Phenotypic Mutation 'Cherub' (pdf version)
List |< first << previous [record 67 of 511] next >> last >|
AlleleCherub
Mutation Type nonsense
Chromosome4
Coordinate101,768,063 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Lepr
Gene Name leptin receptor
Synonym(s) obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
Chromosomal Location 101,717,404-101,815,352 bp (+)
MGI Phenotype Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting.
Accession Number

NCBI RefSeq: NM_146146, NM_010704; MGI: 104993

Mapped Yes 
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
C471* in Ensembl: ENSMUSP00000037385 (fasta)
C471* in Ensembl: ENSMUSP00000099838 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 1.5e-23 PFAM
Blast:IG_like 429 498 N/A BLAST
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Phenotypic Category adipose tissue, behavior/neurological, growth/size, homeostasis/metabolism, reproductive system
Penetrance 100% 
Alleles Listed at MGI
All alleles(36) : Targeted, knock-out(3) Targeted, other(12) Transgenic(1) Spontaneous(13) Chemically induced(7)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign 0.00
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.45
IGL01324:Lepr APN 4 101768068 missense probably damaging 1.00
IGL01372:Lepr APN 4 101735577 missense probably benign 0.29
IGL01626:Lepr APN 4 101733534 missense possibly damaging 0.72
IGL01733:Lepr APN 4 101765082 missense probably benign 0.03
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.84
IGL01899:Lepr APN 4 101779987 missense probably benign 0.03
IGL02138:Lepr APN 4 101768067 missense probably damaging 1.00
IGL02161:Lepr APN 4 101745678 missense probably benign 0.01
IGL02653:Lepr APN 4 101764944 missense probably benign 0.22
IGL02735:Lepr APN 4 101782638 missense probably damaging 0.96
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null 0.00
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
Business_class UTSW 4 101764872 nonsense
giant UTSW 4 101765152 critical splice donor site probably null
odd UTSW 4 101728075 splice donor site
paleo UTSW 4 101745645 missense possibly damaging 0.94
Well-upholstered UTSW 4 101772959 nonsense
R0140:Lepr UTSW 4 101768067 missense probably damaging 0.98
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice donor site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1778:Lepr UTSW 4 101773010 splice donor site probably benign
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice donor site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 unclassified probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4234:Lepr UTSW 4 101790886 missense noncoding transcript
R4343:Lepr UTSW 4 101765152 unclassified probably null
R4345:Lepr UTSW 4 101765152 unclassified probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4935:Lepr UTSW 4 101792055 missense noncoding transcript
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 missense noncoding transcript
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
Repository

none

Last Updated 09/16/2016 9:17 AM by Katherine Timer
Record Created unknown
Record Posted 04/22/2008
Phenotypic Description

The cherub mutation was identified in ENU-mutagenized G3 mice, and is characterized by massive obesity and infertility in homozygous animals (Figure 1).  The mutation mapped to Chromosome 4, and a mutation in the leptin receptor (Lepr) gene was found.  Cherub mutants have similar phenotypes to allelic Business class and Well-upholstered mutants.

Nature of Mutation
The cherub mutation was mapped to Chromosome 4 and corresponds to a T to A transversion at position 1413 (record for variant 1; NM_146146) of the Lepr transcript, in exon 9 of 18 total exons.
 
1396 AGGCGCAGCCTGTATTGTCCTGATAGTCCATCT
466  -R--R--S--L--Y--C--P--D--S--P--S-
 
The mutated nucleotide is indicated in red lettering and results in the conversion of cysteine 471 to a stop codon. This removes the C-terminal 691 amino acids of the leptin receptor (LEPR) protein.
Protein Prediction
Figure 2. Domain of OB-Rb and structure of mouse leptin receptor isoforms. OB-Rb contains the longest intracellular domain, which is crucial for leptin signaling. OB-Ra, OB-Rc and OB-Rd have varying short cytoplasmic domains. All isoforms contain the Box 1 motif known to bind JAK kinases. OB-Re is a secreted isoform of the leptin receptor. Cytokine receptor homology module (CRH)2 is the main binding site for leptin. The immunoglobin-like (IG-like) and fibronectin type III (FNIII) domains are involved in OB-R activation. The role of CRH1 remains to be determined. Both CRH domains also contain a FNIII fold (see text). The Cherub mutation causes a conversion of cysteine 471 to a stop codon. This image is interactive. Click on the image to view other mutations found in the Lepr gene (red). Click on the mutations for more specific information. 
The cherub mutation results in protein truncation of the leptin receptor at amino acid 471. This deletes more than half of the protein including the C-terminal intracellular signaling domain, the membrane spanning region, and a significant portion of the extracellular region including a portion of the ligand-binding region (Figure 2).  It is unlikely that this truncated protein would have any function.
 
Please see the record for Business class for more information on Lepr.
Primers Primers cannot be located by automatic search.
Genotyping
Cherub genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Cherub(F): 5’-GACCGACAACTCCTGACATGGAAG-3’
Cherub(R): 5’-GTGCTCTACAGAAATACCCAGTGGC-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Cherub_seq(F): same as Cherub(F)
Cherub_seq(R): 5’- ACCCAGTGGCTATGAATCTATTACC-3’
 
The following sequence of 1051 nucleotides (from Genbank genomic region NC_000070 for linear DNA sequence of Lepr) is amplified:
 
49998                   gac cgacaactcc tgacatggaa ggaaagcagg tttttgtttg
50041 tttgtttctt ttgtttttgc tttaaaccgt gtcttaaatt ccaacagaaa tggagaatgt
50101 aacaggcagt aatatttggc ttgactggca gggcttgaat actttctagt ccaaactgat
50161 ataatgaaaa caataccaaa tcctgatcct tacatgaatg cagttatggg ggtgggggtg
50221 gggtgagggt ggggggctca gcacagcatg aggagctgtg ttagggtcgc agcaatagga
50281 aggctgagaa ccttgttcta gggtaaccac cacagtcctg ctgctctgtg cctaacttac
50341 cttcttgcca gctcctcaca ccctcacacc catccttcac cagtcaccct ccacacagtg
50401 tttttatagt cactgtttgt ggaaagacta aaatccagct agagctcgga gctcaagaag
50461 gcctttctaa caacagcatc agtttttaga cagagaaaat gatctctgtc aaacaataaa
50521 tctgaattct agatgtcttt ttttttttaa atcaatacta catattaact ggctactttt
50581 aaaaaaatgt atatatatat cttttaaggc gcagcctgta ttgtcctgat agtccatcta
50641 ttcatcctac gtctgagccc aaaaactgcg tcttacagag agacggcttt tatgaatgtg
50701 ttttccagcc aatctttcta ttatctggct atacaatgtg gatcaggatc aaccattctt
50761 taggttcact tgactcgcca ccaacgtgtg tccttcctga ctccgtaggt acgtcagact
50821 atattatgta ttttccttat atacggctgt cattttctaa ttgcactata ttttgaagaa
50881 aaaaattgtt tctgtttata gagtaattga gaagatgatt ggctgtagaa gctttctagt
50941 tttgagattt ttattaccat tttgaattag ttttgatatt agtggtagca tgtttgttta
51001 taaatatagg taatagattc atagccactg ggtatttctg tagagcac
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsNengming Xiao, Bruce Beutler
List |< first << previous [record 67 of 511] next >> last >|
Edit History
07/06/2011 3:39 PM (current)
01/07/2011 8:57 AM
12/08/2010 3:38 PM
08/26/2010 2:06 PM
08/26/2010 2:06 PM
08/26/2010 2:06 PM
02/03/2010 5:31 PM