Phenotypic Mutation 'charlotte_gray' (pdf version)
List |< first << previous [record 63 of 511] next >> last >|
Allelecharlotte_gray
Mutation Type nonsense
Chromosome13
Coordinate13,602,026 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Lyst
Gene Name lysosomal trafficking regulator
Synonym(s) D13Sfk13
Chromosomal Location 13,590,409-13,777,440 bp (+)
MGI Phenotype Strain: 1855968
Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells.
Accession Number

NCBI RefSeq: NM_010748; MGI: 107448

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
Y2780* in Ensembl: ENSMUSP00000106188 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Beach 3118 3408 1.25e-193 SMART
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Phenotypic Category pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(45) : Gene trapped(30) Spontaneous(8) Chemically induced(6) Radiation induced(1

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign 0.00
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.62
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.89
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign 0.00
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null 0.00
IGL02022:Lyst APN 13 13664044 nonsense probably null 0.00
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign 0.00
IGL02185:Lyst APN 13 13661093 nonsense probably null 0.00
IGL02215:Lyst APN 13 13660956 missense probably benign 0.00
IGL02245:Lyst APN 13 13660956 missense probably benign 0.00
IGL02246:Lyst APN 13 13660956 missense probably benign 0.00
IGL02247:Lyst APN 13 13660956 missense probably benign 0.00
IGL02297:Lyst APN 13 13638092 nonsense probably null 0.00
IGL02411:Lyst APN 13 13660956 missense probably benign 0.00
IGL02415:Lyst APN 13 13660956 missense probably benign 0.00
IGL02419:Lyst APN 13 13660956 missense probably benign 0.00
IGL02420:Lyst APN 13 13660956 missense probably benign 0.00
IGL02429:Lyst APN 13 13660956 missense probably benign 0.00
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign 0.00
IGL02601:Lyst APN 13 13660956 missense probably benign 0.00
IGL02603:Lyst APN 13 13660956 missense probably benign 0.00
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site 0.00
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.02
IGL02945:Lyst APN 13 13761198 missense probably benign 0.38
IGL02981:Lyst APN 13 13634911 missense possibly damaging 0.84
IGL03087:Lyst APN 13 13635056 missense unknown 0.00
IGL03149:Lyst APN 13 13681444 missense probably damaging 0.98
IGL03158:Lyst APN 13 13651752 splice site 0.00
IGL03226:Lyst APN 13 13709559 missense probably damaging 1.00
IGL03242:Lyst APN 13 13656881 nonsense probably null 0.00
IGL03385:Lyst APN 13 13656980 nonsense probably null 0.00
50-cal UTSW 13 13708212 critical splice donor site probably null
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 critical splice donor site
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice donor site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice donor site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice acceptor site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign 0.00
R0530:Lyst UTSW 13 13757306 splice acceptor site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign 0.00
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1709:Lyst UTSW 13 13707616 splice acceptor site probably benign
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign 0.00
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 unclassified probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 unclassified probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 unclassified probably null
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
X0026:Lyst UTSW 13 13683043 splice acceptor site probably benign
X0060:Lyst UTSW 13 13650317 splice acceptor site probably benign
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

none

Last Updated 05/24/2017 10:36 AM by Katherine Timer
Record Created unknown
Record Posted 01/09/2009
Phenotypic Description

Charlotte gray was discovered as a hypopigmented mutant in a screen of ENU-mutagenized G3 mice.  Charlotte gray was found to be allelic with souris, in which a mutation in the Lyst gene was identified (1;2). Charlotte gray mice display normal type I interferon (IFN) responses to CpG DNA challenge in vivo.

Nature of Mutation
The charlotte gray mutation was mapped to Chromosome 13, and corresponds to a T to G transversion at position 8521 of the Lyst transcript, in exon 33 of 53 total exons.
 
8504 GCCAAGTTGGTTTTGTATTTGTCAGAGTTGATA
2776   -A--K--L--V--L--Y--L--S--E--L--I-
 

Figure 1. Domain structure of the Lyst protein. The Lyst protein is a 3788-amino acid protein whose biochemical functions remain unknown. The N-terminal portion of the protein contains approximately twenty repeats with homology to ARM  and HEAT repeat motifs and a perilipin domain (PD). The C-terminal portion of Lyst contains a BEACH  domain and seven WD40 motifs. The charlotte gray mutation results in the substitution of a tyrosine to a premature stop codon at amino acid 2780. This image is interactive. Click on the image to view other mutations found in Lyst (red). Click on the mutations for more specific information. There are two additional alleles in the Lyst gene: sooty and grey wolf. The locations of their mutations is unknown.

The mutated nucleotide is indicated in red lettering, and creates a premature stop codon at codon 2780 (normally a tyrosine) deleting 1007 amino acids from the C-terminus of the protein (Figure 1).  This would delete two of the ARM/HEAT motifs, the BEACH domain and the WD40 motifs.  Expression of the mutated Lyst protein has not been tested.

 

Please see the record for souris for information about Lyst.

Primers Primers cannot be located by automatic search.
Genotyping
Charlotte gray genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  
 
Primers for PCR amplification
Cgray(F): 5’- ACCTAATACATTATTAAATTTCACCTACTGTATTGTCGTG -3’
Cgray(R): 5’- CTCAGATCTCCAAGGTTACTGCACAC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Cgray_seq(F): 5’- ACCTACTGTATTGTCGTGTCTTTTAC -3’
Cgray_seq(R): 5’- CCTTTCCTGATCAAAAACTCATTAGC -3’
 
The following sequence of 702 nucleotides (from Genbank genomic region NC_000079 for linear genomic sequence of Lyst) is amplified:
 
115881                       acctaataca ttattaaatt tcacctactg tattgtcgtg
115921 tcttttacag ttgtaataaa tcttacccaa ccaactaact ttagaaatat atttaaatta
115981 tcattaaata atttaaaatc aaaactacaa atataattaa atttattatt aaataattta
116041 aacagaagaa ataaaattct ttataactaa aaccttatta cttattttta aagcatggag
116101 ccaagttggt tttgtatttg tcagagttga tacataatca tcaggatgag ttaagtgaag
116161 aagaaatgga cacagcagaa ctgcttatga atgctctaaa gttatgtggc cacaagtgca
116221 tcccgcccag tgccccttcc aaaccagagc tcattaagat catcagagag gtgagtctac
116281 caatcagagt tgttttttag gaaatccttt tgagtacact taacacagtg actgaaagat
116341 tgttttacta ttgataatat cttgcaatta ttaatttttg ctaatgagtt tttgatcagg
116401 aaaggaaaaa tagagttatt tagggtaact ttctattctc tttggttttt gtcatccatt
116461 atctatagac ttcaatgaag gaaggattat tattgagatt tatttatctt atgtatatgt

116521 atatgttttg tctacatata agtctattta tcacatgtgt gcagtaacct tggagatctg

 
116581 ag
 
Primer binding sites are underlined; the mutated T is highlighted in red.
References
Science Writers Nora G. Smart
Illustrators Katherine Timer
AuthorsAmanda L. Blasius, Bruce Beutler
List |< first << previous [record 63 of 511] next >> last >|
Edit History
01/07/2011 8:57 AM (current)
11/12/2010 12:28 PM
07/22/2010 10:14 AM
02/03/2010 5:32 PM