Phenotypic Mutation 'grasshopper' (pdf version)
Allelegrasshopper
Mutation Type missense
Chromosome19
Coordinate19,110,557 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Rorb
Gene Name RAR-related orphan receptor beta
Synonym(s) Nr1f2, Rorbeta, RZR-beta
Chromosomal Location 18,930,605-19,111,196 bp (-)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001043354.1 (isoform 1), NM_146095.3 (isoform 2); MGI: 1343464

Mapped Yes 
Limits of the Critical Region 1 - 38985058 bp
Amino Acid Change Methionine changed to Threonine
Institutional SourceBeutler Lab
Ref Sequences
M1T in Ensembl: ENSMUSP00000108451 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
ZnF_C4 7 78 1.51e-39 SMART
coiled coil region 84 122 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HOLI 264 420 1.83e-29 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
(Using Ensembl: ENSMUSP00000108451)
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological
Penetrance 100% 
Alleles Listed at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(1) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rorb APN 19 18957328 nonsense probably null
IGL01576:Rorb APN 19 18957334 missense probably damaging 1.00
IGL02863:Rorb APN 19 18952253 missense probably benign 0.05
IGL02886:Rorb APN 19 18977579 critical splice donor site probably null
4-limb_clasper UTSW 19 18983351 missense probably damaging 1.00
dee-no UTSW 19 18955053 missense probably damaging 1.00
IGL02988:Rorb UTSW 19 18937972 missense probably damaging 1.00
R0748:Rorb UTSW 19 18977800 missense probably damaging 0.97
R1087:Rorb UTSW 19 18960414 missense probably damaging 1.00
R1438:Rorb UTSW 19 18955053 missense probably damaging 1.00
R1710:Rorb UTSW 19 18960501 missense probably damaging 1.00
R1846:Rorb UTSW 19 18955081 missense probably damaging 1.00
R1852:Rorb UTSW 19 18962083 missense probably damaging 1.00
R1972:Rorb UTSW 19 18952203 missense probably damaging 0.96
R3903:Rorb UTSW 19 18962099 missense probably damaging 0.99
R3978:Rorb UTSW 19 18937890 missense probably benign 0.00
R4497:Rorb UTSW 19 18977628 missense possibly damaging 0.95
R4982:Rorb UTSW 19 18977688 missense probably benign 0.05
R5602:Rorb UTSW 19 18977937 missense probably damaging 0.97
R5733:Rorb UTSW 19 18988107 missense probably damaging 1.00
R6267:Rorb UTSW 19 18977857 missense possibly damaging 0.88
R6455:Rorb UTSW 19 18960492 missense probably damaging 1.00
R6544:Rorb UTSW 19 18952250 missense possibly damaging 0.66
R6753:Rorb UTSW 19 18957247 missense probably benign 0.02
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

none

Last Updated 2018-05-22 9:32 AM by Anne Murray
Record Created unknown
Record Posted 2010-03-18
Other Mutations in This Stock Stock #: D3080 Run Code:
Validation Efficiency: 141/173

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
2310003L06Rik C to A 5: 87,971,987 P201Q possibly damaging Het
Bdp1 A to T 13: 100,023,621 S2417R probably benign Het
Dscaml1 A to T 9: 45,684,325 H783L probably benign Het
Fbxl5 A to T 5: 43,758,366 M568K probably benign Het
Gab1 T to A 8: 80,766,378 D710V probably damaging Homo
Gabrr2 T to C 4: 33,084,466 F128S probably damaging Het
Gm8251 C to A 1: 44,067,335 Het
Hyou1 T to A 9: 44,384,477 V343E probably damaging Het
Nlrp4a A to G 7: 26,444,341 T44A probably benign Het
Nsd3 C to A 8: 25,713,545 T1362N possibly damaging Homo
Olfr523 G to A 7: 140,176,362 V81M possibly damaging Het
Pcm1 T to A 8: 41,275,939 N649K probably damaging Homo
Pde4dip T to C 3: 97,766,830 K257E probably damaging Het
Pfpl G to A 19: 12,428,832 R149Q probably damaging Homo
Pou2f2 G to T 7: 25,097,133 probably benign Het
Rptn A to G 3: 93,395,828 D156G possibly damaging Het
Sec31a T to C 5: 100,363,832 D1107G probably damaging Het
Smyd3 A to G 1: 179,086,422 Y239H probably damaging Het
Stoml3 T to C 3: 53,497,994 F32S probably benign Het
Tnnc1 C to A 14: 31,210,190 D62E probably damaging Homo
Vsig10 C to T 5: 117,343,819 A358V probably damaging Het
Phenotypic Description

The grasshopper phenotype, identified among ENU-mutagenized G3 mice, is characterized by an abnormal gait in which mutants lift their hind legs excessively high when walking.

Nature of Mutation
The grasshopper mutation was mapped to Chromosome 19, and DNA sequencing using the SOLiD technique identified a T to C transition at position 640 of the Rorb genomic DNA sequence (Genbank genomic region NC_000085). The mutation has been confirmed by DNA sequencing using the Sanger method. There are two Rorb isoforms that contain distinct first exons encoding the N-termini of the expressed proteins; they may arise from alternative promoter usage or exon splicing. The remaining nine C-terminal exons are identical between the two isoforms.  The grasshopper mutation occurs in the start codon of exon 1 of Rorb isoform 1 (nucleotide 640), and is not predicted to affect isoform 2.
 
isoform 1:
639 ATGCGAGCACAAATTGAAGTG
1   -M--R--A--Q--I--E--V-
 
Figure 1. Domain of RORb. The N-terminal domain varies between the two isoforms of RORb; only the shorter isoform 1 is shown. The position of the grasshopper mutation is indicated in red and results in substitution of the start methionine of RORβ-1 with threonine. This image is interactive. Click on the image to view other mutations found in the Rorb gene (red). Click on the mutations for more specific information. 
The mutated nucleotide is indicated in red lettering and results in substitution of the start methionine of RAR-related orphan receptor β-isoform 1 (RORβ1) with threonine (Figure 1).
 
Please see the record for 4-limb clasper for more information about RORβ.
Putative Mechanism

The grasshopper mutation is predicted to destroy the translation start codon of RORβ1, but leave RORβ2 completely unaffected. Thus, homozygous grasshopper mice are expected to be isoform 1-specific null mutants. RORβ1 and RORβ2 are reported to display differential tissue-specific expression patterns and response element specificity (1). These findings suggest non-redundant functions for these isoforms, but so far none have been reported.  The grasshopper phenotype supports the hypothesis that in at least those functions required for the development of normal walking motions, RORβ2 is non-redundant with RORβ1.

Primers Primers cannot be located by automatic search.
Genotyping
Grasshopper genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
Primers
grasshopper (F): 5’- CGACATCTGCCTAAAGGGATGCTTC -3’
grasshopper (R): 5’-AGAGACGCGCTTATAGACTGCTCC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
Primers for sequencing
grasshopper_seq(F): 5’- AAAGGGATGCTTCTCTCAGC -3’
grasshopper _seq(R): 5’- ACTTATGCCAGGGAGTTCAC -3’
 
The following sequence of 614 nucleotides (from Genbank genomic region NC_000085 for linear genomic sequence of Rorb, sense strand) is amplified:
 
494                cgacatc tgcctaaagg gatgcttctc tcagcggagc agctcttcgc
541  cgaccgcctt cttccctcgt gctgagcgga atttttgggt tctctggggt tcgggctggg
601  agcttcatga ctacgcggag caggacagcg gccacatcat gcgaggtaag cgagcccgcg
661  ggcgggcgcc cagagcagga caactctagc tagaccggga gctttggggg aggggagagc
721  tctcggccca agggaagaga gattggctac tcgaggctcc ccgagttcgg ttcgcaggtg
781  ggactgcaaa tggcctgggc ttggaaagtt gtgggaaggt gtggaaggct cggggatttt
841  ggcaggacgc tgaagggcgc attttttgga gaccaggaca gtgctaatcg cgcctcccag
901  ttctggattt gaatcttttc tgcgcgtcgc tctccggtgc gccacaggac acgggataga
961  gagcaggaag tcgggtgact ttgggtagaa gaggctggca gctcgcatcc cgccgtggtc
1021 gctagccata ggtgaactcc ctggcataag tggggatcac actggcccag gctgccagat
1081 gcaggagcag tctataagcg cgtctct
 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsHua Huang, Carrie N. Arnold, Katharina Brandl, and Bruce Beutler
Edit History
2011-06-15 3:31 PM (current)
2011-01-31 8:40 AM
2010-09-28 4:03 PM
2010-09-28 4:03 PM
2010-06-18 11:04 AM
2010-03-18 11:23 AM