Phenotypic Mutation 'Poorly2' (pdf version)
AllelePoorly2
Mutation Type missense
Chromosome9
Coordinate71,858,929 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Tcf12
Gene Name transcription factor 12
Synonym(s) HTF-4, ALF1, HEB, bHLHb20, HEBAlt, REB, HTF4, ME1
Chromosomal Location 71,842,688-72,111,871 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011544 (variant 1), NM_001253862 (variant 2), NM_001253863 (variant 3), NM_001253864 (variant 4), NM_001253865 (variant 5); MGI:101877

Mapped Yes 
Amino Acid Change Valine changed to Aspartic acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000034755] [ENSMUSP00000139365] [ENSMUSP00000138978] [ENSMUSP00000139084] [ENSMUSP00000139334] [ENSMUSP00000138832] [ENSMUSP00000139364] [ENSMUSP00000139233] [ENSMUSP00000138925]
SMART Domains Protein: ENSMUSP00000034755
Gene: ENSMUSG00000032228
AA Change: V474D

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
(Using ENSMUST00000034755)
SMART Domains Protein: ENSMUSP00000139365
Gene: ENSMUSG00000032228
AA Change: V498D

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
(Using ENSMUST00000183404)
SMART Domains Protein: ENSMUSP00000138978
Gene: ENSMUSG00000032228
AA Change: V328D

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
low complexity region 182 193 N/A INTRINSIC
low complexity region 388 402 N/A INTRINSIC
HLH 437 490 7.54e-10 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
(Using ENSMUST00000183918)
SMART Domains Protein: ENSMUSP00000139084
Gene: ENSMUSG00000032228
AA Change: V474D

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 5e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000183992)
SMART Domains Protein: ENSMUSP00000139334
Gene: ENSMUSG00000032228
AA Change: V304D

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
low complexity region 182 193 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
HLH 413 466 7.54e-10 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
(Using ENSMUST00000184448)
SMART Domains Protein: ENSMUSP00000138832
Gene: ENSMUSG00000032228
AA Change: V494D

DomainStartEndE-ValueType
PDB:4JOL|H 173 196 6e-8 PDB
low complexity region 204 215 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 348 359 N/A INTRINSIC
low complexity region 554 568 N/A INTRINSIC
HLH 603 656 7.54e-10 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
(Using ENSMUST00000184523)
SMART Domains Protein: ENSMUSP00000139364
Gene: ENSMUSG00000032228
AA Change: V498D

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
(Using ENSMUST00000184783)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000138925
Gene: ENSMUSG00000032228
AA Change: V474D

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 534 548 N/A INTRINSIC
HLH 583 636 7.54e-10 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
(Using ENSMUST00000185117)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4:CD8 - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(40) : Chemically induced (other)(1) Endonuclease-mediated(1) Gene trapped(35) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Tcf12 APN 9 71868118 missense probably damaging 0.98
IGL01311:Tcf12 APN 9 71858656 splice site probably benign
IGL01734:Tcf12 APN 9 71922648 splice site probably null
IGL01768:Tcf12 APN 9 71868996 splice site probably null
IGL02625:Tcf12 APN 9 71922757 missense probably damaging 1.00
IGL02671:Tcf12 APN 9 72109717 missense probably damaging 1.00
IGL03395:Tcf12 APN 9 71876022 missense probably damaging 1.00
Poorly UTSW 9 71944016 nonsense probably null
Poorly3 UTSW 9 72015636 critical splice donor site probably null
Substandard UTSW 9 71858840 missense probably null 0.54
R0183:Tcf12 UTSW 9 71917027 missense probably damaging 0.99
R0257:Tcf12 UTSW 9 71858622 missense probably benign 0.05
R1126:Tcf12 UTSW 9 72000433 missense probably benign 0.09
R1520:Tcf12 UTSW 9 71883106 critical splice donor site probably null
R1690:Tcf12 UTSW 9 71870072 critical splice donor site probably null
R1819:Tcf12 UTSW 9 72109717 missense probably damaging 1.00
R1850:Tcf12 UTSW 9 71868215 missense probably damaging 1.00
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R2402:Tcf12 UTSW 9 71856510 missense probably damaging 1.00
R4445:Tcf12 UTSW 9 71869063 missense probably damaging 0.99
R4693:Tcf12 UTSW 9 71868967 intron probably benign
R4814:Tcf12 UTSW 9 71870041 intron probably benign
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4885:Tcf12 UTSW 9 71858840 missense probably null 0.54
R5347:Tcf12 UTSW 9 71885243 missense probably damaging 1.00
R5422:Tcf12 UTSW 9 71869038 missense probably damaging 1.00
R5650:Tcf12 UTSW 9 71885302 splice site probably null
R5713:Tcf12 UTSW 9 71885263 makesense probably null
R5789:Tcf12 UTSW 9 71885236 missense probably damaging 1.00
R5964:Tcf12 UTSW 9 71868240 missense probably damaging 1.00
R6012:Tcf12 UTSW 9 71858947 missense possibly damaging 0.62
R6119:Tcf12 UTSW 9 71868265 missense probably damaging 1.00
R6240:Tcf12 UTSW 9 71944016 nonsense probably null
R6299:Tcf12 UTSW 9 71858929 missense probably damaging 1.00
R6449:Tcf12 UTSW 9 71868268 missense probably damaging 1.00
R6489:Tcf12 UTSW 9 72015636 critical splice donor site probably null
R6984:Tcf12 UTSW 9 72006759 nonsense probably null
X0021:Tcf12 UTSW 9 71883172 missense probably damaging 0.99
X0022:Tcf12 UTSW 9 72109743 missense probably damaging 0.99
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-02-12 11:50 AM by Diantha La Vine
Record Created 2018-09-06 12:45 AM by Bruce Beutler
Record Posted 2018-12-05
Phenotypic Description
Figure 1. Poorly2 mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Poorly2 mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Poorly2 mice exhibit decreased frequencies of peripheral naïve CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Poorly2 mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Poorly2 mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Poorly2 phenotype was identified among G3 mice of the pedigree R6299, some of which showed reduced CD4 to CD8 T cell ratios (Figure 1) due to reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 2) and naïve CD4 T cells in CD4 T cells (Figure 3) with concomitant increased frequencies of CD8+ T cells in CD3+ T cells (Figure 4) and effector memory CD4 T cells in CD4 T cells (Figure 5), all in the peripheral blood.

Nature of Mutation

Figure 6. Linkage mapping of the increased effector memory CD4 T cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R6299. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tcf12:  a T to A transversion at base pair 71,858,929 (v38) on chromosome 9, or base pair 252,891 in the GenBank genomic region NC_000075. The strongest association was found with an additive model of inheritance, wherein four homozygotes and 16 heterozygous mice departed phenotypically from 16 homozygous reference mice with a P value of 1.833 x 10-8 (Figure 6).  

 

The mutation corresponds to residue 1,759 in the mRNA sequence NM_011544 within exon 17 of 21 total exons.

 

1743 CATCGGGAAGATTCAGTCAGTCTCAATGGCAAT

493  -H--R--E--D--S--V--S--L--N--G--N-

 

The mutated nucleotide is indicated in red. The mutation results in a valine to aspartic acid substitution at residue 498 (V498D) in the HEB protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.996).

Protein Prediction
Figure 7. Domain organization of HEB. The Poorly2 mutation results in a valine to aspartic acid substitution at residue 498. Click on other mutations to view additional information. Abbreviations: AD1, activation domain 1; AD2, activation domain 2; bHLH, basic helix-loop-helix.

Tcf12 encodes HeLa E-box binding protein (HEB; alternatively, helix-loop-helix transcription factor-4 [HTF4] or ME1), a member of the class I basic helix-loop-helix (bHLH) transcription factor family. Class I bHLH transcription factors recognize the E box (sequence: CANNTG) in target DNA and are designated as E proteins. E proteins have several similar domains, including a C-terminal bHLH domain and two transcriptional activation domains (AD1 and AD2) [Figure 7; (1); reviewed in (2)]. HEB also has a leucine zipper. The bHLH domains facilitate the dimerization of bHLH proteins, which is required for their transcriptional activity [reviewed in (2)]. The bHLH domain also facilitates interaction with p300, a component of the transcriptional machinery (3). P300 subsequently recruits histone acetyltransferases and RNA polymerase II to the promoter or enhancers of target genes. The AD1 domain recruits the SAGA chromatin remodeling complex as well as the CBP and p300 histone acetyltransferases (4). The AD1 domain also represses transcription by recruiting a family of corepressors called ETO (5). The AD2 domain can drive the expression of reporter constructs containing bHLH target genes (4).

 

TCF12 has two transcription start sites and undergoes alternatively splicing to produce a shorter HEB variant, HEBalt (6). HEBalt lacks the AD1 domain, but shares the AD2 and bHLH domain with canonical HEB. HEBAlt has a unique domain, the Alt domain, upstream of AD2 compared to canonical HEB. HEBalt is expressed in pro-T cells and enhances the generation of T cell precursors. TCF12 also has two alternative acceptor sites preceding the second exon, which produces two distinct transcripts, HTF4a and HTF4b (7). HTF4a and HTF4b differ in their 5’-UTR, but share identical coding sequences. A cell-type specific protein, HTF4c, is produced by differential utilization of exon 15.

 

The Poorly2 mutation results in a valine to aspartic acid substitution at residue 498 in the HEB protein; Val498 is within an undefined region between the AD2 and bHLH domains.

 

Please see the record Poorly for more information about Tcf12.

Putative Mechanism

HEB and another E protein, E2A, regulate lymphocyte development and differentiation. E2A and HEB form homo- or heterodimers to activate the transcription of target genes. E2A homodimers are essential for B cell development, while E2A-HEB heterodimers are essential for T cell development (8). E2A and HEB cooperate to maintain DP T cell fate and to control the DP to SP transition until a functional alphabetaTCR is produced (9;10). HEB functions in TCRα and TCRβ gene rearrangement (11;12) as well as in the regulation of pTα (10;13;14) and CD4 (8) gene expression. HEB also putatively assists in the downregulation of IL7R signaling after β-selection. HEB is required for the development of CD73+ and CD73 γδT17 cells in the fetal thymus (15). In addition HEB is required for the expression of Sox4, Sox13, and Rorc in immature CD24+CD73 γδ T cells (15). HEB interacts with Notch1 and GATA3 to regulate T cell fate choice in developing thymocytes (16). HEB-deficient T cell precursors show compromised Notch1 function and lose T cell potential. After reconstitution of the HEB-deficient T cell precursors with Notch1, the cells adopted a DN1-like phenotype and could be induced to differentiate into thymic NK cells.

 

Tcf12-deficient (Tcf12-/-) mice on the 129/Sv * C57BL/6 genetic background exhibited postnatal lethality within two weeks of birth (17). Tcf12-/- mice showed a 50 percent reduction in the number of pro-B cells (17). Tcf12-/- mice on the 129S7/SvEvBrd genetic background showed reduced thymocyte numbers due to a block in T cell development at the immature single positive stage (18). Tcf12-/- mice on the 129S7/SvEvBrd * C57BL/6J genetic background showed thymus hypoplasia, increased numbers of double-negative T cells and CD8+ T cells with a concomitant reduction in the number of double-positive T cells (19). A Tcf12 mutant (HEBbm/bm) mouse with point mutations within the basic DNA-binding region (R611G, L612H, R613G) showed postnatal lethality within two weeks of birth and postnatal growth retardation (18). Some fetuses showed exencephaly. The HEBbm/bm mice also showed thymus hypoplasia; reduced thymocyte numbers; impaired B cell differentiation with reduced immature B cell, pro-B cell, and pre-B cell numbers; and aberrant T cell differentiation (i.e., severe block at the DN3 stage of T-cell development) with increased double-negative T cell number, reduced double-positive T cell number, and loss of single-positive T cells in the thymus (18). Approximately 10 to 20 percent of HEBbm/+ mice showed seizure episodes upon handling by the tail (18).

 

The phenotypes observed in the Poorly2 mice indicate loss of HEB-associated function in T cell development.

Primers PCR Primer
Poorly2(F):5'- CTTCTGGAGGCAAGGGAAAGTC -3'
Poorly2(R):5'- TGTTCACCAAAATTCGGAAAGAGTG -3'

Sequencing Primer
Poorly2_seq(F):5'- GGGAAAGTCTGTTATGTAGACCC -3'
Poorly2_seq(R):5'- CCTGTAATCCTGGCTATTCAGAAGAC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler