Phenotypic Mutation 'Catastrophic'

• Allele: Catastrophic
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 44,774,712 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Ebf1
• Gene Name: early B cell factor 1
• Synonym(s): Olf1, O/E-1, Olf-1
• Chromosomal Location: 44,508,144-44,898,918 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Asparagine changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000080020] [ENSMUSP00000099857] [ENSMUSP00000104891]
• AlphaFold: Q07802
• PDB Structure: DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (crystal form II) [X-RAY DIFFRACTION] ; DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (Crystal form I) [X-RAY DIFFRACTION] ; Early B-cell Factor 1 (Ebf1) bound to DNA [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000080020; Gene: ENSMUSG00000057098; AA Change: N236K

Domain	Start	End	E-Value	Type
IPT	261	345	7.38e-8	SMART
HLH	346	395	5.4e-2	SMART
low complexity region	526	544	N/A	INTRINSIC
low complexity region	564	575	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
  (Using ENSMUST00000081265)
• SMART Domains: Protein: ENSMUSP00000099857; Gene: ENSMUSG00000057098; AA Change: N236K

Domain	Start	End	E-Value	Type
Pfam:COE1_DBD	17	247	8e-150	PFAM
IPT	262	346	7.38e-8	SMART
HLH	347	396	5.4e-2	SMART
low complexity region	527	545	N/A	INTRINSIC
low complexity region	565	576	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000101326)
• SMART Domains: Protein: ENSMUSP00000104891; Gene: ENSMUSG00000057098; AA Change: N236K

Domain	Start	End	E-Value	Type
IPT	254	338	7.38e-8	SMART
HLH	339	388	5.4e-2	SMART
low complexity region	519	537	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000109268)
• Meta Mutation Damage Score: 0.7195
• Is this an essential gene?: Probably essential (E-score: 0.883)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:35 PM by Diantha La Vine
• Record Created: 2018-07-18 11:03 PM by Bruce Beutler
• Record Posted: 2018-12-04
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001290709 (variant 1), NM_007897 (variant 2), NM_001290710 (variant 3), NM_001290711 (variant 4); MGI:95275

Alleles Listed at MGI

All Mutations and Alleles(28) : Chemically induced (other)(1) Gene trapped(21) Spontaneous(1) Targeted(5)

Phenotypic Description

Figure 1. Catastrophic mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Catastrophic mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Catastrophic mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Catastrophic mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Catastrophic mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Catastrophic mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Catastrophic mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The catastrophic phenotype was identified among G3 mice of the pedigree R6170, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2) with concomitant increased frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), CD44+ CD4 T cells (Figure 5), and CD8+ T cells (Figure 6). Some mice also showed reduced frequencies of NK cells (Figure 7).

Nature of Mutation

Figure 8. Linkage mapping of the reduced B cell percentage using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 70 mutations (X-axis) identified in the G1 male of pedigree R6170. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 70 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ebf1:  a T to A transversion at base pair 44,883,885 (v38) on chromosome 11, or base pair 265,786 in the GenBank genomic region NC_000077. The strongest association was found with a dominant/additive model of inheritance to the normalized percentage of  B cells, wherein 26 heterozygous mice departed phenotypically from 29 homozygous reference mice with a P value of 9.741 x 10^-18 (Figure 10). No homozygous variant mice were screened for pedigree R6170. 

The mutation corresponds to residue 787 in the mRNA sequence NM_001290709 within exon 8 of 16 total exons.

770 AACATGTTTGTCCACAATAACTCCAAGCACGGG 231 -N--M--F--V--H--N--N--S--K--H--G-

The mutated nucleotide is indicated in red. The mutation results in an asparagine to lysine substitution at position 236 (N236K) in the EBF1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.996).

Protein Prediction

Figure 11. Domain structure of the EBF1 protein. The Catastrophic mutation and other mutations in EBF1 are noted. Click on each mutation for more information. Abbreviations: DBD, DNA-binding domain; ZK, Zinc knuckle; TIG/IPT, transcription factor immunoglobulin/Ig plexin-like fold in transcription factors; HLHLH, helix-loop-helix-loop-helix.

Early B cell factor 1 (EBF1; alternatively, EBF, O/E-1, or COE1) is a member of the COE (Collier-Olf-EBF) family of transcription factors. EBF1 has a DNA-binding domain (DBD), a TIG/IPT (transcription factor immunoglobulin (Ig)/Ig plexin-like fold in transcription factors) domain, a dimerization region similar to those found in basic helix-loop-helix proteins (termed the helix-loop-helix-loop-helix (HLHLH) domain), and a putative activation/multimerization domain that is rich in serine, threonine, and proline residues (Figure 11) (1-4). A RRARR motif between the DBD and TIG/IPT domain is predicted to be a nuclear localization sequence (5). A histidine and three cysteines within a 14-residue motif, termed the ‘zinc knuckle’, coordinates a zinc ion and mediates DNA recognition (2;6).

Ebf1 has two promoters, a distal promoter (α) and a proximal promoter (β), which produce two EBF1 proteins (7). The two proteins differ by 11 amino acids at the N-terminus. The proteins are predicted to have similar functions. Interleukin-7 signaling, E2A, and EBF1 activate the distal Ebf1 promoter, whereas Pax5, Ets1, and Pu.1 regulate the stronger proximal promoter (7).

The catastrophic mutation results in an asparagine to lysine substitution at position 236 (N236K) in the EBF1 protein; Asn236 is within the DBD.

For more information about EBF1, please see the record for crater_lake.

Putative Mechanism

During B cell differentiation from a common hematopoietic stem cell (HSC) progenitor to a mature B cell, PAX5 [see the record for glacier] and other lineage-specific B lymphoid transcription factors such as EBF1 and E2A function to both activate B lineage-specific genes as well as to repress the transcription of other lineage-inappropriate genes.

In the lymphoid lineage, common lymphoid progenitors (CLPs) are divided into Ly6D-negative all-lymphoid progenitors (ALPs) and Ly6D-positive B cell biased lymphoid progenitors (BLPs) (8). The ALPs generate B cells, T cells, natural killer cells, and lymphoid dendritic cells. The BLPs are biased towards the B cell lineage. Ebf1 expression is initially expressed in the BLPs (9). E2A/E47 and HEB activate the expression of FOXO1, which acts with E2A to induce the expression of EBF1 (10). Expression of EBF1 (and FOXO1) in common lymphoid progenitors biases the cells towards B cell lymphopoiesis. EBF1 subsequently activates the expression of PAX5, which commits cells to the B cell fate (11).

EBF1 is a transcription factor that is required for B cell commitment, pro-B cell development, the transition to the pre-B cell stage, germinal center formation, and class switch recombination as well as for the proliferation, survival, and signaling of pro-B cells and peripheral B-cell subsets (e.g., B1 cells, follicular, and marginal zone B cells) (9;12). Ebf1-deficient (Ebf1^-/-) mice exhibit premature death (incomplete penetrance), reduced body sizes, reduced subcutaneous adipose tissue amounts, reduced serum IgM levels, decreased numbers of pro-B cells, loss of mature B cells in the blood and spleen, increased osteoblast cell numbers, and abnormal bone ossification (13;14). The Ebf1^-/- mice show no V(D)J recombination.  Mice expressing a spontaneous Ebf1 mutation (Ebf1^Serv/+; MGI:5007783) also exhibited reduced B cell numbers. Exogenous expression of EBF1 in mouse hematopoietic stem cells promotes B cell development, but the development of other hematopoietic cell lineages is impaired (15).

The phenotype observed in catastrophic mice indicates loss of EBF1^catastrophic function in regulating EBF1 target genes.

Primers

PCR Primer
Catastrophic_pcr_F: GACGTGTACGACATAAGCACCAG
Catastrophic_pcr_R: TCAGAGGTGTTCAATGGGAC

Sequencing Primer
Catastrophic_seq_F: CGACATAAGCACCAGTTATTATGTG
Catastrophic_seq_R: GGGACACTCAAAATTTGTAACAATAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 412 nucleotides is amplified (chromosome 11, + strand):

1   gacgtgtacg acataagcac cagttattat gtgaaatagc tgtgcaattt tcttcagctc
61  ccagctgtta tttatttaac ttgcgtttat ttcccaccat gcttttatat gaaaatgttc
121 attcatttcc ctctcctgtc tccaggtcgt ggtgtctacc acagtcaacg tggatggcca
181 tgtcctggca gtctctgata acatgtttgt ccacaataac tccaagcacg ggcggagggc
241 tcggaggctt gacccctcgg aaggtacgcc ctcttatctg gaacatggta ggcgaatcat
301 tttcattggt tggcattgct acttgtgact gtgactttgt gtgatttctt tccttcactg
361 caccacattt cctattgtta caaattttga gtgtcccatt gaacacctct ga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Hagman, J., Belanger, C., Travis, A., Turck, C. W., and Grosschedl, R. (1993) Cloning and Functional Characterization of Early B-Cell Factor, a Regulator of Lymphocyte-Specific Gene Expression. Genes Dev. 7, 760-773.

  2. Hagman, J., Gutch, M. J., Lin, H., and Grosschedl, R. (1995) EBF Contains a Novel Zinc Coordination Motif and Multiple Dimerization and Transcriptional Activation Domains. EMBO J. 14, 2907-2916.

  3. Treiber, N., Treiber, T., Zocher, G., and Grosschedl, R. (2010) Structure of an Ebf1:DNA Complex Reveals Unusual DNA Recognition and Structural Homology with Rel Proteins. Genes Dev. 24, 2270-2275.

  4. Siponen, M. I., Wisniewska, M., Lehtio, L., Johansson, I., Svensson, L., Raszewski, G., Nilsson, L., Sigvardsson, M., and Berglund, H. (2010) Structural Determination of Functional Domains in Early B-Cell Factor (EBF) Family of Transcription Factors Reveals Similarities to Rel DNA-Binding Proteins and a Novel Dimerization Motif. J Biol Chem. 285, 25875-25879.

  5. Boller, S., and Grosschedl, R. (2014) The Regulatory Network of B-Cell Differentiation: A Focused View of Early B-Cell Factor 1 Function. Immunol Rev. 261, 102-115.

  6. Fields, S., Ternyak, K., Gao, H., Ostraat, R., Akerlund, J., and Hagman, J. (2008) The 'Zinc Knuckle' Motif of Early B Cell Factor is Required for Transcriptional Activation of B Cell-Specific Genes. Mol Immunol. 45, 3786-3796.

  7. Roessler, S., Gyory, I., Imhof, S., Spivakov, M., Williams, R. R., Busslinger, M., Fisher, A. G., and Grosschedl, R. (2007) Distinct Promoters Mediate the Regulation of Ebf1 Gene Expression by Interleukin-7 and Pax5. Mol Cell Biol. 27, 579-594.

  8. Inlay, M. A., Bhattacharya, D., Sahoo, D., Serwold, T., Seita, J., Karsunky, H., Plevritis, S. K., Dill, D. L., and Weissman, I. L. (2009) Ly6d Marks the Earliest Stage of B-Cell Specification and Identifies the Branchpoint between B-Cell and T-Cell Development. Genes Dev. 23, 2376-2381.

  9. Vilagos, B., Hoffmann, M., Souabni, A., Sun, Q., Werner, B., Medvedovic, J., Bilic, I., Minnich, M., Axelsson, E., Jaritz, M., and Busslinger, M. (2012) Essential Role of EBF1 in the Generation and Function of Distinct Mature B Cell Types. J Exp Med. 209, 775-792.

  10. Zandi, S., Mansson, R., Tsapogas, P., Zetterblad, J., Bryder, D., and Sigvardsson, M. (2008) EBF1 is Essential for B-Lineage Priming and Establishment of a Transcription Factor Network in Common Lymphoid Progenitors. J Immunol. 181, 3364-3372.

  11. Decker, T., Pasca di Magliano, M., McManus, S., Sun, Q., Bonifer, C., Tagoh, H., and Busslinger, M. (2009) Stepwise Activation of Enhancer and Promoter Regions of the B Cell Commitment Gene Pax5 in Early Lymphopoiesis. Immunity. 30, 508-520.

  12. Gyory, I., Boller, S., Nechanitzky, R., Mandel, E., Pott, S., Liu, E., and Grosschedl, R. (2012) Transcription Factor Ebf1 Regulates Differentiation Stage-Specific Signaling, Proliferation, and Survival of B Cells. Genes Dev. 26, 668-682.

  13. Lin, H., and Grosschedl, R. (1995) Failure of B-Cell Differentiation in Mice Lacking the Transcription Factor EBF. Nature. 376, 263-267.

  14. Hesslein, D. G., Fretz, J. A., Xi, Y., Nelson, T., Zhou, S., Lorenzo, J. A., Schatz, D. G., and Horowitz, M. C. (2009) Ebf1-Dependent Control of the Osteoblast and Adipocyte Lineages. Bone. 44, 537-546.

  15. Zhang, Z., Cotta, C. V., Stephan, R. P., deGuzman, C. G., and Klug, C. A. (2003) Enforced Expression of EBF in Hematopoietic Stem Cells Restricts Lymphopoiesis to the B Cell Lineage. EMBO J. 22, 4759-4769.