Phenotypic Mutation 'cardigan' (pdf version)
Gene Symbol Slc45a2
Gene Name solute carrier family 45, member 2
Synonym(s) Aim-1, Aim1, Dbr, Matp, blanc-sale, bls, uw
Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Allele cardigan
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 15
Chromosomal Location 11,000,721-11,029,233 bp (+)
Type of Mutation NONSENSE
DNA Base Change
(Sense Strand)
C to A at 11,022,172 bp (GRCm38)
Amino Acid Change Serine changed to Stop codon
Ref Sequences
S333* in NCBI: NP_444307.1 (fasta)
SMART Domains

DomainStartEndE-ValueType
Pfam:MFS_1 36 364 1.3e-9 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Phenotypic Category pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI
All alleles(11) : Targeted, other(1) Spontaneous(5) Chemically induced(5)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 missense probably damaging 0.96
cheng UTSW 15 11025868 missense
draco2 UTSW 15 11000817 missense probably benign 0.05
galak UTSW 15 11012667 nonsense
grey goose UTSW 15 11002981 missense probably damaging 1.00
june gloom UTSW 15 11023443 missense probably damaging 0.96
nilla UTSW 15 splice donor site destroyed
Olaf UTSW unclassified
sweater UTSW 15 11012610 missense probably damaging 0.96
voldemort UTSW 15 unknown
yuki UTSW 15 11001092 missense probably damaging 1.00
zuckerkuss UTSW 15 11025935 critical splice donor site
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 missense probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably benign 0.01
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

none

Last Updated 12/12/2013 6:56 PM by Stephen Lyon
Record Created unknown
Record Posted 04/15/2008
Phenotypic Description
The cardigan mutation was induced by ENU mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals.  Homozygous mutant mice exhibit a "dirty white" coat color associated with a light ocular albinism (Figure 1).  Newborn mutants have very light-colored skin and eyes in comparison with their heterozygote littermates.  Their eyes darken during development until only a light red glint remains in adults.  Cardigan mutants are viable and fertile.  Cardigan mutants bear a strong resemblance to galak, sweater, and grey goose mutant animals.

 

Nature of Mutation
The cardigan mutation was mapped to Chromosome 15, and corresponds to a C to A transversion at position 1094 of the Slc45a2 transcript, in exon 4 of 7 total exons.
 
1078 TGGACTGCCTTCCTGTCAAACATGCTCTTCTTC
328  -W--T--A--F--L--S--N--M--L--F--F-
 
The mutated nucleotide is indicated in red lettering, and creates a premature stop codon at codon 333 (normally a serine) deleting 297 amino acids from the C-terminus of the protein.
Protein Prediction
Figure 2. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The cardigan mutation creates a premature stop codon at codon 333 (normally a serine) deleting 297 amino acids from the C-terminus of the protein. This image is interactive. Click on the image to view other mutations found in SLC45A2. Click on the mutations for more specific information. 
The mouse SLC45A2 (solute carrier family 45, member 2) or MATP (membrane associated transporter protein) protein contains 530 residues and is 82% identical to human SLC45A2 located on Chromosome 5 (1). 
 
SLC45A2 is a 55kD protein with 12 membrane-spanning domains (Figure 2).  Homologues are present in all vertebrates with a high level of conservation between fish and mouse (2), and even higher between mouse and human (1).  SLC45A2 proteins are similar to sucrose/proton transporters found in plants (1;2), especially to the plant transporters belonging to the SUC3/SUT2 groups (named for Arabidopsis thaliana sucrose transporter 3, and Lycopersicon esculentum sucrose transporter 2) (3).  SLC45A2 transporters are distinguished by an elongated N-terminus, and by an enlarged cytoplasmic loop between transmembrane domains six and seven.  They also have higher Km values for sucrose uptake relative to other plant sucrose transporters (3).  Sucrose transporters are known to transport other sugars besides sucrose, and may even catalyze biotin uptake across the membrane (3).  SLC45A2 proteins include a region found in all plant sucrose/proton symporters known as the sucrose-transporter signature sequence, R-X-G-R-[K/R], located between transmembrane domains two and three (1-4).  The aspartate residue located in the fourth transmembrane domain of all sucrose transporters is also found in SLC45A2 (2).  The N and C-terminal domains of SLC45A2 are predicted to be on the cytoplasmic side of the membrane along with the loops between transmembrane domains two and three, four and five, six and seven, eight and nine, and ten and eleven (1;2).  The transmembrane domains of sucrose transporters are predicted to form alpha-helices (3;4).
 
The cardigan mutation results in protein truncation after amino acid 333, located in the seventh transmembrane domain of the SLC45A2 protein.  It is unknown whether normal levels of the altered SLC45A2 protein exist in cardigan mice.
Expression/Localization
In situ hybridization analysis demonstrates expression of murine Slc45a2 in the presumptive retinal pigmented epithelium (RPE) starting at embryonic day (E) 9.5, and in neural crest-derived melanoblasts (melanocyte precursor cells) starting at E10.5.  The in vivo cellular expression pattern of Slc45a2 at E9.5–E11.5 has a distribution similar to that of dopachrome tautomerase (Dct), an enzyme involved in melanin synthesis often used as a marker for melanoblasts (5), consistent with Slc45a2 expression in pigment cell precursors.  Slc45a2 expression at E9.5 is observed at the dorsal edge of the optic vesicle, the presumptive RPE.  At E10.5, Slc45a2 expression continues in the presumptive RPE, and is also seen in rostral, neural crest-derived melanoblasts.  This expression pattern continues at E11.5 (6).
 
Human SLC45A2 mRNA is expressed at high levels in most melanoma and melanocyte cell lines, but not in other tissues (7).  However, expressed sequence tags (ESTs) of both mouse and human SLC45A2 are present in kidney and uterus cDNA libraries, suggesting some expression of SLC45A2 in these tissues (2).
 
The subcellular localization of the SLC45A2 protein has not been determined.
Background

Figure 3. Premelanosomes arise from the late secretory or endosomal pathway. Stage 1 premelanosomes (depicted here as "Early endosome/Stage I" for simplicity) lacking pigment are thought to correspond to the coated endosome, an intermediate between early and late endosomes densely coated on one face with clathrin. PMEL17, a structural component of the melanosome on which melanins are deposited (not depicted) accumulates in stage I and II; PMEL17 is masked by melanin in later stages. Melanin synthesis begins in Stage II premelanosomes that contain regular arrays of parallel fibers that give these organelles a striated appearance by electron microscopy. During Stage III, these fibers gradually darken and thicken (red arrows, inset) as eumelanin is deposited along them, such that by Stage IV no striations are visible and the melansome is filled with melanin; this action has been illustrated in the inset. All cargoes required for melanin synthesis, processing, and transport (OCA2, SLC45A2, Rab32, Rab38, DCT (alternatively, Tyrp2), Tyr, and Tyrp1) derive from the Golgi and traverse vacuolar and/or tubular elements (not shown) of early endosomes en route to the stage III melanosome. Adaptor protein-3 and -1 as well as biogeneisis of lysosome-related organelle complex-1 (BLOC-1) and BLOC-2 regulate the intracellular trafficking of Tyrp1. SLC45A2 and OCA2 function in the trafficking of Tyrp1 and DCT to melanosomes. OCA2 maintains the proper pH in the melanosomes and transports glutathione, a protein necessary for Tyr and Tyrp1 trafficking to melanosomes. Black arrows represent transport of vesicles; red arrows represent protein-mediated regulation at a specific transport step as indicated in the key. Slc45a2 expression is regulated by the microphthalmia transcription factor (MITF). The image is interactive, click to reveal mutations in several of the proteins. Several mouse models with mutations in components of the pigment-producing pathway are shown below; the mutation name (black) and mutated gene (red) are indicated. The melanosome pathway has been adapted from several sources including: Raposo, G. and Marks, M.S. (2007), Nat. Rev. Mol. Cell Biol., 8:786 and Lakkaraju, A. et al. (2009), J. Cell Biol., 187:161.

The SLC45A2 gene was independently discovered as encoding a melanocyte differentiation antigen expressed in a high percentage of melanoma cell lines (7), and a transporter protein critical for normal pigmentation in medaka fish, mice, and humans (1;2).  In mice, the underwhite (uw) gene encodes the SLC45A2 protein (1;8).  Uw mutants display variable levels of pigmentation in their skin, hair, and eyes, which range from nearly white with dark red eyes for homozygous underwhite mice, light beige with darker eyes for homozygous underwhite dominant brown (Uwdbr) mice, to dark brown and dark eyes for heterozygous Uwdbrand underwhite dense (uwd) animals (9).

 

Initial studies of mice with uw mutations found defects in the melanosomes of these animals.  Melanosomes are endolysosomal-like organelles in which melanin is synthesized and stored (Figure 3).  They are present in pigmented cells including melanocytes and retinal pigmented epithelial cells (10).  Uw melanosomes are irregular in shape, reduced in size, and less mature than their wild-type counterparts.  The irregular shape of the melanosomes suggests that the protein encoded by the uw gene is important in melanosome biogenesis where it might play a structural role (9).  The semidominant nature of the Uwdb allele is also consistent with a structural role for the SLC45A2 protein.  Underwhite mutations reduce the levels of eumelanin (black/brown) pigment specifically by causing a reduction in levels of tyrosinase protein and activity (11;12).  Low tyrosinase activity favors pheomelanin (yellow/red) pigment production (13), whereas complete absence of tyrosinase activity results in absence of both eumelanin and pheomelanin (as in ghost mutants).  These phenotypes are remarkably similar to the phenotypes seen in mice mutant for Oca2, which also encodes a putative transporter protein (14;15) (mutated in quicksilver, charbon, snowflake, whitemouse, and faded).  Similar to the OCA2 protein, SLC45A2 appears to be necessary for the processing and trafficking of tyrosinase and other proteins to the melanosomes.  In vitro, uw melanocytes process tyrosinase and other melanosomal proteins normally through the endoplasmic reticulum (ER) and the Golgi apparatus, but subsequent intracellular trafficking to the melanosomes is aberrant.  Significant amounts of melanogenic enzymes including tyrosinase, tyrosine-related protein 1 (Tyrp1; see the record for chi) and dopachrome tautomerase (DCT) are aberrantly secreted from mutant melanocytes in vesicles and immature melanosomes, so that melanin fails to be produced intracellularly in mature melanosomes (12).  Neither the SLC45A2 nor OCA2 proteins seem to be present in early-stage melanosomes, suggesting these transporters function in intracellular trafficking of melanosomal proteins prior to this stage (16).  Slc45a2 expression appears to be indirectly regulated by the key transcriptional regulator of melanocyte development, the microphthalmia transcription factor (MITF).  Overexpression of MITF in melanoma cells results in an increase in Slc45a2 expression, while Slc45a2 expression is absent in MITF-deficient mice (6;8).  MITF is known to regulate the transcription of tyrosinase, Tyrp1, and Dct, as well as kit, which is necessary for melanocyte migration (mutated in Casper and Pretty2) (17).

 
In humans, mutations in SLC45A2 cause oculocutaneous albinism type 4 (OCA4, OMIM #606574), which affects approximately 1/20,000 people worldwide (1;18-20).  Oculocutaneous albinism in humans is a recessive, genetically heterogeneous congenital disorder characterized by decreased or absent pigmentation in the hair, skin, and eyes.  Reduced melanin pigment in the skin and eyes results in an increased sensitivity to ultraviolet radiation, and a predisposition to skin cancer (21).  The reduction of melanin pigment in the eye during development leads to foveal hypoplasia and abnormal routing of the nerve fibers from the eye to the brain, resulting in nystagmus (rapid movements of the eyes), strabismus (lazy eye), reduced visual acuity, and loss of binocular vision (21;22).  Aside from mutations in SLC45A2, OCA is caused by mutations in several genes including tyrosinase (OCA1A, OMIM #203100 and OCA1B, OMIM #606952), tyrosinase-related protein 1 or Tyrp1 (OCA3, OMIM #203290 or red OCA, OMIM #278400), and the OCA2 or P gene (OCA2, OMIM #203200) (1;14;21;23;24).  Tyrp1 has a direct role in melanin synthesis and also stabilizes tyrosinase (10;25;26), while OCA2 is thought to play a role similar to that of SLC45A2 and is important for proper maturation, processing and trafficking of tyrosinase to post-Golgi melanosomes (10;12;14;27).  OCA, amongst other phenotypes, is also characteristic of Hermansky-Pudlak syndrome (OMIM #203300), and Chediak-Higashi syndrome (OMIM #214500).  Mutations in genes associated with these diseases cause a more generalized defect in protein trafficking resulting in defects in lysosome-related organelles including melanosomes (please see toffee, dorian graypam gray, minnie, stamper-coat, bullet gray, sooty, souris, and grey wolf) (28;29).  The range of phenotypes present in OCA4 patients is very similar to that found in OCA2 patients.  Both OCA2 and OCA4 are generally milder than OCA1.
 
Nearly 30 different mutations in the human SLC45A2 gene have been reported (1;18-20;30;31).  Among these, most of the missense mutations are located within or very close to the transmembrane domains, indicating that these areas are critical for the function of the SLC45A2 protein (18-20;31).  Similarly, most of the missense mutations detected in animal models of OCA4 are located within the transmembrane domains of the orthologous SLC45A2 proteins.  For example, the missense mutation D153N found in the cream coat color horse is within the fourth transmembrane domain (32).  The same amino acid change is found in the Uwdbr allele of the mouse, suggesting that this residue is important for SLC45A2 function.  Additionally, the uwd mouse mutation causes a S435P change in the tenth transmembrane domain (1;8).  In medaka fish, four mutations causing hypopigmentation are located within the eighth, ninth, and tenth transmembrane domains (2).  Polymorphisms in the human SLC45A2 gene are significantly associated with skin color variation (33;34).
Putative Mechanism
The cardigan mutation results in truncation of SLC45A2 in the seventh transmembrane domain.  Humans with SLC45A2 mutations causing protein truncation in the seventh or ninth transmembrane domains have very little pigmentation in their skin and eyes (18), much like cardigan homozygotes.  The classical underwhite mutation causes a frameshift and a premature stop codon at amino acid 308 in the seventh transmembrane domain (8).  These mice, like cardigan mutants, are nearly white with dark red eyes (9), and they do not express Slc45a2 mRNA (1). These results suggest that the truncated protein encoded by Slc45a2cardigan would probably not be expressed, resulting in a functionally null allele of Slc45a2.

 

 

 

Genotyping
Cardigan genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.
 
Primers for PCR amplification
Card(F): 5’- TTACTGGAGAGCAGGCACCTAGTC -3’
Card(R): 5’- GCCCCAGATGATGCAGTACCATTC- 3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Card_seq(F): 5’- CTCTGGTTGTCCAATGGAAAC -3’
Card_seq(R): 5’- AGATGATGCAGTACCATTCTCTGG -3’
 
The following sequence of 791 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Slc45a2) is amplified:
 
21057                                                              ttac
21061 tggagagcag gcacctagtc aaaggacagg gagttgaata gcaatctgtg ttagtttcct
21121 aaaacattac tacaaatgta acatccatca atcatcacac agttgtagtg gtcagaagtg
21181 ttggtgggct ctagtggatt ctcagctctg gttgtccaat ggaaaccaac atgtaatgtc
21241 ttatgagaga caagtgacag agacacagtc tggctgtggc tctgactctg actctgctga
21301 tgggtgcgta tctacactga acacctatgt tcttttgcca gagtcagagg acaatgtcga
21361 tgaagtcact ccttcgggca ttagtaaaca tgccttccca ttatcgctgc ctttgcgtca
21421 gccacctgat tggatggact gccttcctgt caaacatgct cttcttcaca gatttcatgg
21481 gacaggtaac ggatgcatat gcccacactc ttgtctggcc tgtgcaatag atatagcaaa
21541 gagtgccctc aagaagctgg tttacagtta cagttcaaga agtaggctgc tacacgctgt
21601 gaaacgaaat atcgtgcact actcaatcaa atacaataaa taaatgtaat caaattcaac
21661 gaatagacaa gagtaggttt gagagctgca gagccgtggc aagcttcatt aaaagcttgc
21721 aacccggtct tgaagggtga gtttcagaga taagagagaa tcctaagtgg aaacaggaat
21781 ggcatgtgct gaggtgagct ggaaggctgt tagctgtgcc agagaatggt actgcatcat
21841 ctggggc
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine, Nora G. Smart
AuthorsAmanda L. Blasius, Bruce Beutler
Edit History
08/25/2011 11:53 AM (current)
01/07/2011 8:56 AM
07/07/2010 8:49 AM
07/07/2010 8:48 AM
02/03/2010 5:33 PM