Phenotypic Mutation 'hallasan' (pdf version)
List |< first << previous [record 2 of 30] next >> last >|
Allelehallasan
Mutation Type critical splice acceptor site
Chromosome11
Coordinate106,312,441 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Cd79b
Gene Name CD79B antigen
Synonym(s) Igbeta, Ig-beta, Igb, B29
Chromosomal Location 106,311,341-106,314,762 bp (-)
MGI Phenotype FUNCTION: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008339, NM_001313939; MGI:96431

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000048239] [ENSMUSP00000129029]
SMART Domains Protein: ENSMUSP00000048239
Gene: ENSMUSG00000040592

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
IG 110 202 3.56e-9 SMART
transmembrane domain 220 239 N/A INTRINSIC
ITAM 252 272 2.41e-4 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000129029
Gene: ENSMUSG00000040592

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
IG 50 142 3.56e-9 SMART
transmembrane domain 160 179 N/A INTRINSIC
ITAM 192 212 2.41e-4 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
FACS B:T cells - decreased
FACS B1 cells - decreased
FACS B220 MFI - decreased
FACS CD4+ T cells - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD8+ T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - decreased
FACS NK cells - decreased
FACS T cells - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(16) : Gene trapped(2) Spontaneous(1) Targeted(10) Transgenic(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0731:Cd79b UTSW 11 106312433 missense probably damaging 1.00
R4400:Cd79b UTSW 11 106312010 nonsense probably null
R4591:Cd79b UTSW 11 106312046 missense probably damaging 1.00
R4948:Cd79b UTSW 11 106312861 missense probably benign 0.01
R6214:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R6215:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R6605:Cd79b UTSW 11 106312713 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2018-10-25 4:43 PM by Diantha La Vine
Record Created 2018-06-27 8:53 PM by Xue Zhong
Record Posted 2018-10-25
Phenotypic Description
Figure 1. Hallasan mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Hallasan mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Hallasan mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Hallasan mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Hallasan mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Hallasan mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Hallasan mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Hallasan mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Hallasan mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Hallasan mice exhibit reduced frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Hallasan mice exhibit reduced B220 expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hallasan phenotype was identified among G3 mice of the pedigree R6215, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2) and B1 cells (Figure 3) with concomitant increased frequencies of T cells (Figure 4), CD4+ T cells (Figure 5), CD8+ T cells (Figure 6), CD44+ T cells (Figure 7), CD44+ CD4 T cells (Figure 8), and CD44+ CD8 T cells (Figure 9), all in the peripheral blood. The frequency of peripheral blood NK cells was also reduced (Figure 10). Expression of B220 on peripheral blood B cells was reduced (Figure 11).

Nature of Mutation

Figure 12. Linkage mapping of the increased T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 45 mutations (X-axis) identified in the G1 male of pedigree R6215. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 45 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd79b:  a G to T transversion at base pair 106,312,441 (v38) on chromosome 11, or base pair 2,122 in the GenBank genomic region NC_000077 within the splice acceptor site of intron 3. The strongest association was found with a recessive model of inheritance to the normalized T cell frequency, wherein seven variant homozygotes departed phenotypically from 24 homozygous reference mice and 28 heterozygous mice with a P value of 5.7 x 10-35 (Figure 12).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic splice site in exon 4. The resulting transcript would have a 7-base pair deletion of exon 4, which would cause a frame-shifted protein product beginning after amino acid 142 of the protein, which is normally 228 amino acids in length, and termination after the inclusion of five aberrant amino acids.

 

             <--exon 3          <--intron 3 exon 4-->
490 ……GAACTTCTAGTCTTAG ……tctcccctgctcccccag GATTCAGCACGTTGGACCAACTGA……

138 ……-E--L--L--V--L--                      -------A--R--W--T--N--*-

          correct                                   aberrant

 

The acceptor splice site of intron 3, which is destroyed by the hallasan mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction
Figure 3. Domain structure of Igβ. The hallasan mutation destroys the acceptor site of intron 3. Abbreviations: SP, signal peptide; TM, transmembrane domain; ITAM, immunoreceptor tyrosine-based activation motif. See the text for more details.
Figure 4. Crystal structure of murine Igβ. Cysteine residues (C65 and C120) that form an intrachain disulfide bond are indicated in pink. C135 is in an unsolved portion of the protein. UCSF Chimera model is based on PDB 3KHQ, Radaev et al. Structure. 18, 934-943 (2010). Click on the 3D structure to view it rotate.

B cell antigen receptors (BCR) consist of two functional components [reviewed in (1)]. The antigen binding component is a membrane bound form of immunoglobulin (mIg), which consists of two transmembrane spanning heavy (H) chains and two associated light (L) chains. A heterodimer of Igα (see the record for crab) and Igβ constitutes the signaling component of the BCR (2-4). Because the cytoplasmic portion of mIg H chains is very short (three amino acids for IgM and IgD), BCR signaling depends on the interactions of the cytoplasmic domains of Igα and Igβ with downstream signaling molecules. The Igα/Igβ heterodimer associates noncovalently with all mIg isotypes (IgM, IgD, IgG, IgA, and IgE) (5), and is found in each BCR complex in a 1:1 stoichiometry with mIg (6).

 

Igα and Igβ are type I transmembrane glycoproteins of approximately 34 kD and 40 kD in mice, respectively (Figure 3). Igβ consists of 228 and 229 amino acids in mice and humans, respectively, and are 68% identical. The level of glycosylation of Igα and Igβ has been observed to vary between B cells of different lymphoid organs, resulting in molecular weight variations (7).

 

The cytoplasmic tails of Igα and Igβ are 61 and 48 amino acids in length, respectively, and each contains a single immunoreceptor tyrosine-based activation motif (ITAM) (8), a conserved domain containing two tyrosines that upon phosphorylation act as a binding site for SH2 domain-containing effectors (D/ExxxxxxxD/ExxYxxL/IxxxxxxxYxxL/I). BCR activation results in the phosphorylation of ITAM tyrosines in both Igα and Igβ by membrane-localized Src family kinases, which are subsequently recruited to the receptor through binding of the phosphorylated ITAMs to Src SH2 domains, thereby amplifying signaling (9). ITAM phosphorylation occurs largely on the membrane-proximal tyrosine (10), but doubly phosphorylated ITAMs also occur and serve as a binding site for the tandem SH2 domains of Syk, which initiates several signaling pathways (11;12) (see Background).

 

One side of the helical transmembrane segment of mIgs is highly conserved between isotypes and interacts closely with the transmembrane segment of the Igα/Igβ heterodimer, although it remains unknown whether contact between mIg and Igα/Igβ is through Igα or Igβ. Igα contains a negatively charged amino acid (glutamic acid) at the fifth position of the transmembrane segment that was hypothesized to interact directly with positively charged transmembrane residues in mIg (1;2). However, mIgM contains several polar but no charged amino acids in its transmembrane domain, and mutation of the central YS to VV abolished association with the Igα/Igβ heterodimer (13). More recent studies using fluorescence resonance energy transfer (FRET) indicated that the cytoplasmic domain of Igβ lies physically closer to mIg than Igα (14). Since Igβ contains a polar amino acid (glutamine) in its transmembrane region, polar interactions may mediate association between mIg and Igβ.

 

Based on its amino acid sequence, the extracellular N-terminus of Igβ would form a V-type Ig fold  (15). The extracellular domains of Igα and Igβ each contain features that are highly conserved in Ig superfamily proteins, including two cysteine residues that form an intrachain disulfide bond (Cys50 and Cys101 in Igα; Cys65 and Cys120 in Igβ), as well as several other conserved residues (16;17). The predicted Ig fold of Igβ was confirmed by X-ray crystallographic analysis, which demonstrated an I-type rather than a V-type fold [Figure 4; PDB: 3KHQ] (24). Igα and Igβ each contain an additional extracellular cysteine residue (Cys113 and Cys135, respectively); these form an interchain disulfide bond that mediates heterodimerization of the proteins (18;19). The function of the extracellular domains of Igα/Igβ in BCR signaling is not well understood. They contribute to interactions with mIg (3;18;20), and may be required for transport of mIgM to the cell surface (21).

Expression/Localization

Expression of Igβ mRNA and protein is restricted to cells of the B lineage, including B lineage progenitors, pre-B, and mature B cells (4;16). Both resting and activated B cells express Igβ.

Background
Figure 5. BCR Signaling. In resting B cells (inset), BCRs are dispersed as monomers with one Igα/β heterodimer in a “closed” position. Upon stimulation, receptors translocate into lipid rafts and aggregate to form caps. The tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn), causing them to take an open conformation and serve as docking sites for the adapter protein BLNK and the SH2 domains of SYK. SYK phosphorylates a number of downstream targets including BLNK, PLC-γ2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-γ2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-4,5-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca2+) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

B cells induce numerous responses to microbial infections, including antigen internalization, proliferation, T cell-independent antibody production, and the T cell-dependent antibody response. These responses are initiated upon antigen binding by the BCR, which rapidly recruits a signaling complex through interactions with Src family kinases (SFK) and the tyrosine kinase Syk (Figure 5). These kinases recruit and activate other molecules, notably BLNK (see busy) and Pik3ap1 (also called BCAP) (see Sothe) followed by PI-3K and Btk, that lead to activation of PLC-γ2 (see queen), which hydrolyzes phosphatidylinositol-4,5-bisphosphate (PIP2) to diacylglycerol (DAG) and inositol-1,4,5-triphosphate (IP3). Ultimately, through activation of IP3 receptors on the endoplasmic reticulum, IP3 triggers a large influx of Ca2+ to the cytoplasm. Sustained elevation of cytosolic Ca2+ regulates the activity of transcription factors including NF-AT and NF-κB (see xander and panr2). BCR engagement also activates pathways regulated by PKCβ (see Untied), PI-3K, and Ras/MAPK, which further modulate B cell responses [see (22;23) for reviews of B cell antigen receptor signaling]. Signal transduction following antigen binding to the BCR absolutely requires Igα and Igβ. Below, the functions of Igα and Ig β in proximal BCR signaling are described.

 

BCR engagement triggers receptor translocation into lipid rafts (24;25), and aggregation into microclusters that move together along actin filaments to form a central synapse at one pole of the cell, termed ‘capping’ (26). Following these events, the ITAMs located on the cytoplasmic tails of Igα and Igβ become phosphorylated by SFKs, which are enriched in lipid rafts as a result of their myristoylation and/or palmitoylation. Four SFKs (Lyn [see the record for Lemon], Fyn, Blk, Lck [see the record for iconoclast]) are the earliest activated kinases upon BCR ligation [(27); reviewed in (28)]. Lyn and Fyn, but not Src, were shown to interact directly with the resting BCR through binding to Igα (29;30). Lyn is believed to be primarily responsible for phosphorylating the ITAMs of Igα/Igβ (28;31)

 

Once phosphorylated on both tyrosines, the Igα/Igβ ITAMs serve as docking sites for the adapter protein BLNK (32) and the two SH2 domains of Syk (see the record for poppy), which is then activated by SFK-dependent trans-phosphorylation (33-36). Syk-deficient B cells are deficient in downstream BCR signaling responses, but display normal SFK activation and Igα/Igβ phosphorylation, indicating that Syk is essential for transmitting signals from the BCR to distal signaling molecules (37). Syk phosphorylates a number of targets including BLNK, PLC-γ2, and PKCβ. BLNK serves as a scaffold to bring together several important signaling molecules (38;39). In particular, phosphorylated BLNK provides docking sites for the tyrosine kinase Btk as well as PLC-γ2, resulting in phosphorylation and activation of PLC-γ2 by Btk (40;41).

 

In addition to phosphorylation of tyrosines within the Igα and Igβ ITAMs, BCR aggregation also results in phosphorylation of a non-ITAM tyrosine at the tip of the Igα cytoplasmic domain (Y204) (32;42). This non-ITAM phosphotyrosine binds to the C-terminal SH2 domain of BLNK (32;43), and has been proposed to recruit BLNK to the BCR where it can be phosphorylated by ITAM-bound Syk (44). Both Igα ITAM tyrosines and Y204 are necessary for chicken B cell development in the absence of Igβ (45). In mice, Igα Y204 is required for T cell-independent B cell activation, proliferation, and antibody production, but not BCR capping, antigen internalization, antigen presentation, or T cell-dependent antibody production (46) B cells from Cd79aY204F/Y204F mice exhibited normal levels of BCR-induced Syk phosphorylation, but reduced BLNK phosphorylation, calcium flux, and NF-κB, JNK, and ERK activation. These findings suggest that phosphorylation of Igα Y204 promotes T cell-independent B cell responses in a manner dependent on BLNK phosphorylation. Several other non-ITAM tyrosines in the cytoplasmic tail of Igα, which are not phosphorylated, mediate BCR internalization in a manner independent of BCR signaling (47;48).

 

BCR signaling is essential for progression through the early stages of B cell development. Signaling-competent Igα and Igβ have been detected in a complex with the ER chaperone calnexin on the surface of mouse progenitor B (pro-B) cells, which do not yet express the Ig heavy chain (49;50). In this context, Igα and Igβ were proposed to promote V(D)J recombination (see maladaptive). However, pro-B cells from Igα- and Igβ-deficient mice initiated and completed V(D)J recombination as well wild type cells (51). Despite normal V(D)J recombination, these cells failed to express the pre-BCR (a complex composed of the recombined mIgM heavy chain, the surrogate light chains λ5 and VpreB, and the Igα/Igβ heterodimer) on the cell surface, and B cell development was blocked at the pro-B cell stage (51;52). Similarly, mutations of Igβ in humans cause agammaglobulinemia-6  leading to recurrent infections (OMIM: #612692). Pro-B cells in mice expressing chimeric receptors with the extracellular domain of mIgM and the cytoplasmic domain of either Igβ or Igα on a Rag1-/- background transitioned to the pre-B cell stage and generated immature B cells (53;54). In addition, targeting the cytoplasmic domains of the Igα/Igβ heterodimer to the cell surface in the absence of any other BCR extracellular domains in pro-B cells lacking μ heavy chain expression was sufficient to generate immature B cells (55). Thus, basal signals generated by membrane-localized Igα/Igβ cytoplasmic domains are necessary and sufficient to support B cell differentiation.

 

In mature B cells, signaling through Igα/Igβ is required for cell survival. Cre-mediated deletion of the Igα locus in mature B cells resulted in apoptosis within a period of two weeks (56), a situation that also results from Ig heavy chain inactivation in mature B cells (57). Interestingly, when the BCR was altered to express two Igα cytoplasmic domains, mutant B cells developed to maturity but were anergic to T-independent and T-dependent antigens in vivo (58).

 

The distinct phenotypes of mice expressing either cytoplasmically truncated Igα or Igβ demonstrated that although Igα and Igβ are covalently linked and function together to transmit BCR signals, they are not equivalent in their signaling roles. In mice expressing Igβ truncated after the third amino acid of the cytoplasmic domain, B cell development proceeds up through the immature B stage (59). In contrast, B cell progression is impaired before the pre-B stage (50% reduction of pre-B cells) and severely impaired beyond it (80% reduction of immature B cells) in mice with a deletion of 40 of the 61 amino acids of the Igα cytoplasmic domain (60).

 

As further support that Igα and Igβ mediate different signals, several BCR signaling proteins were found to associate differentially with either Igα or Igβ. In particular, the cytoplasmic tail of Igα preferentially or exclusively bound to the tyrosine kinases Lyn, Fyn, and Syk over Igβ (61;62). Igα also bound preferentially to PI-3K and to p52Shc, an adapter that couples BCR signaling to Ras activation. Consistent with these data, tyrosine kinase activity was strongly activated in B cells expressing a fusion protein containing the CD8α extracellular domain and the Igα cytoplasmic domain, but not the Igβ cytoplasmic domain (63). Similar data were obtained with a fusion of Igα to a mutant form of mIgM defective for association with either Igα or Igβ (64). Distinct patterns of calcium signaling have also been observed in response to signaling from Igα or Igβ (65).

Putative Mechanism

The phenotype of hallasan mice is consistent with a loss of function of Igβ.

Primers PCR Primer
hallasan(F):5'- CTCAGAATATGGAGACCCTGCC -3'
hallasan(R):5'- GTGCAAGGTAGATTGTGTAGCC -3'

Sequencing Primer
hallasan_seq(F):5'- GAATATGGAGACCCTGCCCATGTC -3'
hallasan_seq(R):5'- GGTAGATTGTGTAGCCATCCACAC -3'
References
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, Bruce Beutler
List |< first << previous [record 2 of 30] next >> last >|