Phenotypic Mutation 'Sluggish' (pdf version)
AlleleSluggish
Mutation Type splice acceptor site (5 bp from exon)
Chromosome18
Coordinate4,339,608 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Map3k8
Gene Name mitogen-activated protein kinase kinase kinase 8
Synonym(s) Tpl2, Tpl-2, c-COT, Cot, Cot/Tpl2
Chromosomal Location 4,331,327-4,353,015 bp (-)
MGI Phenotype Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed.
Accession Number

NCBI RefSeq: NM­_007746; MGI: 1346878

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000025078 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 138 385 5.7e-23 PFAM
Pfam:Pkinase 140 388 1.3e-47 PFAM
Blast:STYKc 426 455 N/A BLAST
Phenotypic Category immune system, TLR signaling defect: TNF production by macrophages, TLR signaling defect: type I IFN production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(4) : Targeted, knock-out(3) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Map3k8 APN 18 4334660 missense probably damaging 1.00
IGL02483:Map3k8 APN 18 4349318 utr 5 prime noncoding transcript
IGL03174:Map3k8 APN 18 4349247 missense probably damaging 1.00
Flojo UTSW 18 4339548 missense
gnostic_gospel UTSW 18 4333965 missense probably damaging 1.00
juicy UTSW 18 4339552 missense probably damaging 0.99
R0304:Map3k8 UTSW 18 4339552 missense probably damaging 0.99
R0569:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R1748:Map3k8 UTSW 18 4334766 missense probably damaging 1.00
R1793:Map3k8 UTSW 18 4332389 nonsense probably null
R2310:Map3k8 UTSW 18 4349001 missense probably benign
R3625:Map3k8 UTSW 18 4333965 missense probably damaging 1.00
R4152:Map3k8 UTSW 18 4332312 missense silent
R4786:Map3k8 UTSW 18 4340647 nonsense probably null
R4921:Map3k8 UTSW 18 4349124 missense possibly damaging 0.92
R4930:Map3k8 UTSW 18 4349215 nonsense probably null
R4934:Map3k8 UTSW 18 4339548 missense possibly damaging 0.95
R4956:Map3k8 UTSW 18 4339530 missense probably benign 0.00
R5241:Map3k8 UTSW 18 4340750 missense probably damaging 0.98
R5549:Map3k8 UTSW 18 4340762 missense probably damaging 0.98
Mode of Inheritance Autosomal Semidominant
Local Stock Embryos, Sperm, gDNA
MMRRC Submission 030499-UCD
Last Updated 09/11/2017 5:24 PM by Diantha La Vine
Record Created unknown
Record Posted 06/25/2008
Phenotypic Description
The Sluggish phenotype was identified in a screen of homozygous ENU-induced G3 mutant mice for altered responses to Toll-like receptor (TLR) ligands (see the TLR Signaling Screen) (1).  Peritoneal macrophages from Sluggish homozygotes produced no tumor necrosis factor (TNF)-α in response to the TLR2/6 ligands MALP2 (macrophage-activating lipopeptide 2) and peptidoglycan (PGN), or to the TLR9 ligand CpG DNA.   These macrophages also exhibited a partially reduced TNF-α response to other TLR ligands, such as the TLR4 ligand lipopolysaccharide (LPS), the TLR1/2 ligand Pam3CSK4 (a triacyl lipopeptide), the TLR7 ligand resiquimod (a ssRNA mimetic), and the TLR3 ligand poly I:C (a dsRNA mimetic).  The TNF-α responses to TLR4 and TLR7 are greatly reduced, while the responses to TLR1/2 and TLR3 are intermediate (Figure 1A).  The interferon (IFN) α/β response to TLR7 and TLR9 signaling was abolished as was the production of IL-1β induced by LPS, but the interferon response to LPS and poly I:C was normal. Heterozygous Sluggish animals also displayed defective TNF-α responses to TLR signaling. The defect in the TNF-α response to TLR signaling is likely to be one of post-transcriptional proteolytic processing as normal levels of intracellular TNF-α are observed in MALP2, PGN, and CpG stimulated Sluggish macrophages (Figure 1B). Production of the interleukin 6 (IL-6) cytokine in response PGN, Pam3CSK4 and resiquimod was also impaired in Sluggish macrophages, but IL-12p40 production in response to resiquimod and CpG DNA was increased (Figure 1C).
 
In addition to the induction of genes encoding proinflammatory cytokines, TLR-mediated signaling can induce type I IFN production. TLR3 and 4 primarily elicit IFNβ production through a MyD88-independent pathway (2;3), while TLR7 and TLR9 signal through MyD88 to induce production of type I IFNs primarily in DCs (4-6). Following IFNγ-priming, macrophages are able to induce IFNβ production in response to CpG-B (7;8). In order to examine the effects of the Sluggish mutation on type I IFN production, peritoneal macrophages were pretreated with IFNγ and then challenged with various concentrations of CpG-B or resiquimod, or were exposed directly to LPS or poly(I:C). CpG-B- and resiquimod-induced type I IFN production were significantly reduced in homozygous Sluggish macrophages (Figure 2A), while LPS and poly(I:C)-induced type I IFN production was unaffected (Figure 2B). To examine the effects of the Sluggish mutation on type I IFN from pDCs in vivo, mice were injected with CpG-A intravenously and serum concentration of type I IFN was examined (see the In Vivo CpG Screen). The IFNα production in homozygous Sluggish mice was unaffected. By contrast, IFNγ (type II IFN) was decreased in Sluggish mice (Figure 2C), suggesting that IFNγ production in response to TLR signaling is affected by the Sluggish mutation. Sluggish mice were then infected with 2×105 PFU of MCMV (see the MCMV Susceptibility and Resistance Screen). Sluggish animals were resistant to MCMV similar to C57BL/6J control mice, while highly susceptible STAT1-deficient mice died within four days (Figure 2D) (9). Furthermore, homozygous Sluggish macrophages infected with either GFP-tagged MCMV, GFP-tagged adenoviral vector, or a mouse-adapted human influenza A (PR8 strain) virus were able to control viral infections (Figure 3A) and displayed normal type I IFN production (Figure 3B), although TNF-α production remained impaired (Figure 3C) (see the Ex Vivo Macrophage Screen for Control of Viral Infection).  
 
Because macrophages have a central role in innate immunity, the responses of homozygous Sluggish animals and macrophages to bacterial infection was examined. TNF-α production was severely impaired, but type I IFN production was not significantly different, in response to infection by the intracellular pathogen Listeria monocytogenes in Sluggish macrophages, while macrophages isolated from Myd88poc/poc control mice displayed normal TNF-α production due to the partial preservation of TLR2/TLR6 signaling (Figure 4A) (8)Despite reductions in TNF and IL-6 production relative to wild-type animals, most homozygous Sluggish mice resisted L. monocytogenes infection. By contrast, Myd88poc/poc animals were highly susceptible to infection by L. monocytogenes and displayed a severe reduction in all serum cytokine levels (Figure 4B,C). After infection with 1×106 CFU/ml of the extracellular group B streptococcus (GBS) pathogen, Sluggish homozygous macrophages displayed severely impaired production of both TNF-α and type I IFN (Figure 5A), and most homozygous Sluggish mice died within two days with elevated levels of inflammatory cytokines due to an increased bacterial load in spleen, kidney and blood (Figure 5B-D; data not shown). Surviving Sluggish animals exhibited decreased bacterial loads, which correlated with lower levels of proinflammatory cytokines relative to the susceptible mice. 
 
Sluggish animals display normal natural killer (NK) and T cell cytolytic activities (see the In Vivo NK Cell and CD8+ T Cell Cytotoxicity Screen), and normal B cell antibody responses to alum-precipitated NP-CGG, a T-dependent antigen.
Nature of Mutation
On the basis of 39 meioses, the Sluggish mutation was mapped to Chromosome 18 with a peak LOD score of 11.74 to an 11.9 Mb critical region upstream of Marker D18Mit110 (Figure 6). Sequencing of the candidate gene Map3k8 within this region identified a T to A transversion in the acceptor splice site of intron 4 (TTGCAG -> TAGCAG) at position 13346 of the Map3k8 gene (Genbank genomic region NC_000084 for linear genomic DNA sequence of Map3k8). Three different splice forms caused by the mutation have been observed, one of which is close to the wild type transcript in size.  Two of these splice variants have been sequenced, and are shown below. 
 
The first splice variant results in skipping the 107-nucleotide exon 5 (out of 8 total exons), causing a frame-shift and insertion of 64 aberrant amino acids (corresponding to positions 255-319) before a premature stop codon.  The acceptor splice site of intron 4, which is destroyed by the Sluggish mutation, is shown in blue lettering; the mutated nucleotide is shown in red.
 
        <--exon 4    <--intron 4 exon 5-->  exon 6-->  <--exon 7
12397 GATATTAAAC………CTCGTTGCAGCTAGCAACA………ATATACAT………CGCTGGTGA 18930
252   -D--I--K--             P--S--N--   H--I--H-………-P--R--*  319
       correct                deleted         aberrant
 
The second splice variant results in skipping both exons 4 and 5, which results in in-frame splicing to exon 6. 
 
         <--exon 3    <--exon 4 exon 5--> exon 6-->   <--exon 8
9924 TGCAAACTG………GATATTAAACCTAGCAAC………ATATACATG………TACGGTTGA 20648
166  -C--K--L-   -D--I--K--P--S--N-   -I--Y--M-………-Y--G--*  344       
       correct         deleted                correct
Protein Prediction
The TPL2 (tumor progression locus 2)/COT (cancer Osaka thyroid)/MAP3K8 is a 467-amino acid serine/threonine protein kinase that is a member of the mitogen-activated protein kinase kinase kinase (MAP3K) family of proteins.  Mouse and human TPL2 proteins are 94% identical (10-12).  Murine and human MAP3K8 genes produce two isoforms, of 58 kDa and 52 kDa generated by alternative initiation sites (10;12;13).  The 58 kDa isoform has a shorter half-life than the 52 kDa protein and appears to be the functional isoform (10;13).
 
Figure 7. Domain structure of TPL2 protein and splice variations of the Sluggish mutation. TPL2 is encoded by 8 exons in Chromosome 18. It contains an N-terminal domain, a kinase domain, and a C-terminal region. A PEST sequence was identified between residues 415 and 438. There is a conserved ATP-binding lysine (K167), and phosphorylation of T290 is required for activation. The Sluggish mutation (red asterisk) impairs the acceptor splice site of intron 4 resulting in several transcripts including two aberrantly spliced transcripts.  The first aberrant transcript results in utilizing the acceptor splice site from intron 5, thus skipping exon 5, causing a frameshift, insertion of aberrant amino acids, and creation of a premature stop codon. Truncation of the TPL2 at exon 5 should result in a kinase-inactive protein. The second aberrant transcript results in skipping of both exons 4 and 5, resulting in an in-frame splice from exon 3 to exon 6 and an internal deletion of 123 amino acids.  Exon 4 also encodes a portion of the kinase domain, thus this deletion should also result in a kinase-inactive protein.  The critical T290 necessary for TPL2 activation would be missing in both splice variants. Hashed and gray boxes represent deleted and aberrant exons, respectively.
Full-length TPL2 contains three domains; the N-terminal domain, the kinase domain, and a C-terminal region (Figure 7).  The N-terminal domain consists of residues 1 to 132, and may have a role in regulating protein stability (10).  The kinase domain of TPL2 (amino acids 133-388) shows sequence homology to the kinase domains of other MAP3 kinases (10-12), and more distant homology to all protein kinases, which universally contain a kinase domain with motifs critical for ATP binding, substrate binding and catalysis (14).  These include a conserved ATP-binding lysine (K167 in TPL2) (15), a glycine-rich loop also involved in ATP binding and phosphoryl transfer, the magnesium-binding loop or subdomain VII, the activation loop, and subdomain VIII.  Mutation of many of the conserved residues present in these domains, including the ATP-binding lysine, abolishes kinase activity.  Activation of most protein kinases also requires phosphorylation of a residue in the activation loop (14).  In TPL2, T290 has been shown to be this critical residue (15;16).  Phosphorylation of T290 also promotes the dissociation of TPL2 from nuclear factor kappa-B1 (NFκB1) p105, and is required for the degradation of TPL2 via the proteasome in response to certain signals (see Background) (17).
 
The C-terminus of TPL2 appears both to inhibit TPL2 kinase activity (18-20), and to target the protein for degradation (20;21).  Inhibition is potentially mediated by binding of the C-terminus to the kinase domain (18).  Eliminating amino acids 425-467 resulted in a kinase with higher specific activity (20).  Phosphorylation of a serine near the C-terminus (amino acid 400) also appears necessary for this inhibition, possibly by promoting molecular interactions between the C-terminal domain and the kinase domain (19).  C-terminally truncated TPL2 is also more stable than wild type protein, and a region encompassing residues 435-457 was found to target the protein for proteasome-mediated degradation (20).  Accordingly, a PEST sequence thought to target the protein for proteolytic degradation was identified between residues 415 and 438 (21).
 
The Sluggish mutation impairs the acceptor splice site of intron 4 resulting in several transcripts including two aberrantly spliced transcripts (Figure 7).  The first aberrant transcript results in utilizing the acceptor splice site from intro 5, thus skipping exon 5, causing a frameshift, insertion of aberrant amino acids, and creation of a premature stop codon.  Exons 5 and 6 encode portions of the kinase domain including the critical kinase subdomains VII, VIII and the activation loop.  Truncation of the TPL2 at exon 5 should result in a kinase-inactive protein (14).  The second aberrant transcript results in skipping of both exons 4 and 5, resulting in an in-frame splice from exon 3 to exon 6 and an internal deletion of 123 amino acids.  Exon 4 also encodes a portion of the kinase domain, thus this deletion should also result in a kinase-inactive protein.  The critical T290 necessary for TPL2 activation would be missing in both splice variants.
Expression/Localization
In mice, expression of Map3k8 was observed in many tissues from fetal to adult developmental stages, though the level of expression was low in all tissues examined (11).  Additional experiments using in situ hybridization in adult mice found Map3k8 mRNA to be expressed in four types of exocrine glandular cells; granular duct cells in the submandibular and sublingual glands, serous cells in the parotid gland, peptic (chief) cells in gastric glands, and goblet cells in colonic glands.  In situ hybridization during embryonic day (E) 14 and 18 found that Map3k8 is expressed in only morphologically differentiated and functionally activated cells of these four cell types (22).  In the rat, northern blot analysis of multiple normal rat tissues found Map3k8 mRNA to be primarily expressed in spleen, thymus, liver, and lung.  Lower levels of expression were detected in brain and testis (12).  
 
MAP3K8 mRNA is also expressed at varying levels in human tumors.  Some tumors, including a significant number of breast tumors, displayed high levels of MAP3K8 mRNA (22;23).  TPL2 isoforms are located in the cytosol (10).
Background
Upon binding of specific ligands, the TLRs engage various adaptors including myeloid differentiation (MyD) 88 (see pococurante and lackadaisical), TIRAP for toll-interleukin 1 receptor domain containing adaptor protein (also called MAL for MyD88 adaptor-like) (see torpid), TRIF for Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-β (also known as TICAM-1 for TIR domain-containing adaptor molecule-1) (see Lps2), and TRAM for TRIF related adaptor molecule (also called TICAM-2) (Figure 8) (see Tram KO) (24).  Most TLR signaling is at least partially dependent upon MyD88, operating by itself or in conjunction with TIRAP in the case of TLR 2/1, 2/6 and TLR4 signaling (25-27).  IRAKs (interleukin receptor associated kinases), including IRAK-1 and IRAK-4 (see otiose), are recruited to MyD88, along with interferon-regulatory factor 5 (IRF5) and TNF receptor–associated factor 6 (TRAF6) (28).  IRAK-4 phosphorylates IRAK-1 in this complex (29), allowing for dissociation of IRAK-1 and TRAF6 from the receptor.  TRAF6 undergoes K63 polyubiquitination, which recruits TGF-β–activated kinase (TAK) 1 (or MAP3K7), and TAK1-binding proteins (TAB) 1 and 2 (30).  TAK1 is activated to phosphorylate the IκB kinase (IKK) complex (see panr2) and MAP2K3 and 6.  Phosphorylation of IκB by the IKK complex leads to IκB degradation, allowing NF-κB to translocate into the nucleus and induce genes involved in the inflammatory response (24;31;32).  Activated MAP kinase cascades are responsible for AP-1 and CREB–induced gene expression, and are also involved in post-transcriptional TNF-α regulation mediated through the protein kinases p38 and c-Jun N-terminal kinase (JNK) (33-35).  TLR4 also signals via a MyD88-independent TRIF/TRAM dependent pathway (36;37), which converges with the MyD88/TIRAP pathway at the level of TRAF6 (38).  TLR3 signaling depends upon the TRIF adapter alone.  TRIF triggers a signaling cascade leading to the production of type I IFNs via the IKK-related kinases TANK-binding kinase 1 (TBK1) and IKK-i, and is also capable of activating NF-κB.
 
Figure 3. TPL2 involvement during TLR signaling. Upon binding of specific ligands, the TLRs engage various adaptors including MyD88, TIRAP, TICAM1, and TRAM. Most TLR signaling is at least partially dependent upon MyD88, operating by itself or in conjunction with TIRAP in the case of TLR 2/1, 2/6 and TLR4 signaling. IRAK1 and IRAK4 are recruited to MyD88, along with IRF5 and TRAF6). IRAK4 phosphorylates IRAK1, allowing for dissociation of IRAK1 and TRAF6 from the receptor.  TRAF6 undergoes K63 polyubiquitination, which recruits TAK1, and TAK1-binding proteins TAB1 and 2. Activation of TAK1 leads to activation of MAP kinase cascades and the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, p105, and TPL2, resulting in IκB and p105 ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus and permitting TPL2 to become activated, respectively. Activation of the p38, JNK and ERK1/2 kinases leads to the activation of both CREB and AP1, which in turn induce many target genes. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information. 
The COT oncogene was initially identified from a human thyroid cancer cell line (39).  In the COT oncoprotein, the C-terminal 70 amino acids of normal TPL2/COT are replaced by 18 novel residues resulting in a highly activated kinase (10).  Similarly, in mice and rats, the Tpl2 protooncogene encodes a serine threonine protein kinase that is activated by provirus integration in Moloney murine leukemia virus (MoMuLV)-induced rodent T-cell lymphomas and mouse mammary tumor virus (MMTV)-induced mammary carcinomas (12;18;40).  Provirus integration occurs in the last intron of the gene and gives rise to mRNA transcripts that encode a carboxy-terminally truncated constitutively-active kinase.  Transgenic mice expressing the truncated form of TPL2 in T cells rapidly developed T cell lymphoblastic lymphomas (18).  Overexpression of TPL2 in various cell lines results in activation of factors important in the immune response including JNK, p38, extracellular signal regulated kinase (ERK), as well as the transcription factors, NF-κB and nuclear factor of activate T-cells (NFAT) (41-43).  Activation of these factors by endogenous TPL2 does occur in immune cells, but in a cell-type and stimulus-specific manner (34;44-47).
 
The involvement of TPL2 in TLR signaling was first discovered by analyzing the phenotypes of Tpl2 knockout mice (48).  Tpl2 -/- mice did not display any overt developmental defects, and displayed appropriate numbers and ratios of immune cells.  However, Tpl2 -/- animals were resistant to LPS-induced shock, which was ascribed to low levels of circulating TNF-α.  Tpl2 -/- macrophages were examined for activation of the p38, JNK, ERK and NF-κB in response to LPS, and only ERK activation was found to be affected.  Inhibition of the LPS response and ERK activation in wild type macrophages using a MEK inhibitor suggested that LPS-induced TNF-α induction depended on a TPL2/MEK/ERK kinase cascade.  Deletion of the 3’ AU-rich motif (ARE) of TNF-α mRNA, which negatively regulates mRNA stability and translation (35;49), minimized the effect of Tpl2 inactivation on the induction of TNF-α by LPS in mice.  TPL2-deficient macrophages contained normal levels of TNF-α mRNA, but were found to have a defect in the transport of TNF-α mRNA to the cytoplasm in response to LPS (48).  These results suggest that TPL2 regulates TNF-α mRNA transport, but not stability, through its 3’ARE region.  Interestingly, recent data indicate TPL2 regulates TNF-α post-translationally by regulating the conversion of pre-TNF-α to its secreted form (50) (see Putative Mechanism).  These latter data help reconcile the phenotypes seen in Tpl2 knockout mice carrying an allele of Tnf with a deletion in the 3’ARE.  As described above, these mice regain sensitivity to LPS due to restored levels of circulating TNF-α.  However, the TNF-α-induced Crohn’s-like inflammatory bowel disease (OMIM #266600) caused by the unregulated Tnf allele is ameliorated by TPL2 deficiency (51).  The latter phenotype suggests that TPL2 may play a role downstream of TNF-α signaling, but could also be interpreted as decreased TNF-α secretion due to the post-translational defects caused by loss of TPL2.  This explanation is more consistent with the observed sensitivity of Tpl2 -/- mice to TNF-α injection (48).  However, other data have shown that TPL2 is activated in response to TNF-α signaling in several cell types (47;52).   
 
Subsequently, TPL2 has been shown to activate the MEK/ERK pathway downstream of most TLR signaling (13;44), although this can vary depending on cell type and stimulus (44-46).  Under basal conditions, TPL2 binds to NF-κB1 p105 and the A20 binding inhibitor of NF-kappaB activation (ABIN)-2, where it exists in a stable but inactive state (13;52-55).  Upon TLR stimulation, both p105 and TPL2 are phosphorylated by the IKK complex, resulting in degradation of p105 and the release and activation of TPL2 (56).  Phosphorylation of TPL2 by the IKK complex occurs at T290, and is necessary for both the dissociation of TPL2 from p105, as well as kinase activity (15-17).  Activated TPL2 phosphorylates MEK1/2 (MAP kinase 1 and 2), which then activates ERK1/2 (13;48;53).  Upstream of the IKK complex, TPL2 regulation is less well-defined.  In most cases, it is likely TRAF6-dependent activation of the IKK complex is sufficient for TPL2 activation (45;57).  Indeed, biochemical overexpression experiments have shown that TPL2 can physically interact with TRAF6, suggesting that TPL2, along with its binding partners, is recruited to the TRAF6 complex where it can undergo activation by the IKK complex.  However, this interaction has not been demonstrated in macrophages, suggesting that the interaction may be transient (57).  RNAi knockdown of TRAF6 in macrophages did not prevent LPS-induced TPL2 activation, suggesting that the IκB kinase complex can be stimulated by an unknown factor to activate TPL2 (45). 
 
TPL2 is related to several MAP3Ks in addition to the above-mentioned MAP3K7 protein (also known as TAK1).  The MAP3K14 (also known as NIK, or NF-κB inducing kinase) is required for the biogenesis of secondary lymphoid structures, and is mutated in the Aly mouse, which lacks lymph nodes (see the record for lucky) (58).  NIK signals downstream of the lymphotoxin (LT) β receptor, and is involved in the processing of the p52 NF-κB subunit from its p100 precursor (59).  Although potentially redundant, NIK has also been implicated in NF-κB activation in response to latent membrane protein 1 (LMP1) expressed as a consequence of Epstein-Barr Virus (EBV) infection (60).  TPL2 has been shown to interact with and activate NIK, and is a component of the LMP1-induced NF-kB activation pathway (57;61).  Along with NIK, two other MAP3 kinases, MEKK1 and ASK (also known as MAP3K5), have been shown to interact with TRAF proteins and are implicated in TRAF-dependent signaling pathways (62).
Putative Mechanism
The Sluggish mutation, the first identified point mutation in the Map3k8 gene, is located in the acceptor splice of intron 4 and results in the production of aberrant transcripts. If expressed, these transcripts are predicted to result in proteins lacking critical regions of the TPL2 kinase domain necessary both for post-translational TPLl2 regulation as well as kinase activity (16;17). Since low levels of wild-type transcript are produced in Sluggish animals, it is possible that the Sluggish mutation may permit minimal quantities of functional TPL2 to be synthesized, which could result in a hypomorphic phenotype. For instance, a lack of ERK activation in response to CpG stimulation is observed in Sluggish-/- macrophages (Figure 9), whereas TLR9 signaling in peritoneal macrophages was previously reported to be TPL2-independent (46). However, data in bone marrow-derived macrophages from nfkb1-/- mice, which lack stable TPL2 protein, support our results that activation of ERK in response to CpG stimulation depends on the presence of Tpl2 (44). Furthermore, the Map3k8Sluggishmutant shows a strong phenotypic similarity to the previously reported Map3k8 knockout by displaying a similar impairment of cytokine production in response to TLR signaling [reviewed by (34)]. Due to these phenotypic similarities, it is likely that the Map3k8Sluggish mutation results in a loss-of-function allele. 
 
The studies using Sluggish mice suggest that TPL2 may play an additional role in MyD88-dependent type I IFN production in macrophages. Unlike the general defect seen with TNF-α production in response to TLR signaling in TPL2-deficient mice, TPL2 appears to be required specifically for type I IFN production from IFNγ-primed macrophages in response to CpG-B and resiquimod, while type I IFN production in response to TLR3 and TLR4 remains intact. Although TLR7 and TLR9-induced type I IFN was affected in Sluggish macrophages, TPL2 is not critically required for type I IFN production in response to CpG-A in vivo, suggesting that TPL2 is dispensable for type I IFN production in pDCs (7). As pDCs are important responders and producers of type I IFN in response to some (but not all) viral infections, this may explain why TPL2-deficient mice and macrophages remain resistant and able to produce appropriate amounts of type I IFN in response to all viral infections tested (1;48). It was recently demonstrated that TPL2 negatively regulates IFNβ production in bone marrow-derived macrophages and myeloid dendritic cells in response to both CpG and LPS, while appearing to be necessary for type I IFN production in pDCs in response to CpG (63). These findings apparently contradict the results obtained from Sluggish mice that TPL2 plays a critical role in type I IFN production in response to CpG, but is not necessary for type I IFN production in response to LPS in macrophages or CpG in vivo. However, the type I IFN responses examined in this study occur at a much later time point (24 hours) than the primary responses examined using the Sluggish allele. 
 
Type I IFN signaling is also critical for host defense against a variety of pathogenic bacteria, including GBS, pneumococci, and Escherichia coli (64), and TPL2 is necessary to produce type I IFNs in macrophages in response to GBS. Recently, it was reported that recognition of GBS RNA by TLR7 in conventional DCs activates a MyD88-dependent pathway leading to type I IFN production that is necessary for host response to this disease (5). It is possible that this pathway may depend on intact TPL2 function, and a defect in GBS-induced type I IFN production in homozygous Sluggish animals could partially explain their susceptibility to disease. In addition, macrophages obtained from homozygous Sluggish animals display a profound impairment of TNFα production. This is likely the primary cause for the susceptibility of Sluggish animals to GBS as TNF-α production in response to GBS is critical in controlling the infection. Animals with deficiencies in TLR2 or MyD88, or treated with anti-TNF antibodies, were protected against GBS-induced septic shock under certain conditions, but were unable to control the spread of infection (65;66). In addition, GBS stimulation in human monocytes results in the phosphorylation and activation of various MAPKs, including ERK1/2, which is regulated by TPL2 kinase activity (44;48). Inhibition of MAPK activation resulted in reduced TNF-α production (67)
 
It is likely that TPL2 functions downstream of multiple TLRs, including TLR2, TLR7 and TLR9, to induce TNF-α production in response to GBS. Thus, lack of appropriate TLR signaling in TPL2-deficient mice leads to a deficient early response to GBS infection and causes susceptibility. The existence of high levels of circulating TNF-α in GBS-infected homozygous Sluggish mice presumably reflects signaling through Tpl2-independent pathways, driven by high bacterial loads that result from poor control of bacterial proliferation.
 
A reduction in TNF-α production in both Map3k8Sluggish/Sluggish macrophages and animals also occurs in response to infection with Listeria monocytogenes, although the reduction in animals was noted at an early time point when serum TNF-α levels were very low (Figure 4B). TN-Fα is an important component of the immune response to this pathogen (68;69), but Map3k8Sluggish/Sluggish animals appear resistant to this disease. Previous work suggests that only a small amount of TNF-α may be sufficient to protect animals against this pathogen, although complete inhibition leads to susceptibility (70). Thus, the resistance of Map3k8Sluggish/Sluggish animals to L. monocytogenes infection may be explained by the presence of low TNF-α levels. The Myd88poc mutation, which renders mice highly susceptible to L. monocytogenes, allows normal TNF-α production in macrophages in responses to this bacterium suggesting that factors other than TNF-α are important in the immune response to L. monocytogenes. Interestingly, a recent study examining the susceptibility of Tpl2 knockout mice to L. monocytogenes reports that these animals succumb to infection, but display normal levels of TNF-α following infection (71). The reasons for the discrepant phenotypes seen between Map3k8Sluggish/Sluggish and Map3k8-/- animals are unknown, but raise the possibility that some residual TPL2 function is retained in Map3k8Sluggish/Sluggish mice. 
 
In addition to impairment of type I IFN and TNF-α production, TPL2-deficient mice have significantly reduced levels of IFNγ (type II IFN) in response to CpG stimulation. TNF-α and IFNγ play interconnected roles in the host response to GBS. TNFα released from microbe stimulated macrophages has been shown to be important for IFNγ production, and TNF-α and IFNγ together activate macrophage killing of intracellular bacteria (72;73). Moreover, Tpl2 knockout mice exhibit decreased IFNγ production from T cells and consequent susceptibility to Toxoplasma gondii infection (74). It is possible that the impairment of IFNγ production in TPL2-deficient mice may also contribute to their susceptibility to GBS.
 
Primers Primers cannot be located by automatic search.
Genotyping
Sluggish genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Slug(F): 5’- CAAAACCGTGAGCTTTCCTGCTG -3’
Slug(R): 5’- AGGCACCATGTTACAATCTGTCCG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Slug_seq(F): 5’- ACACTAGGTGGGTTCCTGAC -3’
Slug_seq(R): 5’- TAGGAATGCTCAACTGGTCC -3’
 
The following sequence of 1147 nucleotides (from Genbank genomic region NC_000084 for linear DNA sequence of Map3k8) is amplified:
 
13116                                       caaaa ccgtgagctt tcctgctggc
13141 tgtagctcct agctgcccac actaggtggg ttcctgacag gcctcaggtg ttttcacctg
13201 actgctcccc tacttctctc ttctggggtg aaccacctga gtcattatca gaagcgtttc
13261 cttctgctct gcttggaact tgctgttcta gatgattttc ctgttgggtt aggatgcatt
13321 aactcacatt aaaaacccct ctcgttgcag ctagcaacat tgtattcatg tctacaaaag
13381 ctgttttggt agattttggc ctgagtgtta agatgactga agatgtctat cttcccaagg
13441 acctccgggg aacagaggta attgattgat tgtattggtg atggtctgga aatgctgtga
13501 caatcagcaa tgaaggggac aaaatggcaa cattggatga tcgttgtcac cagaacaaat
13561 tcattttaca ttttaccttt tttactattt ctatgataag actttaaata tgcatggtta
13621 tatttataga tattttttat tactgtttat atatacaaca caaagcactt acagacaatt
13681 cagtgccaaa acagaggacc agttgagcat tcctaatcca aacgtctaaa aagctagaca
13741 agacctagag agaggttgcc aagtaaagtg cttgctacac aagcccaggg acctgagttc
13801 aaatcctgag aacccaaata aagccatgta tggtagacct agtgtgacta tgggtagatc
13861 taagtagaca ggagtcttcc ccaacgctca caggagagta gcctggaata caggactatg
13921 aataagagat cccgcctcaa ggtgggaagt gtcatatgtg cagtgtcgta tatattacac
13981 agacagacag acaaggtgaa aagaaaagcc cataaaaata tcaaatattc caaacatgag
14041 cttctaaatc tgatttttga ttctaagttt ctcaagtaag ggatactcag aattcatctt
14101 taaaactgtt agagaacaat agtcaactta tagttcactt agtaccttaa atgaattatt
14161 tcttccttaa aattattgtg tgtaaatact ggtataacag gcagatgact gctattatcc
14221 tattttataa gaagacaacg gacagattgt aacatggtgc ct
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
 
Sluggish genotyping can also be done by PCR amplification followed by HpyCH4V restriction digest of the amplified region.  The Sluggish mutation removes a HpyCH4V (5'-TG|CA-3') restriction site.
 
Primers
SLGSH_TGCA_F   5’-CTGTTGGGTTAGGATGCGTTAACTCAC -3’
SLGSH_TGCA_R: 5’- AGGCACCATGTTACAATCTGTCCG -3’
 
PCR program
1) 94°C             3:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             0.20
5) repeat steps (2-4) 40X
6) 72°C             7:00
7) 4°C               ∞
 
The following sequence of 127 nucleotides (from Genbank genomic region NC_000084 for linear DNA sequence of Map3k8) is amplified:
 
13301                                             ctgttgggtt aggatgcgtt
13321 aactcacatt aaaaacccct ctcgttgcag ctagcaacat tgtattcatg tctacaaaag
13381 ctgttttggt agattttggc ctgagtgtta agatgactga agatgtc
 
PCR primer binding sites are underlined; the HpyCH4V site destroyed by the Sluggish mutation is highlighted in gray; the mutated T is shown in red text.
 
Restriction Digest
Digest PCR reactions with HpyCH4V at 37 degrees celsius for 2 h. Run on 2% agarose gel with C57BL/6J control.
Products: Sluggish homozygotes- 127 bp (can’t be cut).  Wild type allele- 48 bp + 79 bp. Heterozygotes: 127 bp (mutant allele); 48bp + 79bp (wt allele).
References
62. Wajant, H., Henkler, F., and Scheurich, P. (2001) The TNF-receptor-associated factor family: scaffold molecules for cytokine receptors, kinases and their regulators, Cell Signal. 13, 389-400. 64. Mancuso, G., Midiri, A., Biondo, C., Beninati, C., Zummo, S., Galbo, R., Tomasello, F., Gambuzza, M., Macri, G., Ruggeri, A., Leanderson, T., and Teti, G. (2007) Type I IFN Signaling is Crucial for Host Resistance Against Different Species of Pathogenic Bacteria. J. Immunol. 178, 3126-3133.
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsNengming Xiao, Bruce Beutler
Edit History
02/01/2011 1:51 PM (current)
01/07/2011 9:42 AM
01/05/2011 9:19 AM
06/17/2010 8:42 AM
06/16/2010 4:08 PM
06/16/2010 4:04 PM
06/16/2010 4:04 PM
06/16/2010 4:02 PM
06/16/2010 4:01 PM
06/16/2010 12:25 PM
06/16/2010 12:24 PM
06/07/2010 11:45 AM
06/07/2010 11:44 AM
06/07/2010 11:42 AM
06/07/2010 11:41 AM
02/25/2010 3:11 PM