in Artemis, SMART) [(2); reviewed in (3)]. Together, the metallo-β-lactamase and β-CASP domains are designated as the SNM1 domain [reviewed in (4)]. The SNM1 domain comprises the “catalytic core” of Artemis and contains nuclease activity as well as regulates protein-protein interactions including that of Artemis with the Cul4a-DDB1 ubiquitin complex [(5-7); reviewed in (4)].

The metallo-β-lactamase domain is a four-layered β-sandwich with two mixed β-sheets flanked by α-helices (1;8;9). The metallo-β-lactamase domain has five highly conserved sequence motifs that function in metal coordination, substrate binding, and enzymatic activities (8;9). Motif 1 contains an aspartate at the end of two β-strands of the first β-sheet  (8;10). Motif 2 contains a HxHxDH sequence (amino acids 33-38 in Artemis); the first two His residues in the motif (His33 and His35) are proposed to participate in metal ion coordination (10). The Asp amino acid in the motif (Asp37) is proposed to function in the hydrolysis reactions; the role of the third His (His38) in the motif is unknown (10). Asp37, His33, His35, His38, His115, and His319 coordinate the two active site metals, while Asp17, Asp136 and/or Asp165 are proposed to form salt bridges to the HxHxDH motif as well as H38 and H33 to stabilize the HxHxDH motif for optimum metal ion interaction (10). Motifs 3 and 5 are comprised of single histidines that are proposed to coordinate metal ions and the binding of negatively charged substrates (10). Motif 4 is a single aspartate that is proposed to participate in hydrolysis reactions (8;9). Asp165 or His319 are proposed to represent motif 5 (2;5). The β-CASP domain is between motif 4 and motif 5 and has an α/β fold with a five-stranded β-sheet surrounded on both sides with α-helices (11). Amino acid 341 determines nucleic acid specificity (i.e., a His at 341 is found in RNA-specific enzymes, while a Val at 341 is found in DNA-specific enzymes (2); Val341 is essential for the interaction of Artemis with DNA (5).  

The C-terminal region (CTR; amino acids 346-705) is dispensable for Artemis-mediated hairpin opening during V(D)J recombination (7) and is also required for DNA repair (12;13). Trp489, Phe492, and Ph493 within the CTR are essential for the formation of the Artemis-Ligase IV/XRCC4 complex (14). Ma et al. proposed an inhibitory role for the CTR, which would regulate Artemis function in the absence of DNA double-strand breaks (DSBs) (7). Several sites within the CTR of Artemis are phosphorylated by the phosphatidylinositol-3-OH kinase-like (PIK) kinases DNA-dependent protein kinase catalytic subunit (DNA-PK_CS; see the record for clover), ataxia telangiectasia mutated (ATM), and ATM- and Rad3-related (ATR) in response to DNA damage or cellular stress (7;15-18). Three basal (Ser503, Ser516, and Ser645) and 11 DNA-PKcs–mediated phosphorylation sites have been located in the CTR (6;7;19). Ser645 is also phosphorylated by ATM in response to ionizing radiation (IR) (15;17). Mutation of Ser645 to alanine (Ser645Ala) did not affect survival of the mutant cells after exposure to IR, indicating that phosphorylation at Ser645 is not functionally critical (7). Artemis phosphorylation is not required for Artemis-dependent DSB repair and V(D)J recombination (see “Background” section for more information about V(D)J recombination) (6).

The pee-wee mutation results in an aspartic acid to glycine substitution at position 165 (D165G) in the Artemis protein; Asp165 is within motif 5, which helps in metal coordination, substrate binding, and enzymatic activities.

Please see the record kiwis for more information about Dclre1c.

Putative Mechanism

Artemis has several functions. Artemis is an endonuclease that functions in homologous recombination, nonhomologous end-joining (NHEJ), and class switch recombination (20-24). For a detailed explanation of Artemis functions in these processes, please see the kiwis record. Artemis regulates recovery from the G2 checkpoint in response to IR through regulation of cyclin B/Cdk1 activation by retaining Cdk1/cyclin B at the centrosome and inhibiting its nuclear import during prophase (15-18). Artemis is also involved in S phase checkpoint recovery in response to replication fork blocking lesions (25). At the S phase checkpoint recovery, Artemis interacts with SCF^Fbw7 to mediate the degradation of cyclin E via the SCF^Fbw7 E3 ligase complex (25). Artemis interacts with the tumor suppressor p27 during the G1 phase of the cell cycle and is required for the ubiquitination and degradation of p27 by the Cul4A-DDB1 complex, which is required cell cycle progression at the G1-S and G0 to S transitions (26). Artemis is required for normal proliferative control of multipotent mesenchymal stem/progenitor cells (MSCs), especially after exposure to cytostress stimuli (27). Dclre1c deficiency resulted in chromosomal damage as well as enhanced resistance and proliferative potential in primary MSCs after stress (27). Artemis is a negative regulator of p53 in response to oxidative stress in primary cells and cancer cell lines (28).

Mutations in DCLRE1C are linked to severe combined (T⁻B⁻NK⁺) immunodeficiency associated with increased radiosensitivity (RS-SCID; OMIM: #602450), Athabascan SCID (SCID-A; OMIM:#602450), and Omenn syndrome (OS; OMIM: #603554) (1;29;30). Patients with RS-SCID exhibit defects in V(D)J recombination resulting in early maturation defects in B and T cells (1). Patients have absence of complete V(H)-J(H) gene rearrangements and subsequent differentiation arrest of B cells at the pre-BCR checkpoint (30). As a result, the patients display a complete absence of T- and B lymphocytes (31). Some RS-SCID patients have a predisposition to B cell lymphoma (32). Most patients with RS-SCID exhibit early lethality (at approximately 1 year of age) due to opportunistic infections. SCID-A is an autosomal recessive disorder in peoples of the Athabascan-speaking Native Americans (1;29). Similar to RS-SCID, patients present with an absence of both T and B cells due to defective coding joint and precise, but reduced signal joint formation during V(D)J recombination (29). OS is an autosomal recessive condition in which patients present with symptoms of SCID as well as erythrodermia, hepatosplenomegaly, lymphadenopathy, and alopecia (33). OS patients are classified as T⁺B^-NK⁺ SCID (33). Patients with OS often exhibit elevated or normal T cell counts that are activated and skewed toward a Th2 phenotype (34;35). V(D)J coding joints are normal in the T cells of OS patients. B cells in the OS patients are not detected. The eosinophilia and high IgE levels are the result of increased secretion of the Th2-type cytokines (36). The other immunoglobins were reduced or not detectable in the serum of OS patients. NK cell functions and numbers were unaffected in patients with OS. Patients with OS exhibit lethality; bone marrow transplantation is often successful in treating patients with OS (36). A DCLRE1C truncation mutation, D451fsX10, results in loss of the C-terminus of Artemis and has been linked to partial immunodeficiency and aggressive EBV-associated lymphoma (32). Patients have low levels of T and B cells, but exhibited lymphocytopenia and died of recurrent infections or lymphoma progression (32).

A spontaneous Dclre1c mutant (37) and Artemis knockout (Dclre1c^-/-) mice exhibit early T- and B-cell maturation arrest as well as increased sensitivity to IR (31;38;39). The number of CD11c⁺MHCII⁺ dendritic cells, CD3^-NK1.1⁺ NK cells, CD11b⁺ monocytes and Gr1⁺ granulocytes were comparable to those in wild-type mice (37;40). In the bone marrow of Dclre1c^-/- mice, B cell development was blocked at the B220⁺/CD43⁺ progenitor stage resulting in loss of B220⁺ CD43⁻ precursor and B220⁺ IgM⁺ immature B cell (12;31;37;38). Dclre1c^-/- mice also lacked peripheral B220⁺/IgM⁺ B cells and T cells (38-40). Thymocyte numbers were reduced by approximately 50-fold in the Dclre1c^-/- mice compared to wild-type or heterozygous littermates. Thymocytes in the Dclre1c^-/- mice  were predominantly DN T cells, but low numbers of DP and SP thymocytes was observed in some Dclre1c^-/- thymocytes indicating that some T cell development occurred (31;37-39). Most thymocytes were arrested in the CD44⁺CD25^- ("DN3") stage of development and few matured to the DP stage; the number of DN1 cells in the thymus were also reduced compared to wild-type levels (37;40). The thymus in the Dclre1c^-/- mice did not have a lymphocytic cortex and scattered lymphoid cells with abundant mitotic figures (40). T and B cell frequency were reduced in the lymph nodes and spleens of the Dclre1c^-/- mice (40). B cell development was arrested at the early progenitor stage (B220⁺CD43⁺) in the lymph nodes and spleens of the Dclre1c^-/- mice (40). In the lymph nodes and spleen of some Dclre1c^N/N mice, SP T cells (mostly CD4⁺ CD8⁻) were observed that also expressed surface CD3 and TCRα/β (38). The spleens from the Dclre1c^-/- mice had reduced fully developed lymphoid follicles; most lymphoid cells had larger nuclei with less dense chromatin and prominent nucleoli (40). The lymph nodes from the Dclre1c^-/- mice were smaller than those in wild-type mice and were depleted of mature lymphocytes and lymphoid follicles (40). Both T and B cell proliferation were reduced in response to Con A and LPS, respectively in the Dclre1c^-/- mice compared to wild-type mice (40).

A targeted Dclre1c mutation (Art^P70/P70; Dclre1c^tm1Jsek) in exon 14 resulted in a coding of a premature stop codon at amino acid 449 (Asp449X) and mimics a human DCLRE1C allele, Artemis-P70 (D451X) (12). The Artemis^P70 protein can interact with DNA-PKcs, and it retains exo- and endonuclease activities, but it is not phosphorylated (12). The number of thymocytes and splenocytes in the Art^P70/P70 mice were reduced compared to wild-type and heterozygous mice, but higher than those in Dclre1c knockout (Dclre1c^-/-; Dclre1c^tm1Fwa) mice (12). The Art^P70/P70 mice exhibited impaired V(D)J recombination, DSB repair, and increased chromosomal instability (12). T cell development was impaired at the DN3 stage, but some T cells did progress to the DP and SP stages (12). In the Art^P70/P70 mice, B cell development was defective at the transition from the pro-B to pre-B stage resulting in reduced percentage and number of pre-B cells than wild-type mice (12). The number of surface IgM-expressing cells in the bone marrow and peripheral lymphoid organs was reduced in the Art^P70/P70 mice (12). The Art^P70/P70 mice displayed a reduced frequency of both D to J and V to DJ rearrangements within the TCR-β locus (12). A modest decrease in the levels of D_H to J_H rearrangements in the pro- and pre-B cells from Art^P70/P70 mice; significant levels of D_H-J_H rearrangements occurred (12). Mouse embryonic fibroblasts from the Art^P70/P70 mice exhibited an intermediate hypersensitivity to IR compared to Dclre1c^-/- mice (12).

Conditional knockout of Dclre1c in mature B cells (Dclre1c^tm2.1Jpdv) resulted in defective switching to certain isotypes (IgG3 and IgA) after B cell activation or after KLH immunization; CSR was not significantly affected (39).

The pee-wee mouse phenocopies the previously characterized Dclre1c mutant and knockout models, indicating that the D165G mutation results in loss of Artemis function.

Primers

PCR Primer
pee-wee_pcr_F: TATAAGTCACTGGATCAGGTGTGC
pee-wee_pcr_R: GAAGTAATCACACCCCAGGG

Sequencing Primer
pee-wee_seq_F: CTGGATCAGGTGTGCAAAAGCC
pee-wee_seq_R: AGGGGACAGCTATACCCTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 429 nucleotides is amplified (chromosome 2, + strand):

1   tataagtcac tggatcaggt gtgcaaaagc caatattttt acgttttatt catttgtgca
61  tgggtacttt attgtataga aattgtttat cagtaaagtt gatgaacaaa atgtttgcaa
121 gtgagatgga acacctcaaa aataactgag ggtctatctc attttataca caattatgtc
181 ccacaaaatg gttaacacta tttttttttt cttttcagag taaaagacat ccaaagtgtg
241 tatttagaca cgactttctg tgacccaagg ttttatcaga tcccaagtcg tgtatgtttc
301 cctggggtga cagatatgcc tggggtgatg agtctccttg gggtagtggg tctgcctgga
361 gtggtgacct ggggtgtggc cactgtcttg ttgggagggt atagctgtcc cctggggtgt
421 gattacttc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Moshous, D., Callebaut, I., de Chasseval, R., Corneo, B., Cavazzana-Calvo, M., Le Deist, F., Tezcan, I., Sanal, O., Bertrand, Y., Philippe, N., Fischer, A., and de Villartay, J. P. (2001) Artemis, a Novel DNA Double-Strand Break repair/V(D)J Recombination Protein, is Mutated in Human Severe Combined Immune Deficiency. Cell. 105, 177-186.

  2. Callebaut, I., Moshous, D., Mornon, J. P., and de Villartay, J. P. (2002) Metallo-Beta-Lactamase Fold within Nucleic Acids Processing Enzymes: The Beta-CASP Family. Nucleic Acids Res. 30, 3592-3601.

  3. Kurosawa, A., and Adachi, N. (2010) Functions and Regulation of Artemis: A Goddess in the Maintenance of Genome Integrity. J Radiat Res. 51, 503-509.

  4. Yan, Y., Akhter, S., Zhang, X., and Legerski, R. (2010) The Multifunctional SNM1 Gene Family: Not just Nucleases. Future Oncol. 6, 1015-1029.

  5. Poinsignon, C., Moshous, D., Callebaut, I., de Chasseval, R., Villey, I., and de Villartay, J. P. (2004) The Metallo-Beta-lactamase/beta-CASP Domain of Artemis Constitutes the Catalytic Core for V(D)J Recombination. J Exp Med. 199, 315-321.

  6. Goodarzi, A. A., Yu, Y., Riballo, E., Douglas, P., Walker, S. A., Ye, R., Harer, C., Marchetti, C., Morrice, N., Jeggo, P. A., and Lees-Miller, S. P. (2006) DNA-PK Autophosphorylation Facilitates Artemis Endonuclease Activity. EMBO J. 25, 3880-3889.

  7. Ma, Y., Pannicke, U., Lu, H., Niewolik, D., Schwarz, K., and Lieber, M. R. (2005) The DNA-Dependent Protein Kinase Catalytic Subunit Phosphorylation Sites in Human Artemis. J Biol Chem. 280, 33839-33846.

  8. Aravind, L. (1999) An Evolutionary Classification of the Metallo-Beta-Lactamase Fold Proteins. In Silico Biol. 1, 69-91.

  9. Wang, Z., Fast, W., Valentine, A. M., and Benkovic, S. J. (1999) Metallo-Beta-Lactamase: Structure and Mechanism. Curr Opin Chem Biol. 3, 614-622.

  10. Pannicke, U., Ma, Y., Hopfner, K. P., Niewolik, D., Lieber, M. R., and Schwarz, K. (2004) Functional and Biochemical Dissection of the Structure-Specific Nuclease ARTEMIS. EMBO J. 23, 1987-1997.

  11. de Villartay, J. P., Shimazaki, N., Charbonnier, J. B., Fischer, A., Mornon, J. P., Lieber, M. R., and Callebaut, I. (2009) A Histidine in the Beta-CASP Domain of Artemis is Critical for its Full in Vitro and in Vivo Functions. DNA Repair (Amst). 8, 202-208.

  12. Huang, Y., Giblin, W., Kubec, M., Westfield, G., St Charles, J., Chadde, L., Kraftson, S., and Sekiguchi, J. (2009) Impact of a Hypomorphic Artemis Disease Allele on Lymphocyte Development, DNA End Processing, and Genome Stability. J Exp Med. 206, 893-908.

  13. Jacobs, C., Huang, Y., Masud, T., Lu, W., Westfield, G., Giblin, W., and Sekiguchi, J. M. (2011) A Hypomorphic Artemis Human Disease Allele Causes Aberrant Chromosomal Rearrangements and Tumorigenesis. Hum Mol Genet. 20, 806-819.

  14. Malu, S., De Ioannes, P., Kozlov, M., Greene, M., Francis, D., Hanna, M., Pena, J., Escalante, C. R., Kurosawa, A., Erdjument-Bromage, H., Tempst, P., Adachi, N., Vezzoni, P., Villa, A., Aggarwal, A. K., and Cortes, P. (2012) Artemis C-Terminal Region Facilitates V(D)J Recombination through its Interactions with DNA Ligase IV and DNA-PKcs. J Exp Med. 209, 955-963.

  15. Chen, L., Morio, T., Minegishi, Y., Nakada, S., Nagasawa, M., Komatsu, K., Chessa, L., Villa, A., Lecis, D., Delia, D., and Mizutani, S. (2005) Ataxia-Telangiectasia-Mutated Dependent Phosphorylation of Artemis in Response to DNA Damage. Cancer Sci. 96, 134-141.

  16. Zhang, X., Succi, J., Feng, Z., Prithivirajsingh, S., Story, M. D., and Legerski, R. J. (2004) Artemis is a Phosphorylation Target of ATM and ATR and is Involved in the G2/M DNA Damage Checkpoint Response. Mol Cell Biol. 24, 9207-9220.

  17. Poinsignon, C., de Chasseval, R., Soubeyrand, S., Moshous, D., Fischer, A., Hache, R. J., and de Villartay, J. P. (2004) Phosphorylation of Artemis Following Irradiation-Induced DNA Damage. Eur J Immunol. 34, 3146-3155.

  18. Geng, L., Zhang, X., Zheng, S., and Legerski, R. J. (2007) Artemis Links ATM to G2/M Checkpoint Recovery Via Regulation of Cdk1-Cyclin B. Mol Cell Biol. 27, 2625-2635.

  19. Soubeyrand, S., Pope, L., De Chasseval, R., Gosselin, D., Dong, F., de Villartay, J. P., and Hache, R. J. (2006) Artemis Phosphorylated by DNA-Dependent Protein Kinase Associates Preferentially with Discrete Regions of Chromatin. J Mol Biol. 358, 1200-1211.

  20. Beucher, A., Birraux, J., Tchouandong, L., Barton, O., Shibata, A., Conrad, S., Goodarzi, A. A., Krempler, A., Jeggo, P. A., and Lobrich, M. (2009) ATM and Artemis Promote Homologous Recombination of Radiation-Induced DNA Double-Strand Breaks in G2. EMBO J. 28, 3413-3427.

  21. Meek, K., Gupta, S., Ramsden, D. A., and Lees-Miller, S. P. (2004) The DNA-Dependent Protein Kinase: The Director at the End. Immunol Rev. 200, 132-141.

  22. Dip, R., and Naegeli, H. (2005) More than just Strand Breaks: The Recognition of Structural DNA Discontinuities by DNA-Dependent Protein Kinase Catalytic Subunit. FASEB J. 19, 704-715.

  23. Weterings, E., and Chen, D. J. (2007) DNA-Dependent Protein Kinase in Nonhomologous End Joining: A Lock with Multiple Keys? J Cell Biol. 179, 183-186.

  24. Franco, S., Murphy, M. M., Li, G., Borjeson, T., Boboila, C., and Alt, F. W. (2008) DNA-PKcs and Artemis Function in the End-Joining Phase of Immunoglobulin Heavy Chain Class Switch Recombination. J Exp Med. 205, 557-564.

  25. Wang, H., Zhang, X., Geng, L., Teng, L., and Legerski, R. J. (2009) Artemis Regulates Cell Cycle Recovery from the S Phase Checkpoint by Promoting Degradation of Cyclin E. J Biol Chem. 284, 18236-18243.

  26. Yan, Y., Zhang, X., and Legerski, R. J. (2011) Artemis Interacts with the Cul4A-DDB1DDB2 Ubiquitin E3 Ligase and Regulates Degradation of the CDK Inhibitor p27. Cell Cycle. 10, 4098-4109.

  27. Maas, S. A., Donghia, N. M., Tompkins, K., Foreman, O., and Mills, K. D. (2010) ARTEMIS Stabilizes the Genome and Modulates Proliferative Responses in Multipotent Mesenchymal Cells. BMC Biol. 8, 132-7007-8-132.

  28. Zhang, X., Zhu, Y., Geng, L., Wang, H., and Legerski, R. J. (2009) Artemis is a Negative Regulator of p53 in Response to Oxidative Stress. Oncogene. 28, 2196-2204.

  29. Li, L., Moshous, D., Zhou, Y., Wang, J., Xie, G., Salido, E., Hu, D., de Villartay, J. P., and Cowan, M. J. (2002) A Founder Mutation in Artemis, an SNM1-Like Protein, Causes SCID in Athabascan-Speaking Native Americans. J Immunol. 168, 6323-6329.

  30. Noordzij, J. G., Verkaik, N. S., van der Burg, M., van Veelen, L. R., de Bruin-Versteeg, S., Wiegant, W., Vossen, J. M., Weemaes, C. M., de Groot, R., Zdzienicka, M. Z., van Gent, D. C., and van Dongen, J. J. (2003) Radiosensitive SCID Patients with Artemis Gene Mutations show a Complete B-Cell Differentiation Arrest at the Pre-B-Cell Receptor Checkpoint in Bone Marrow. Blood. 101, 1446-1452.

  31. Benjelloun, F., Garrigue, A., Demerens-de Chappedelaine, C., Soulas-Sprauel, P., Malassis-Seris, M., Stockholm, D., Hauer, J., Blondeau, J., Riviere, J., Lim, A., Le Lorc'h, M., Romana, S., Brousse, N., Paques, F., Galy, A., Charneau, P., Fischer, A., de Villartay, J. P., and Cavazzana-Calvo, M. (2008) Stable and Functional Lymphoid Reconstitution in Artemis-Deficient Mice Following Lentiviral Artemis Gene Transfer into Hematopoietic Stem Cells. Mol Ther. 16, 1490-1499.

  32. Moshous, D., Pannetier, C., Chasseval Rd, R., Deist Fl, F., Cavazzana-Calvo, M., Romana, S., Macintyre, E., Canioni, D., Brousse, N., Fischer, A., Casanova, J. L., and Villartay, J. P. (2003) Partial T and B Lymphocyte Immunodeficiency and Predisposition to Lymphoma in Patients with Hypomorphic Mutations in Artemis. J Clin Invest. 111, 381-387.

  33. Ege, M., Ma, Y., Manfras, B., Kalwak, K., Lu, H., Lieber, M. R., Schwarz, K., and Pannicke, U. (2005) Omenn Syndrome due to ARTEMIS Mutations. Blood. 105, 4179-4186.

  34. Schandene, L., Ferster, A., Mascart-Lemone, F., Crusiaux, A., Gerard, C., Marchant, A., Lybin, M., Velu, T., Sariban, E., and Goldman, M. (1993) T Helper Type 2-Like Cells and Therapeutic Effects of Interferon-Gamma in Combined Immunodeficiency with Hypereosinophilia (Omenn's Syndrome). Eur J Immunol. 23, 56-60.

  35. Chilosi, M., Facchetti, F., Notarangelo, L. D., Romagnani, S., Del Prete, G., Almerigogna, F., De Carli, M., and Pizzolo, G. (1996) CD30 Cell Expression and Abnormal Soluble CD30 Serum Accumulation in Omenn's Syndrome: Evidence for a T Helper 2-Mediated Condition. Eur J Immunol. 26, 329-334.

  36. Aleman, K., Noordzij, J. G., de Groot, R., van Dongen, J. J., and Hartwig, N. G. (2001) Reviewing Omenn Syndrome. Eur J Pediatr. 160, 718-725.

  37. Barthels, C., Puchalka, J., Racek, T., Klein, C., and Brocker, T. (2013) Novel Spontaneous Deletion of Artemis Exons 10 and 11 in Mice Leads to T- and B-Cell Deficiency. PLoS One. 8, e74838.

  38. Rooney, S., Sekiguchi, J., Zhu, C., Cheng, H. L., Manis, J., Whitlow, S., DeVido, J., Foy, D., Chaudhuri, J., Lombard, D., and Alt, F. W. (2002) Leaky Scid Phenotype Associated with Defective V(D)J Coding End Processing in Artemis-Deficient Mice. Mol Cell. 10, 1379-1390.

  39. Rivera-Munoz, P., Soulas-Sprauel, P., Le Guyader, G., Abramowski, V., Bruneau, S., Fischer, A., Paques, F., and de Villartay, J. P. (2009) Reduced Immunoglobulin Class Switch Recombination in the Absence of Artemis. Blood. 114, 3601-3609.

  40. Li, L., Salido, E., Zhou, Y., Bhattacharyya, S., Yannone, S. M., Dunn, E., Meneses, J., Feeney, A. J., and Cowan, M. J. (2005) Targeted Disruption of the Artemis Murine Counterpart Results in SCID and Defective V(D)J Recombination that is Partially Corrected with Bone Marrow Transplantation. J Immunol. 174, 2420-2428.