Phenotypic Mutation 'Dumpling' (pdf version)
AlleleDumpling
Mutation Type missense
Chromosome1
Coordinate137,995,628 bp (GRCm39)
Base Change A ⇒ C (forward strand)
Gene Ptprc
Gene Name protein tyrosine phosphatase receptor type C
Synonym(s) Ly-5, T200, CD45, B220, Lyt-4
Chromosomal Location 137,990,599-138,103,446 bp (-) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001111316 (variant 1), NM_011210 (variant 2), NM_001268286 (variant 3); MGI:1924753

MappedYes 
Amino Acid Change Cysteine changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000138800] [ENSMUSP00000138275] [ENSMUSP00000138350]
AlphaFold P06800
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect noncoding transcript
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: C1018G

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000182283)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: C994G

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000182755)
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: C1157G

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000183301)
Meta Mutation Damage Score 0.5394 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category Unknown
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (ENU)(9) Chemically induced (other)(2) Radiation induced(1) Targeted(7)  Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138011528 splice site probably benign
IGL00486:Ptprc APN 1 138043359 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138041415 missense probably benign 0.00
IGL00833:Ptprc APN 1 138006230 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138041380 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138047911 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138008650 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138027369 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138027219 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 137996148 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 137992497 missense probably damaging 1.00
IGL01820:Ptprc APN 1 137993936 missense probably damaging 1.00
IGL02340:Ptprc APN 1 137998957 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138027251 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138041357 missense probably benign 0.15
IGL03308:Ptprc APN 1 138054058 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138020739 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
Benighted UTSW 1 138054039 critical splice donor site probably null
bletchley UTSW 1 138045600 missense probably benign
Blush UTSW 1 138045458 intron probably benign
bruise UTSW 1 137992509 missense probably damaging 1.00
chor_muang UTSW 1 138041300 critical splice donor site probably null
crystal UTSW 1 137999993 critical splice donor site probably null
fluorescent UTSW 1 138028930 missense probably damaging 0.97
fuchsia UTSW 1 138028779 critical splice donor site probably null
Gentian UTSW 1 137995623 critical splice donor site probably null
guotie UTSW 1 137996139 nonsense probably null
guotie2 UTSW 1 138022037 missense probably damaging 0.97
Guotie3 UTSW 1 138006189 missense possibly damaging 0.92
Gyoza UTSW 1 138011305 missense probably damaging 1.00
Half_measure UTSW 1 137998987 missense probably damaging 0.98
jirisan UTSW 1 138041416 nonsense probably null
mauve UTSW 1 138027423 missense probably benign
Perverse UTSW 1 138028782 missense probably benign 0.02
petechiae UTSW 1 138041446 nonsense probably null
ultra UTSW 1 138006183 critical splice donor site probably null
violaceous UTSW 1 138011377 missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138041297 splice site probably null
R0189:Ptprc UTSW 1 138010453 missense probably benign 0.10
R0390:Ptprc UTSW 1 138050313 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138016435 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138017223 splice site probably benign
R0627:Ptprc UTSW 1 137996058 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138001348 missense probably benign 0.01
R0751:Ptprc UTSW 1 138020668 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138028870 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 137996139 nonsense probably null
R0943:Ptprc UTSW 1 138038902 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138000057 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138000050 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138047824 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138035562 missense probably benign 0.04
R1728:Ptprc UTSW 1 138035561 missense probably benign 0.22
R1728:Ptprc UTSW 1 138027414 missense probably benign 0.05
R1728:Ptprc UTSW 1 138039992 missense possibly damaging 0.53
R1728:Ptprc UTSW 1 138035575 missense probably benign 0.09
R1729:Ptprc UTSW 1 138035561 missense probably benign 0.22
R1729:Ptprc UTSW 1 138027414 missense probably benign 0.05
R1729:Ptprc UTSW 1 138039992 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138035575 missense probably benign 0.09
R1729:Ptprc UTSW 1 138035562 missense probably benign 0.04
R1730:Ptprc UTSW 1 138035575 missense probably benign 0.09
R1730:Ptprc UTSW 1 138039992 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138027414 missense probably benign 0.05
R1730:Ptprc UTSW 1 138035561 missense probably benign 0.22
R1730:Ptprc UTSW 1 138035562 missense probably benign 0.04
R1739:Ptprc UTSW 1 138035575 missense probably benign 0.09
R1739:Ptprc UTSW 1 138039992 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138027414 missense probably benign 0.05
R1739:Ptprc UTSW 1 138035561 missense probably benign 0.22
R1739:Ptprc UTSW 1 138035562 missense probably benign 0.04
R1762:Ptprc UTSW 1 138035575 missense probably benign 0.09
R1762:Ptprc UTSW 1 138039992 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138027414 missense probably benign 0.05
R1762:Ptprc UTSW 1 138035561 missense probably benign 0.22
R1762:Ptprc UTSW 1 138035562 missense probably benign 0.04
R1783:Ptprc UTSW 1 138027414 missense probably benign 0.05
R1783:Ptprc UTSW 1 138035561 missense probably benign 0.22
R1783:Ptprc UTSW 1 138035562 missense probably benign 0.04
R1783:Ptprc UTSW 1 138035575 missense probably benign 0.09
R1783:Ptprc UTSW 1 138039992 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138035575 missense probably benign 0.09
R1784:Ptprc UTSW 1 138039992 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138027414 missense probably benign 0.05
R1784:Ptprc UTSW 1 138035561 missense probably benign 0.22
R1784:Ptprc UTSW 1 138035562 missense probably benign 0.04
R1785:Ptprc UTSW 1 138027414 missense probably benign 0.05
R1785:Ptprc UTSW 1 138035561 missense probably benign 0.22
R1785:Ptprc UTSW 1 138039992 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138035575 missense probably benign 0.09
R1785:Ptprc UTSW 1 138035562 missense probably benign 0.04
R1862:Ptprc UTSW 1 138039965 missense probably benign 0.13
R2145:Ptprc UTSW 1 138001419 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138038926 missense probably benign 0.00
R2403:Ptprc UTSW 1 138016270 missense probably damaging 1.00
R2439:Ptprc UTSW 1 137993890 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138007916 missense probably damaging 1.00
R2906:Ptprc UTSW 1 137992272 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 137992511 missense probably damaging 0.97
R3775:Ptprc UTSW 1 137992511 missense probably damaging 0.97
R3776:Ptprc UTSW 1 137992511 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138011305 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138006254 missense probably damaging 1.00
R4377:Ptprc UTSW 1 137995663 missense probably benign 0.04
R4580:Ptprc UTSW 1 137998989 missense probably benign 0.09
R4923:Ptprc UTSW 1 138006236 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138027235 missense probably benign 0.04
R4937:Ptprc UTSW 1 138017238 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138022037 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138022037 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138017304 missense probably benign 0.07
R5158:Ptprc UTSW 1 138102822 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138045600 missense probably benign
R5593:Ptprc UTSW 1 138045458 intron probably benign
R5689:Ptprc UTSW 1 138045515 missense probably benign 0.01
R5885:Ptprc UTSW 1 138016246 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138028794 missense probably benign 0.09
R6026:Ptprc UTSW 1 137998987 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138028779 critical splice donor site probably null
R6173:Ptprc UTSW 1 137995628 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138041416 nonsense probably null
R6383:Ptprc UTSW 1 138006189 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138011377 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138041300 critical splice donor site probably null
R6520:Ptprc UTSW 1 138007881 nonsense probably null
R6805:Ptprc UTSW 1 137995623 critical splice donor site probably null
R6830:Ptprc UTSW 1 137999993 critical splice donor site probably null
R6847:Ptprc UTSW 1 138016283 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138006183 critical splice donor site probably null
R6995:Ptprc UTSW 1 138016482 missense probably damaging 1.00
R7009:Ptprc UTSW 1 137992291 missense probably damaging 0.97
R7041:Ptprc UTSW 1 138054047 missense probably benign 0.04
R7055:Ptprc UTSW 1 138017309 missense probably damaging 1.00
R7098:Ptprc UTSW 1 138027423 missense probably benign
R7164:Ptprc UTSW 1 138045600 missense probably benign
R7188:Ptprc UTSW 1 137998918 missense probably damaging 1.00
R7191:Ptprc UTSW 1 138028782 missense probably benign 0.02
R7204:Ptprc UTSW 1 138045600 missense probably benign
R7316:Ptprc UTSW 1 137992509 missense probably damaging 1.00
R7644:Ptprc UTSW 1 137995645 missense probably benign 0.01
R7948:Ptprc UTSW 1 137992314 missense probably benign 0.45
R8029:Ptprc UTSW 1 138006197 missense probably damaging 1.00
R8677:Ptprc UTSW 1 138011335 missense probably damaging 1.00
R8704:Ptprc UTSW 1 138043362 missense probably benign 0.34
R8824:Ptprc UTSW 1 138041446 nonsense probably null
R8921:Ptprc UTSW 1 138054039 critical splice donor site probably null
R8998:Ptprc UTSW 1 138028930 missense probably damaging 0.97
R8999:Ptprc UTSW 1 138028930 missense probably damaging 0.97
R9154:Ptprc UTSW 1 138016302 missense probably damaging 1.00
R9388:Ptprc UTSW 1 138011380 missense possibly damaging 0.87
R9428:Ptprc UTSW 1 138041485 missense probably benign 0.01
R9467:Ptprc UTSW 1 137993960 missense probably damaging 1.00
R9468:Ptprc UTSW 1 138044754 missense probably benign 0.01
R9479:Ptprc UTSW 1 138001388 missense probably benign 0.38
R9526:Ptprc UTSW 1 137996111 missense probably benign 0.02
R9632:Ptprc UTSW 1 138008627 missense probably damaging 1.00
R9710:Ptprc UTSW 1 138008627 missense probably damaging 1.00
R9714:Ptprc UTSW 1 138008687 missense probably damaging 1.00
R9777:Ptprc UTSW 1 138047901 missense
Z1177:Ptprc UTSW 1 137995645 missense probably benign 0.01
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:34 PM by Diantha La Vine
Record Created 2018-07-31 8:19 AM by Bruce Beutler
Record Posted 2018-08-01
Phenotypic Description

Figure 1. Dumpling mice exhibit decreased frequencies of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dumpling mice exhibit decreased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Dumpling mice exhibit reduced B220 expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Dumpling phenotype was identified among G3 mice of the pedigree R6173, some of which showed reduced frequencies of B1a cells in B1 cells (Figure 1) and B1b cells (Figure 2) in the peripheral blood. Some mice also showed reduced expression of B220 on peripheral blood B cells (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced B220 expression using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R6173. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ptprc: a T to G transversion at base pair 138,067,890 (v38) on chromosome 1, or base pair 107,867 in the GenBank genomic region NC_000067 encoding Ptprc. The strongest association was found with an additive model of inheritance to the B220 mean fluorescence intensity (MFI) on B cells, wherein 10 variant homozygotes and 23 heterozygous mice departed phenotypically from five homozygous reference mice with a P value of 7.315 x 10-15 (Figure 4).  

The mutation corresponds to residue 3,508 in the mRNA sequence NM_001111316 within exon 31 of 33 total exons, residue 3,189 in the mRNA sequence NM_011210 within exon 28 of 30 total exons, and residue 3,117 in the mRNA sequence NM_001268286 within exon 27 of 29 total exons.

107852 TCCATCCTCGTCCACTGCAGAGATGGATCCCAG

1152   -S--I--L--V--H--C--R--D--G--S--Q-   (NP_001104786; CD45-RABC)

1013   -S--I--L--V--H--C--R--D--G--S--Q-   (NP_035340; CD45-RAB)

989    -S--I--L--V--H--C--R--D--G--S--Q-   (NP_001255215; CD45-RO)

Genomic numbering corresponds to NC_000067. The mutated nucleotide is indicated in red. The mutation results in a cysteine to glycine substitution at position 1,157 (C1157G) in variant 1 of the CD45 protein (PolyPhen score = 1.000), a C1018G substitution in variant 2 (PolyPhen score = 1.000), and a C994G substitution in variant 3 (PolyPhen score = 1.000).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 5. Domain structure of the CD45RABC isoform. The extracellular N-terminal A, B, and C regions are encoded by exons 4, 5, and 6, respectively, and are heavily O-glycosylated. The remainder of the extracelluar domain contains 15 sites for N-glycosylation. The catalytic cysteine (828) is indicated within the PTP D1 domain. The Dumpling mutation is shown in red. Abbreviations: FNIII=Type III fibronectin; TM=Transmembrane domain; PTP=Protein tyrosine phosphatase. This image is interactive. Other mutations found in CD45 are noted in red. Click on the mutations for more specific information.

Ptprc encodes CD45, a receptor-like protein tyrosine phosphatase (PTP) expressed by cells of the immune system. It is known by several names, including T200 (1), B220 for the B cell form (2), the mouse allotypic marker Ly-5 (3), and CD45. CD45 is a type I transmembrane glycoprotein containing a large N-terminal extracellular domain of ~400-500 residues (depending on the expression of several alternative exons, see below), a single transmembrane domain (22 amino acids), and a C-terminal cytoplasmic domain of 707 residues containing tandem PTP domains only one of which is enzymatically active (Figure 5). Following the PTP domains is a 79 residue C-terminal tail. 

Exons 4, 5, and 6 of Ptprc are alternatively spliced to generate three protein isoforms with variations in the most N-terminal domain, furthest from the cell membrane. The three peptides are designated as A, B, and C, respectively. The protein isoforms are commonly named based on the exons included, with the largest isoform (RABC) including all three exons, RAB including exons 4 and 5, etc., and the smallest isoform lacking all three exons designated RO. The D2 domain is a protein tyrosine phosphatase (PTP) domain that is enzymatically inactive, but optimal phosphatase activity in cells requires both the D1 and the D2 domains (4). Within the D2 domain is a unique acidic region of 19 residues that contains multiple sites for serine phosphorylation by casein kinase II (5;6). This modification is important for optimal CD45 phosphatase activity toward a model substrate in vitro and for cellular signaling leading to Ca2+ flux in Jurkat T cells, although the mechanistic basis for these effects is unknown. The D2 domain may also modulate substrate access and localization, as suggested by the interaction of D2 with the CD45 substrate Lck (7).

The Dumpling mutation results in a cysteine to glycine substitution at position 1,157 (C1157G) in variant 1 of CD45; amino acid 1157 is within the D2 domain.

Please see the record for belittle for information about CD45.

Putative Mechanism

The physiological function of CD45 has been examined most extensively in T cells. Studies with CD45-deficient cell lines identified CD45 as an obligate positive regulator of antigen receptor signaling, since T cells lacking CD45 failed to proliferate or produce cytokines in response to TCR stimulation (8;9). CD45 can regulate both the activating and inhibitory tyrosines of Src family kinases.

Ptprc-/- mice have profound defects in thymic development due to dysfunctional signaling through the preTCR and TCR, leading to a block in thymocyte development at β selection and at the DP stage (10-12). As a result, the absolute number of DP thymocytes is reduced twofold, and the number of single positive (SP) thymocytes is reduced five-fold. Peripheral B cell numbers are actually increased in CD45-deficient mice.  CD45 deficiency has less severe consequences for B cells than for T cells. Peripheral B cell numbers are actually increased in CD45-deficient mice (10-12). Marginal zone B cells are increased, while B1 cell production is decreased, and B cell development is blocked at the transitional 2 (T2) to mature follicular B cell transition (13). Humans deficient in CD45 develop severe combined immunodeficiency (SCID) with defects in T and B cell development and function (OMIM #608971) (14;15)

The immune cell phenotype of the Dumpling mice is similar to that of the Ptprc-/- mice suggesting that the Dumpling mutation abrogates CD45 expression. Another ENU-induced Ptprc allele, storm (MGI:4819159), exhibited decreased B cell numbers as well as reduced T cell numbers. The expression and localization of CD45Dumpling have not been examined; however, the phenotype of the Dumpling mice indicates that the Dumpling mice do not express functional CD45.

Primers PCR Primer
Dumpling_pcr_F: TCAAATGATAGGCAGCAGCTACC
Dumpling_pcr_R: CACTTCACCTCGGATTGCAG

Sequencing Primer
Dumpling_seq_F: GCTACCAGCCTAAAAGCCTGG
Dumpling_seq_R: TTGCAGAGGAAGGAGCCC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 400 nucleotides is amplified (chromosome 1, - strand):


1   cacttcacct cggattgcag aggaaggagc ccagaactgt gtaccagtac cagtgtacca
61  catggaaagg ggaagagctg cctgcagaac ccaaagacct ggtgtctatg attcaggacc
121 tcaaacagaa gcttcccaag gcttccccag aagggatgaa gtatcacaag catgcatcca
181 tcctcgtcca ctgcaggtta ggaagctgat ggggtgtact ctaaggttgg aaggctttgt
241 cttcactttt atgaagatgt agatggtgtg ttccagtgaa aatctccatg aagccattca
301 ctctcatgtt atttatatgc agcatgacta taatagtaat ataaacaata aaggttataa
361 agccaggctt ttaggctggt agctgctgcc tatcatttga 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler