Phenotypic Mutation 'punk2'

• Allele: punk2
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 72,144,217 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Slc13a5
• Gene Name: solute carrier family 13 (sodium-dependent citrate transporter), member 5
• Synonym(s): Nact, Indy, NaC2/NaCT, mINDY
• Chromosomal Location: 72,132,815-72,158,048 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014] ; PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000021161] [ENSMUSP00000119417] [ENSMUSP00000146922] [ENSMUSP00000146762]
• AlphaFold: Q67BT3
• SMART Domains: Protein: ENSMUSP00000021161; Gene: ENSMUSG00000020805; AA Change: T287I

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	8	558	1.3e-121	PFAM
Pfam:CitMHS	13	172	1.6e-14	PFAM
Pfam:CitMHS	202	498	6.4e-24	PFAM

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
  (Using ENSMUST00000021161)
• SMART Domains: Protein: ENSMUSP00000119417; Gene: ENSMUSG00000020805; AA Change: T287I

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	7	115	1.3e-24	PFAM

• Predicted Effect: unknown
• Predicted Effect: probably benign ; PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
  (Using ENSMUST00000208056)
• Predicted Effect: probably benign ; PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
  (Using ENSMUST00000208912)
• Meta Mutation Damage Score: 0.1795
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:35 PM by Anne Murray
• Record Created: 2018-06-08 6:46 AM by Bruce Beutler
• Record Posted: 2018-06-19
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Zhao Zhang, Emre Turer, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001004148; MGI:1919003

Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (other)(1)  Chemically induced (ENU)(1) Targeted(7)

Phenotypic Description

Figure 1. Punk2 mice exhibited r educed body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The punk2 phenotype was identified among G3 mice of the pedigree R5878, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 66 mutations (X-axis) identified in the G1 male of pedigree R5878. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. The body weight phenotype was linked to a mutation in Slc13a5: a C to T transition at base pair 72,253,391 (v38) on chromosome 11, or base pair 13,666 in the GenBank genomic region NC_000077. Linkage was found with a recessive model of inheritance (P = 6.753 x 10^-6), wherein five variant homozygotes departed phenotypically from 37 homozygous and 41 heterozygotes reference mice (Figure 2).

The mutation corresponds to residue 899 in the mRNA sequence NM_001004148 within exon 7 of 12 total exons.

883 CACAATTTAAAAAAAACTTGCATCTGCTGTGGG 282 -H--N--L--K--K--T--C--I--C--C--G-

The mutated nucleotide is indicated in red.  The mutation results in a threonine to isoleucine substitution at position 287 (T287I) in the NaCT protein, and is predicted by PolyPhen-2 to be damaging (score = 0.655).

Protein Prediction

Figure 3. Domain organization and topology of NaCT. NaCT has 11 putative transmembrane domains (SMART). The location of the punk2 mutation results in a threonine to isoleucine substitution at position 287. Other mutations found in NaCT are noted. Click on each mutation to view more information. The topology of mouse NaCT was modeled after that of the Vibrio cholerae homolog of mouse NaCT (termed VcINDY); see Figure 4, PDB:4F35, and (1) for more information.

Slc13a5 encodes NaCT (Na⁺/citrate transporter; alternatively, mINDY (mouse I’m not dead yet) or NaC2), a member of the solute carrier 13 (SLC13) family of anion transporters. The members of the SLC13 family are members of a superfamily of anion transporters called divalent anion sodium symporters (DASS), which mediate sodium-coupled anion cotransport at the plasma membrane of epithelial cells of the kidney, small intestine, placenta, and liver.

The structure of the bacterial homolog of NaCT from Vibrio cholerae (VcINDY) has been solved by X-ray crystallography (1). VcINDY has 11 transmembrane domains and two opposing hairpin structures: HP_in and HP_out. The HP_in structure inserts into the membrane from the cytosolic side and connects to TM4; the HP_out structure inserts into the protein from the periplasm connecting to TM9. The N-terminus is in the cytosol, while the C-terminus is in the extracellular space (2). TM4, TM5, TM9, and TM10 of VcINDY are each broken into two segments within the membrane; each pair are named “a” and “b”. The loops that connect TM5a and TM5b as well as the loop that connects TM10a and TM10b are eight amino acids long. 

The Punk mutation results in a threonine to isoleucine substitution at position 287 (T287I); Thr287 is within the lumenal loop between transmembranes six and seven.

Please see the record Punk for more information about Slc13a5.

Putative Mechanism

NaCT is a member of the Na⁺-carboxylate (NaC; alternatively, Na⁺-dicarboxylate [NaDC]) cotransporter subfamily of the SLC13 family, which mediate the transportation of Krebs cycle intermediates including succinate citrate, succinate, and α-ketoglutarate. NaCT exhibits highest affinity for citrate (3;4). NaCT has lower affinities to other Krebs cycle intermediates including succinate, malate, and formate (3;5;6). NaCT mediates inward electrgenic sodium-coupled substrate cotransport with a sodium:substrate coupling ratio of 4:1 (3;5;7).

Mutations in SLC13A5 are linked to early-onset epileptic encephalopathy-25 (EOEE25; OMIM: #615905) (8;9). EOEE is a genetically heterogenous group of disorders. EOEE25 is an autosomal recessive condition marked by frequent tonic seizures or spasms starting in infancy. EOEE25 patients exhibit abnormal interictal (between seizures) electro-encephalogram, psychomotor delay, and/or cognitive deterioration. Approximately 75% of EOEE patients progress to West syndrome, which is a condition characterized by tonic spasms with clustering, arrest of psychomotor development, and hypsarrhythmia. The disease-causing SLC13A5 mutations in patients with EOEE25 are proposed to affect the ability of NaCT to transport citrate across the plasma membrane to the cytosol by preventing its ability to bind sodium (8).

Slc13a5-deficient (Slc13a5^-/-) mice exhibit metabolic defects and changes in energy balance-regulating pathways. The Slc13a5^-/- mice were smaller in size, have lower plasma glucose levels than wild-type mice, and are resistant to the effects (i.e., weight gain and insulin resistance) of high fat feeding (10). Citrate and malate levels in the plasma of Slc13a5^-/- mice are slightly increased compared to that in wild-type mice; the levels of succinate or fumarate were not significantly changed upon loss of Slc13a5. The Slc13a5^-/- mice exhibited reduced uptake of citrate from the circulation into the liver, but not the kidney or adipose tissue (10). The Slc13a5^-/- mice also exhibited increased oxygen consumption, carbon dioxide generation, and resting energy expenditure. After a glucose tolerance test, plasma glucose and insulin concentrations were reduced in the Slc13a5^-/- mice. The Slc13a5^-/- mice had improved insulin sensitivity after hyperinsulinemic euglycemic clamp with reduced basal hepatic glucose production. The resistance to diet-induced obesity and insulin resistance is mediated by the function of NaCT on mitochondrial metabolism as the hepatocellular ATP/ADP ratio was reduced and induction of PGC-1α, inhibition of ACC-2, and reduction of SREBP-1c levels were observed (10).

NaCT-mediated uptake of circulating citrate mediates the generation of metabolic energy as well as the synthesis of fatty acids and cholesterol (5;6). Citrate generated in the mitochondria by the tricarboxylic acid (TCA) cycle enters the cytoplasm when intracellular energy stores are abundant. Cytoplasmic citrate is subsequently converted to acetyl-CoA. Conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase is the first step in fatty acid synthesis. Similar to the Slc13a5^-/- mice, the punk2 mice are smaller in size compared to their wild-type littermates, indicating that NaCT^punk2 has lost citrate uptake function.

Primers

PCR Primer
punk2_pcr_F: TACACGGTGTTTCCCTCGAC
punk2_pcr_R: CCAGTTTGAGATGGTGGCAC

Sequencing Primer
punk2_seq_F: TCGACCCAGGCGAATGACAG
punk2_seq_R: AGCTCTGGAAGTGCCCTAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 488 nucleotides is amplified (chromosome 11, - strand):

1   ccagtttgag atggtggcac accccttttg tatcacctca ccccctgccc ccagctctgg
61  aagtgcccta ggccctcagt ctctacttct caacagtctc tctgtaaggt gatgtggggg
121 tggggtggag agaggagctg atggaaatca gaagaagaaa gagggagggt gggaccctca
181 ggctctatcc cagaagcccc ccacccccac ttctcccaca agtcgttcca tctgccttgc
241 ccttctctta ccattacatg gtctagttta aaaaaaactt gcatctgctg tggggagaag
301 aagagggaca ccgagaagat tgcctacaaa gtgctgaacg aggagtacca gaagctgggg
361 tccttgagct accctgaatg caacgtgctc ttttgcttca ccctacttgt catcctgtgg
421 ttctcccgag accccggctt catgcctggc tggctgtcat tcgcctgggt cgagggaaac
481 accgtgta

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Mancusso, R., Gregorio, G. G., Liu, Q., and Wang, D. N. (2012) Structure and Mechanism of a Bacterial Sodium-Dependent Dicarboxylate Transporter. Nature. 491, 622-626.

  2. Zhang, F. F., and Pajor, A. M. (2001) Topology of the Na(+)/dicarboxylate Cotransporter: The N-Terminus and Hydrophilic Loop 4 are Located Intracellularly. Biochim Biophys Acta. 1511, 80-89.

  3. Inoue, K., Fei, Y. J., Zhuang, L., Gopal, E., Miyauchi, S., and Ganapathy, V. (2004) Functional Features and Genomic Organization of Mouse NaCT, a Sodium-Coupled Transporter for Tricarboxylic Acid Cycle Intermediates. Biochem J. 378, 949-957.

  4. Knauf, F., Mohebbi, N., Teichert, C., Herold, D., Rogina, B., Helfand, S., Gollasch, M., Luft, F. C., and Aronson, P. S. (2006) The Life-Extending Gene Indy Encodes an Exchanger for Krebs-Cycle Intermediates. Biochem J. 397, 25-29.

  5. Inoue, K., Zhuang, L., and Ganapathy, V. (2002) Human Na+ -Coupled Citrate Transporter: Primary Structure, Genomic Organization, and Transport Function. Biochem Biophys Res Commun. 299, 465-471.

  6. Inoue, K., Zhuang, L., Maddox, D. M., Smith, S. B., and Ganapathy, V. (2002) Structure, Function, and Expression Pattern of a Novel Sodium-Coupled Citrate Transporter (NaCT) Cloned from Mammalian Brain. J Biol Chem. 277, 39469-39476.

  7. Inoue, K., Zhuang, L., Maddox, D. M., Smith, S. B., and Ganapathy, V. (2003) Human Sodium-Coupled Citrate Transporter, the Orthologue of Drosophila Indy, as a Novel Target for Lithium Action. Biochem J. 374, 21-26.

  8. Thevenon, J., Milh, M., Feillet, F., St-Onge, J., Duffourd, Y., Juge, C., Roubertie, A., Heron, D., Mignot, C., Raffo, E., Isidor, B., Wahlen, S., Sanlaville, D., Villeneuve, N., Darmency-Stamboul, V., Toutain, A., Lefebvre, M., Chouchane, M., Huet, F., Lafon, A., de Saint Martin, A., Lesca, G., El Chehadeh, S., Thauvin-Robinet, C., Masurel-Paulet, A., Odent, S., Villard, L., Philippe, C., Faivre, L., and Riviere, J. B. (2014) Mutations in SLC13A5 Cause Autosomal-Recessive Epileptic Encephalopathy with Seizure Onset in the First Days of Life. Am J Hum Genet. 95, 113-120.

  9. Hardies, K., de Kovel, C. G., Weckhuysen, S., Asselbergh, B., Geuens, T., Deconinck, T., Azmi, A., May, P., Brilstra, E., Becker, F., Barisic, N., Craiu, D., Braun, K. P., Lal, D., Thiele, H., Schubert, J., Weber, Y., van 't Slot, R., Nurnberg, P., Balling, R., Timmerman, V., Lerche, H., Maudsley, S., Helbig, I., Suls, A., Koeleman, B. P., De Jonghe, P., and autosomal recessive working group of the EuroEPINOMICS RES Consortium. (2015) Recessive Mutations in SLC13A5 Result in a Loss of Citrate Transport and Cause Neonatal Epilepsy, Developmental Delay and Teeth Hypoplasia. Brain. 138, 3238-3250.

  10. Birkenfeld, A. L., Lee, H. Y., Guebre-Egziabher, F., Alves, T. C., Jurczak, M. J., Jornayvaz, F. R., Zhang, D., Hsiao, J. J., Martin-Montalvo, A., Fischer-Rosinsky, A., Spranger, J., Pfeiffer, A. F., Jordan, J., Fromm, M. F., Konig, J., Lieske, S., Carmean, C. M., Frederick, D. W., Weismann, D., Knauf, F., Irusta, P. M., De Cabo, R., Helfand, S. L., Samuel, V. T., and Shulman, G. I. (2011) Deletion of the Mammalian INDY Homolog Mimics Aspects of Dietary Restriction and Protects Against Adiposity and Insulin Resistance in Mice. Cell Metab. 14, 184-195.