Phenotypic Mutation 'Poorly' (pdf version)
AllelePoorly
Mutation Type nonsense
Chromosome9
Coordinate71,944,016 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Tcf12
Gene Name transcription factor 12
Synonym(s) HTF-4, ALF1, HEB, bHLHb20, HEBAlt, REB, HTF4, ME1
Chromosomal Location 71,842,688-72,111,871 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011544 (variant 1), NM_001253862 (variant 2), NM_001253863 (variant 3), NM_001253864 (variant 4), NM_001253865 (variant 5); MGI:101877

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000034755] [ENSMUSP00000139365] [ENSMUSP00000138939] [ENSMUSP00000138952] [ENSMUSP00000139084] [ENSMUSP00000139284] [ENSMUSP00000139248] [ENSMUSP00000139008] [ENSMUSP00000138832] [ENSMUSP00000139364] [ENSMUSP00000139233] [ENSMUSP00000138925]
SMART Domains Protein: ENSMUSP00000034755
Gene: ENSMUSG00000032228
AA Change: K110*

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139365
Gene: ENSMUSG00000032228
AA Change: K110*

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138939
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Predicted Effect probably benign
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139084
Gene: ENSMUSG00000032228
AA Change: K110*

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 5e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139284
Gene: ENSMUSG00000032228
AA Change: K18*

DomainStartEndE-ValueType
PDB:4JOL|H 85 108 4e-8 PDB
low complexity region 116 127 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
Predicted Effect probably null
Predicted Effect probably benign
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000138832
Gene: ENSMUSG00000032228
AA Change: K106*

DomainStartEndE-ValueType
PDB:4JOL|H 173 196 6e-8 PDB
low complexity region 204 215 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 348 359 N/A INTRINSIC
low complexity region 554 568 N/A INTRINSIC
HLH 603 656 7.54e-10 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139364
Gene: ENSMUSG00000032228
AA Change: K110*

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000138925
Gene: ENSMUSG00000032228
AA Change: K110*

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 534 548 N/A INTRINSIC
HLH 583 636 7.54e-10 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4+ T cells in CD3+ T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(40) : Chemically induced (other)(1) Endonuclease-mediated(1) Gene trapped(35) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Tcf12 APN 9 71868118 missense probably damaging 0.98
IGL01311:Tcf12 APN 9 71858656 splice site probably benign
IGL01734:Tcf12 APN 9 71922648 splice site probably null
IGL01768:Tcf12 APN 9 71868996 splice site probably null
IGL02625:Tcf12 APN 9 71922757 missense probably damaging 1.00
IGL02671:Tcf12 APN 9 72109717 missense probably damaging 1.00
IGL03395:Tcf12 APN 9 71876022 missense probably damaging 1.00
Poorly2 UTSW 9 71858929 missense probably damaging 1.00
Poorly3 UTSW 9 72015636 critical splice donor site probably null
Substandard UTSW 9 71858840 missense probably null 0.54
R0183:Tcf12 UTSW 9 71917027 missense probably damaging 0.99
R0257:Tcf12 UTSW 9 71858622 missense probably benign 0.05
R1126:Tcf12 UTSW 9 72000433 missense probably benign 0.09
R1520:Tcf12 UTSW 9 71883106 critical splice donor site probably null
R1690:Tcf12 UTSW 9 71870072 critical splice donor site probably null
R1819:Tcf12 UTSW 9 72109717 missense probably damaging 1.00
R1850:Tcf12 UTSW 9 71868215 missense probably damaging 1.00
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R2402:Tcf12 UTSW 9 71856510 missense probably damaging 1.00
R4445:Tcf12 UTSW 9 71869063 missense probably damaging 0.99
R4693:Tcf12 UTSW 9 71868967 intron probably benign
R4814:Tcf12 UTSW 9 71870041 intron probably benign
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4885:Tcf12 UTSW 9 71858840 missense probably null 0.54
R5347:Tcf12 UTSW 9 71885243 missense probably damaging 1.00
R5422:Tcf12 UTSW 9 71869038 missense probably damaging 1.00
R5650:Tcf12 UTSW 9 71885302 splice site probably null
R5713:Tcf12 UTSW 9 71885263 makesense probably null
R5789:Tcf12 UTSW 9 71885236 missense probably damaging 1.00
R5964:Tcf12 UTSW 9 71868240 missense probably damaging 1.00
R6012:Tcf12 UTSW 9 71858947 missense possibly damaging 0.62
R6119:Tcf12 UTSW 9 71868265 missense probably damaging 1.00
R6240:Tcf12 UTSW 9 71944016 nonsense probably null
R6299:Tcf12 UTSW 9 71858929 missense probably damaging 1.00
R6449:Tcf12 UTSW 9 71868268 missense probably damaging 1.00
R6489:Tcf12 UTSW 9 72015636 critical splice donor site probably null
R6984:Tcf12 UTSW 9 72006759 nonsense probably null
X0021:Tcf12 UTSW 9 71883172 missense probably damaging 0.99
X0022:Tcf12 UTSW 9 72109743 missense probably damaging 0.99
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-02-12 11:49 AM by Diantha La Vine
Record Created 2018-07-18 2:32 PM by Bruce Beutler
Record Posted 2018-12-05
Phenotypic Description

Figure 1. Poorly mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The poorly phenotype was identified among G3 mice of the pedigree R6240, some of which showed increased frequencies of CD8+ T cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased CD8+ T cell frequency using a dominant/additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 63 mutations (X-axis) identified in the G1 male of pedigree R6240. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. The increased CD8+ T cell frequency phenotype was linked by continuous variable mapping to a mutation in Tcf12:  an A to T transversion at base pair 71,944,016 (v38) on chromosome 9, or base pair 111,405 in the GenBank genomic region NC_000075.  Linkage was found with an additive/dominant model of inheritance, wherein 23 heterozygous mice departed phenotypically from 26 homozygous reference mice with a P value of 3.729 x 10-7 (Figure 2); no homozygous variant mice were alive at time of screening.  

 

The mutation corresponds to residue 594 in the mRNA sequence NM_011544 within exon 6 of 21 total exons.

 

579 TCAAATCTGATAGGGAAAACATCAGAGAGAGGC

105 -S--N--L--I--G--K--T--S--E--R--G-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of lysine 110 for a premature stop codon (K110*) in the HEB protein.

Protein Prediction
Figure 3. Domain organization of HEB. The Poorly mutation results in substitution of lysine 110 for a premature stop codon. Click on other mutations to view additional information. Abbreviations: AD1 and AD2, activation domain 1 and 2, respectively; LZ, leucine zipper; bHLH, basic helix-loop-helix
Figure 4. Crystal structure of basic-helix-loop-helix domains of the E47/NeuroD1 heterodimer bound to DNA. UCSF Chimera model is based on PDB 2QL2, Longo et al. Biochemistry. 47, 218-229 (2008). Click on the 3D structure to view it rotate.

Tcf12 encodes HeLa E-box binding protein (HEB; alternatively, helix-loop-helix transcription factor-4 [HTF4] or ME1), a member of the class I basic helix-loop-helix (bHLH) transcription factor family. The class I bHLH proteins also include E2A (E47/E12; alternatively, TCF-3) and E2-2 (alternatively, TCF-4). See the Background section for more information about E protein function. Class I bHLH transcription factors recognize the E box (sequence: CANNTG) in target DNA and are designated as E proteins. E box sites are found in several B and T lineage-specific genes, including the immunoglobulin loci, the T cell receptor (TCR) α and β loci, mb-1, λ5, and pre-Tα genes, and the CD4 silencer and enhancer elements.

 

E proteins have several similar domains, including a C-terminal bHLH domain and two transcriptional activation domains (AD1 and AD2) [Figure 3; (1); reviewed in (2)]. HEB also has a leucine zipper. The bHLH domains facilitate the dimerization of bHLH proteins, which is required for their transcriptional activity [reviewed in (2)]. The bHLH domain also facilitates interaction with p300, a component of the transcriptional machinery (3). P300 subsequently recruits histone acetyltransferases and RNA polymerase II to the promoter or enhancers of target genes. The crystal structure of the bHLH domain of an E47/NeuroD1 heterodimer has been solved [Figure 4; PDB:2QL2; (4;5)].  The E47/NeuroD1 dimer forms a parallel, four-helix bundle which allows the basic region to contact the major groove of DNA. Residues in the loop and helix two make contact with DNA. Each monomer interacts with either a CAC or CAG half-site within the E-box on the target DNA. A glutamate in the basic region of each monomer makes contact with cytosine and adenine bases in the DNA; an adjacent arginine stabilizes the glutamate. Both the glutamate and the arginine residues are conserved in most bHLH proteins (6).

 

The AD1 domain recruits the SAGA chromatin remodeling complex as well as the CBP and p300 histone acetyltransferases (7). The AD1 domain also represses transcription by recruiting a family of corepressors called ETO (8). The AD2 domain can drive the expression of reporter constructs containing bHLH target genes (7).

 

TCF12 has two transcription start sites and undergoes alternatively splicing to produce a shorter HEB variant, HEBalt (9). HEBalt lacks the AD1 domain, but shares the AD2 and bHLH domain with canonical HEB. HEBAlt has a unique domain, the Alt domain, upstream of AD2 compared to canonical HEB. HEBalt is expressed in pro-T cells and enhances the generation of T cell precursors. TCF12 also has two alternative acceptor sites preceding the second exon, which produces two distinct transcripts, HTF4a and HTF4b (10). HTF4a and HTF4b differ in their 5’-UTR, but share identical coding sequences. A cell-type specific protein, HTF4c, is produced by differential utilization of exon 15.

 

The poorly mutation results in substitution of lysine 110 for a premature stop codon (K110*) in the HEB protein; Lys110 is within the AD1 domain.

Expression/Localization

TCF12 is expressed at varying levels in several human cell lines and tissues (11). Tcf12 is expressed in the embryonic midbrain throughout development, but is not expressed in adult neurons (12).

Background
Figure 5. Regulation of T and B cell development by HEB. 

Development of αβ thymocytes into mature T cells occurs in the thymus through a differentiation program characterized by the expression of certain cell-surface markers including CD4 (see the record for thoth), CD8 (see the record for alfalfa [Cd8a] and Carlsbad [Cd8b1]), CD44 (see the record for Jialin) and CD25 [Figure 5; reviewed in (13)].  The most immature stage of thymocyte development is known as the double negative (DN) stage due to the lack of expression of CD4 and CD8.  Differentiation proceeds through several stages known as DN1-4 that differentiate in the following order: CD44+CD25- (DN1) to CD44+CD25+ (DN2) to CD44-CD25+ (DN3) to CD44-CD25- (DN4).  The DN3 stage is the first critical checkpoint during thymocyte development.  Progression and expansion past DN3 requires surface expression of the product of a productive chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with CD3 and TCRζ.  This complex, known as the pre-TCR, produces a TCR-like signal that requires Lck (see the record for iconoclast) and Fyn and is necessary for continued survival (14;15).  Interestingly, this stage does not require CD4 or CD8 (16).  After progressing through the DN4 stage, αβ thymocytes express both CD4 and CD8 and are known as double positive (DP) cells.  Progression past this state to single positive CD4 or CD8 cells requires a TCR signal that occurs through a newly rearranged TCRα chain and the previously expressed TCRβ chain.  The strength of interaction of the final TCRαβ receptor to self-MHC molecules expressed on stromal or APCs in the thymus determines whether or not thymocytes are positively selected and survive to become a single positive (SP) CD4 or CD8 T cell.  Strong interactions and increased TCR signaling likely represents autoreactivity and results in negative selection, while moderate interactions indicates usefulness of the TCR and results in positive selection.  Cells that are unable to effectively bind MHC are eliminated.  Interestingly, CD4 associates more strongly with Lck than does CD8 and fusing the transmembrane/cytoplasmic domains of CD4 to the extracellular domain of CD8 diverted a transgenic MHC-I-restricted TCR into the CD4 lineage suggesting that the TCR signal in CD4+ T cells is different and stronger than the one in CD8+ T cells (17).  Increasing Lck activity in transgenic mice is sufficient to promote CD4 commitment and, conversely, decreasing Lck activity can promote CD8 commitment (18;19).  CD4+ cells become several distinct subsets of T cells including T helper cell subsets Th1, Th2, Th3, Th17 and follicular helper (TFH) cells (please see the record for sanroque), as well as Tregs.  Th cells are involved in activating and directing other immune cells such as B cells, macrophages, and neutrophils by producing specific cytokines, while Tregs are important for suppressing autoimmune responses (20), and express the transcription factor FOXP3 (see the record for crusty) (21)

 

HEB and E2A regulate lymphocyte development and differentiation. E2A and HEB form homo- or heterodimers to activate the transcription of target genes. E2A homodimers are essential for B cell development, while E2A-HEB heterodimers are essential for T cell development (22). E2A and HEB cooperate to maintain DP T cell fate and to control the DP to SP transition until a functional alphabetaTCR is produced (23;24). HEB functions in TCRα and TCRβ gene rearrangement (25;26) as well as in the regulation of pTα (24;27;28) and CD4 (22) gene expression. HEB also putatively assists in the downregulation of IL7R signaling after β-selection. HEB is required for the development of CD73+ and CD73 γδT17 cells in the fetal thymus (29). In addition HEB is required for the expression of Sox4, Sox13, and Rorc in immature CD24+CD73 γδ T cells (29). HEB interacts with Notch1 and GATA3 to regulate T cell fate choice in developing thymocytes (30). HEB-deficient T cell precursors show compromised Notch1 function and lose T cell potential. After reconstitution of the HEB-deficient T cell precursors with Notch1, the cells adopted a DN1-like phenotype and could be induced to differentiate into thymic NK cells.

 

Although E2A primarily functions in B cell development, HEB and E2-2 also have roles in B cell development. Mice lacking either E2-2 or HEB can produce mature B cells, but they have reduced numbers of pro-B cells. This indicates that E2-2 and HEB promote cell survival at the pro-B stage (31).  HEB and E2A also work together to activate the expression of FOXO1 in common lymphoid progenitors (32). E2A and FOXO1 subsequently induce the expression of EBF1. EBF1 and FOXO1 establish a positive intergenic feedback circuitry to establish B cell identity (33). E2A, EBF1 and FOXO1 coordinately activate the expression of PAX5.

 

B cell progenitors first arise in fetal liver, then in bone marrow shortly after birth, and give rise to three major mature populations (34). Marginal zone (MZ) B cells localize to the splenic marginal zone and respond to blood-borne antigens independently of T cell help (35).  Follicular B cells, by contrast, respond to protein antigens in a T cell-dependent manner, and progressively undergo immunoglobulin isotype switching and affinity maturation. B-1 B cells comprise a much smaller population, which predominates in the pleural and peritoneal cavities and contributes most of the serum IgM during the early phases of infection (36).  Whereas MZ and B-1 B cells are predominantly self-renewing, follicular B cells require constant replenishment from bone marrow.  The development of B cells is characterized by the differential expression of marker proteins, and by the sequential recombination of the immunoglobulin gene loci [reviewed in (37)].  In the bone marrow, lymphoid progenitor cells or prepro-B cells receive signals from bone marrow stromal cells, such as interleukin 7 (IL-7) to begin B cell development.  The developmental of early B lymphopoiesis is regulated by a network of key transcription factors that include PU.1, Ikaros (see the record for star_lord), Bcl11a (a zinc finger transcription factor), E2A, EBF1 (early B cell factor; see the record for crater_lake) and the paired boxprotein, Pax5 (see the record for glacier) (38). Prepro-B cells become pro-B cells as they begin to rearrange their immunoglobulin heavy (IgH) chains in a process known as V(D)J recombination mediated by the RAG1 (recombination activating gene 1)-RAG2 complex (see the record for maladaptive [Rag1] and snowcock [Rag2]).  On the H chromosome, the diversity (D) and joining (J) gene segments are recombined together, and the cells transition into the early pro-B stage and express the CD45 (B220) marker (see the record for belittle).  Joining of a variable (V) segment to the D-J segment completes the late pro-B cell stage.  Successful VDJ recombination gives rise to the Igμ chain.  Two Igμ chains combine with two surrogate light chains (SLCs), composed of λ-5 and Vpre5.  Association with the signaling subunits Igα and Igβ completes the pre-B cell receptor (BCR) complex.  Cells expressing the pre-BCR are competent for pre-BCR signaling, which initiates proliferation, further differentiation, and eventually downregulates expression of the pre-BCR.  Cycling B cells expressing the pre-BCR complex are known as large pre-B cells.  Large pre-B cells downregulate both the B cell marker CD43 as well as the pre-BCR to become non-cycling small pre-B cells.  At this stage rearrangement of the immunologlobin light (IgL) chain by the RAG1-RAG2 complex occurs to form the BCR (or surface IgM) characteristic of immature B cells.  These cells leave the bone marrow to further mature in the spleen. 

 

HEB has several functions in addition to its function in lymphocyte development: (i) HEB functions in early cell-fate determination and subset specification of midbrain dopamine neurons (12). (ii) HEB is a signaling cofactor with SMAD2/3 and FOXH1 during mesendoderm differentiation (39). Loss of HEB expression in human embryonic stem cells resulted in mesodermal development defects as well as reduced expression of regulators of mesoendodermal fate choices (40). Mesoderm-derived hemogenic endothelium formation and T cell development were aberrant. (iii) HEB mediates bone marrow mesenchymal stem cell osteogenic differentiation (41). HEB downregulation is essential for osteoblast differentiation via the bone morphogenetic protein (BMP) and ERK1/2 signaling pathways. (iv) HEB synergizes with the bHLH transcription factors MyoD, ITF2, and E12 to induce myogenic differentiation through the regulation of myogenin expression in proliferating myoblasts (42;43).

 

Mutations in TCF12 are linked to craniosynostosis-3 (OMIM: # 615314) (44). Craniosynostosis is a skull growth abnormality in which the cranial sutures prematurely fuse. As a result, the growth velocity of the skull often cannot match that of the developing brain. Craniosynostosis-3 includes coronal, sagittal, and multisuture forms.

Putative Mechanism

Tcf12-deficient (Tcf12-/-) mice on the 129/Sv * C57BL/6 genetic background exhibited postnatal lethality within two weeks of birth (31). Tcf12-/- mice showed a 50 percent reduction in the number of pro-B cells (31). Tcf12-/- mice on the 129S7/SvEvBrd genetic background showed reduced thymocyte numbers due to a block in T cell development at the immature single positive stage (45). Tcf12-/- mice on the 129S7/SvEvBrd * C57BL/6J genetic background showed thymus hypoplasia, increased numbers of double-negative T cells and CD8+ T cells with a concomitant reduction in the number of double-positive T cells (46). A Tcf12 mutant (HEBbm/bm) mouse with point mutations within the basic DNA-binding region (R611G, L612H, R613G) showed postnatal lethality within two weeks of birth and postnatal growth retardation (45). Some fetuses showed exencephaly. The HEBbm/bm mice also showed thymus hypoplasia; reduced thymocyte numbers; impaired B cell differentiation with reduced immature B cell, pro-B cell, and pre-B cell numbers; and aberrant T cell differentiation (i.e., severe block at the DN3 stage of T-cell development) with increased double-negative T cell number, reduced double-positive T cell number, and loss of single-positive T cells in the thymus (45). Approximately 10 to 20 percent of HEBbm/+ mice showed seizure episodes upon handling by the tail (45).

 

The phenotypes observed in the Poorly mice mimic that of the HEBbm/bm mice, indicating loss of HEB-associated function in B and T cell development.

Primers PCR Primer
Poorly(F):5'- GGAATAGGTGAGAACTTATTTCCAGAC -3'
Poorly(R):5'- TGCTTCAGTGTTCAGTCGTC -3'

Sequencing Primer
Poorly_seq(F):5'- CCAGACATAAGATGCATTTAGAAAGC -3'
Poorly_seq(R):5'- AAATATGTGTGAATGTCCTCTGTGAG -3'
References
  21. Fontenot, J. D., Gavin, M. A., and Rudensky, A. Y. (2003) Foxp3 Programs the Development and Function of CD4+CD25+ Regulatory T Cells. Nat Immunol. 4, 330-336.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler