Phenotypic Mutation 'daniel_gray'

• Allele: daniel_gray
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 45,531,045 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Kdelr1
• Gene Name: KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
• Synonym(s): 8030486F04Rik
• Chromosomal Location: 45,522,264-45,533,150 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, which is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. The protein encoded by this gene was the first member of the family to be identified, and it encodes a protein structurally and functionally similar to the yeast ERD2 gene product. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for an ENU-induced single point mutation display thymus hypoplasia and a reduction in CD4+ as well as CD8+ T cell numbers. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 47494518 - 58800764 bp
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q99JH8
• SMART Domains: Protein: ENSMUSP00000002855; Gene: ENSMUSG00000002778; AA Change: Y158C

Domain	Start	End	E-Value	Type
low complexity region	7	23	N/A	INTRINSIC
Pfam:ER_lumen_recept	28	169	7.5e-58	PFAM
transmembrane domain	178	200	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000002855)
• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000211234)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9750
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 034372-JAX
• Last Updated: 2019-04-19 3:35 PM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2015-10-08
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Owen M. Siggs, Daniel Popkin, Philippe Krebs, Xiaohong Li, Xiaoming Zhan, Ming Zeng, Yu Xia, Bruce Beutler

Accession Number

NCBI RefSeq: NM_133950; MGI: 1915387

Alleles Listed at MGI

All mutations/alleles(7) : Chemically induced (ENU)(1) Gene trapped(4) Targeted(2)

Phenotypic Description

Figure 1. An inherited phenotype associated with expansion of CD44 hi T cells. (A) Flow cytometry plots of CD44 expression on CD4 + and CD8 + blood lymphocytes (left) and frequencies of CD44 hi cells in either population (right). P values determined by unpaired t-test. (B) Frequencies of CD44 hi cells amongst CD4 + and CD8 + populations as a function of age. Each symbol represents an individual mouse. Data are representative of one (B), or more than ten (A) experiments (error bars, s.e.m.). Figure obtained from ( 1 ).

Figure 2. Kdelr1 mutation is causative for daniel gray phenotype. (A) Schematic of the Cas9/sgRNA targeting site at the Kdelr1 locus. Boxes indicate exons, with dark shading indicating protein-coding sequence. The sgRNA targeting sequence is underlined, and the protospacer-adjacent motif (PAM) labeled in red. (B) Frequencies and CD44 mean fluorescence intensity (MFI) of CD4 + and CD8 + blood lymphocytes, including those from a CRISPR/Cas9 engineered mutant of Kdelr1 (U2077). CRISPR WT mice represent non-mutant littermates of U2077. (C) Frequencies and CD44 MFI of CD4 + and CD8 + blood lymphocytes, including those from daniel gray mice with a wild-type Kdelr1 transgene (Tg(Kdelr1)). P values calculated by unpaired t test. Each symbol in (B) and (C) represents an individual mouse (error bars, s.e.m.). Figure obtained from ( 1 ).

Figure 3. Compromised lymphocyte development. Frequencies and absolute numbers of T, B and NK subset were measured in thymus (A) and spleen (B,C,D) by flow cytometry. Thymic subsets were gated as: DN (CD4-CD8α-), DP (CD4+CD8α+ ), CD4SP (CD4+CD8α- ), and CD8SP (CD4-CD8α+ ). Splenic subsets were: T1 (B220+CD93+CD23- ),T2 (B220+CD93+CD23+ ), Fo (follicular; B220+CD23+ CD21/35int ), MZ (marginal zone; B220+CD23-CD21/35hi ), NK (NK1.1+CD3ε-) and NKT (NK1.1+CD3ε+). Asterisks represent P values less than 0.05, as determined by unpaired t-test. Data are representative of two experiments, with three mice per genotype (error bars, s.e.m.). Figure obtained from ( 1 ).

Figure 4. Kdelr1 is required to control chronic viral infection. Mice were infected intravenously with 1x106 PFU of LCMV Clone 13, and viral titers in the blood were measured at 4, 11, 26, and 53 days after infection. ffu, focus-forming units; *, P=0.005 (Mann Whitney test at day 53). Dashed line at Y=102 indicates the assay detection limit of 100 ffu/mL, which was used to calculate the proportion of mice with detectable viremia. Data are representative of two experiments, with 2-13 mice per group (error bars, s.e.m.). Figure obtained from ( 1 ).

The daniel gray phenotype was initially identified among G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU), some of which exhibited increased frequencies of CD8⁺CD44^hi and CD8⁺CD44^hi cells in the peripheral blood (Figure 1A) (1). CD44^hi T cell frequency increased with age in homozygous daniel gray mice compared to that in age-matched wild-type mice (Figure 1B) (1). A CRISPR/Cas9-induced Kdelr1 null mouse exhibited comparable T lymphopenia and increased CD44 expression to daniel gray homozygotes (Figure 2b). Transgenic expression of wild-type Kdelr1 in homozygous daniel gray mice resulted in higher frequencies of CD4⁺ cells, but not a correction of the CD44^hi phenotype (Figure 2c). T cell development in the thymus was impaired in the daniel gray homozygotes, leading to a reduction in single positive CD4 and CD8 cells in the thymus (Figure 3A) and spleen (Figure 3B). Homozygotes also exhibited a reduction of the frequency of splenic transitional and follicular B cells, but an increased frequency of marginal zone B cells (Figure 3C). The frequency of splenic natural killer T cells in the homozygotes was also reduced (Figure 3D).  The surface expression of the T cell receptor (TCR) complex subunits CD3ε and TCRβ are reduced roughly two-fold on all T cells. Analysis of the defect using bone marrow chimeras demonstrated that the defect was T cell-intrinsic. The T cell phenotypes cannot be rescued by transgenic overexpression of the potent antiapoptotic protein, BCL2 (2). Since fewer developing T cells are found in the thymus, it is possible that the reduced numbers of peripheral T cells are due to a developmental rather than a cell survival defect.

Macrophages from homozygous daniel gray animals have been tested for responses to toll-like receptor (TLR) ligands (TLR Signaling Screen) and double-stranded DNA (Double-stranded DNA Macrophage Screen), and were found to produce normal amounts of tumor necrosis factor (TNF)-α and type I interferon (IFN) in response to these stimuli. These mice were not susceptible to low doses of dextran sodium-induced colitis (DSS-induced Colitis Screen), mouse cytolomegalovirus (MCMV; MCMV Susceptibility and Resistance Screen), or to Listeria monoctyogenes, and they displayed normal antibody responses to both T-dependent and T-independent model antigens. Both male and female daniel gray animals are fertile. Homozygous daniel gray mice exhibited susceptibility to persistent infection with the Armstrong strain of lymphochoriomeningitis virus (LCMV) (Figure 4).

Nature of Mutation

Figure 5. DNA sequencing trace .

The daniel gray phenotype was mapped to chromosome 7 by backcrossing F1 offspring from crosses of daniel gray and C3H animals. Partial sequencing of the coding regions present in the critical region did not uncover a mutation. Subsequently, whole genome sequencing of a homozygous daniel gray mouse using the SOLiD technique identified an A to G transition at position 45,881,621 (GRCm38) in the Genbank genomic region NC_000073 for the Kdelr1 gene on chromosome 7. The mutation was confirmed using standard Sanger sequencing (Figure 5), and corresponds to nucleotide 644 of the Kdelr1 transcript in exon 4 of 5 total exons.

 

628 TTTGCACTGGGTGTCTACCGTACACTCTATCTC

153 -F--A--L--G--V--Y--R--T--L--Y--L-

 

The mutated nucleotide is indicated in red lettering, and results in a tyrosine to cysteine substitution at amino acid 158 of the KDELR1 protein, and is predicted to be ‘probably damaging’ by PolyPhen-2 (score of 0.996).

Protein Prediction

Figure 6. Protein domains of KDELR1. KDELR1 is a 212 amino acid protein that contains seven transmembrane domains (TMDs) at amino acids 3-21, 36-53, 62-80, 97-110, 118-137, 150-168, 179-199. D193 located in the seventh TMD is necessary for retrograde transport of the receptor from the Golgi back to the ER. The ligand-binding pocket of KDELR1 was further defined with the identification of four amino acid residues: R5, D50, Y162 and N165. The daniel gray mutation causes a tyrosine to cysteine substitution at amino acid 158.

The Kdelr1 gene encodes the 212 amino acid KDEL receptor 1 (KDELR1) protein that is a homologue of ERD2 (ER-retention defective 2), an integral membrane protein first identified in yeast (Figure 6) (3). ERD2 recognizes and interacts with C-terminal tetrapeptide motifs present in endoplasmic reticulum (ER)-resident proteins and plays a critical role in the retention of these proteins in the ER (4;5). The ER-retention motif is often KDEL in mammalian cells and HDEL in yeast, but nearly 60 variations of this motif have also been found on ER proteins and can be recognized by ERD2/KDELR (3;6). Three KDELRs are encoded in the mammalian genome: KDELR1, KDELR2, and two alternatively spliced isoforms of KDELR3 (6-8). KDELR1 displays 83.5% identity with KDELR2 and between 65 and 72% identity with the KDELR3 isoforms. The mammalian KDELR1 protein retains 50% identity with the yeast homologue (7), suggesting that strong evolutionary pressure was applied to this gene to preserve its function from yeast to human. The KDELRs preferentially bind to slightly different sets of KDEL-like sequences, with both KDELR1 and KDELR3 having broad specificity while KDELR2 is more specific and favors sequences containing HXEL (6).

KDELR1 contains seven transmembrane domains (TMDs) at amino acids 3-21, 36-53, 62-80, 97-110, 118-137, 150-168, 179-199 with the N-terminal two amino acids located in the lumen of organelles and a short cytoplasmic tail (9;10). Mutational analysis of human KDELR1 revealed the importance of different parts of the protein. In general, mutations in the cytoplasmic loops affect transport between the ER and the Golgi, but do not affect ligand binding. Mutations in the luminal regions or in the transmembrane regions adjacent to the lumen generally altered ligand binding, but not the trafficking of the receptor. D193 located in the seventh TMD does not affect ligand binding, but is necessary for retrograde transport of the receptor from the Golgi back to the ER (9). KDELR1 protein containing this mutation can act as a dominant-negative in transfected cells (11). The ligand-binding pocket of KDELR1 was further defined with the identification of four amino acid residues: R5, D50, Y162 and N165. These conserved amino acids lie in the first, second, and sixth TMDs. Mutation of D50 impaired the binding of KDEL, HDEL, and RDEL-containing peptides, but not the binding of DDEL. This suggested that D50 is involved in mediating the ligand specificity of KDELR1 by interacting with the fourth amino acid from the C-terminal end of KDEL-like motifs (10). Another report found that KDEL-like motifs efficiently bound to peptides containing amino acids 22-25 of KDELR1 (KWIK), but as this sequence is predicted to be in the first cytoplasmic loop, the physiological significance of this is unclear (12).

The seven transmembrane-domain structure of KDELRs is similar to receptors belonging to the G-protein coupled receptor (GPCR) family, although KDELRs do not contain any sequence homology to these proteins (10). Like KDELRs, GPCRs also contain ligand-binding sites formed from charged amino acids. The binding of ligands to GPCRs induces conformational changes, including phosphorylation and dimerization in some cases, which leads to the activation of heterotrimeric guanine nucleotide-binding (G) proteins on the cytoplasmic side of the membrane and signal transduction (13). Similarly, KDELR1 has been shown to oligomerize upon binding to KDEL-like motifs and to recruit a GTPase-activating protein (GAP) to the Golgi membrane. The KDELR1/GAP complex then associates with the GTPase ADP-ribosylation factor 1 (ARF1) resulting in the inclusion of KDELR1 and bound proteins into coat protein complex I (COPI) vesicles (14-17). Protein kinase A (PKA)-mediated phosphorylation of the KDELR1 C-terminal domain on S209 promotes the interaction with ARFGAP and COPI proteins. Mutation of this residue to an alanine abrogated KDELR1 transport from the Golgi to the ER, as did the mutation of a di-lysine motif located at amino acids 206 and 207 (18). Di-lysine motifs at the C-terminal end of membrane proteins are often involved in COPI interactions and retrieval back to the ER (19-21). The cycling of KDELR1 from Golgi to the ER and back again is reminiscent of the regulation and internalization of GPCRs. Like GPCRs, ligand-bound KDELR1 is able to interact with and activate Src family kinases (SFKs) (11;22). Direct binding of the KDELR1 C-terminal domain (residues 183-212) to Src was demonstrated using a yeast two-hybrid assay (11).

In addition to the interactions mentioned above, KDELR1 associates with other proteins necessary for protein trafficking including the p24 family of Golgi/ER transmembrane proteins (components of the ARF1 complex) (17), and several SNARE [SNAP (soluble NSF attachment protein) receptor] complex] proteins, which mediate vesicle fusion with the cell membrane or with target compartments. These proteins include mSec22b, mUse1, and mSec20/BNIP1 (23;24). The yeast KDELR has also been shown to physically interact with cell membrane permeases, a cell membrane glucanosyltransferase (GAS3), a subunit of the signal peptide recognition system (SPC1), a protein involved in the formation of GPI anchors in the membrane (GP18), and a protein involved in ergosterol synthesis (ERG25) (25). A mass-spectrometry-based study found that mammalian KDELR1 associates with Serinc3 (serine incorporator 3), a protein involved in the metabolism of serine at the plasma membrane; BZW1 (basic leucine zipper and W2 domain-containing protein 1), a putative transcription factor; NEK6, a serine/threonine kinase involved in mitosis; and WBP5 (WW domain binding protein 5), which has an unknown function (26). The significance of these interactions remains unknown. 

The daniel gray mutation results in a tyrosine to cysteine change in the sixth TMD of KDELR1.

Expression/Localization

All three of the KDEL receptors are expressed in all human tissues, although to different extents. The KDELR1 gene is generally transcribed at higher levels than KDELR2, which in turn displays more expression than KDELR3 (6). 

Roughly half of COS cells transfected with epitope-tagged KDELR1, expressed the receptor in a juxtanuclear, Golgi-like pattern, while the remainder showed a reticular, ER-like pattern with nuclear envelope staining (27). Electron microscopy of different tissues including mouse spermatids, rat pancreas, and various cell lines revealed that the KDELR1 protein is concentrated in the intermediate compartment between the ER and Golgi, as well as in the Golgi stack. Lower but significant labeling was detected in the rough ER. Only small amounts of the receptor were detected on the trans side of the Golgi stack, including the trans-Golgi network (TGN) of normal cells and tissues. Under conditions of stress including infection with vaccinia virus or vesicular stomatitis virus and changes in temperature, KDELR1 localization shifts towards the trans-TGN side of the Golgi stack (28). KDELR1 can also be detected in COPI vesicles (27;28), which mediate retrograde Golgi to ER transport. Overexpression of KDELR1 ligands in cells results in KDELR1 redistribution from the Golgi to the ER, suggesting that ligand binding induces transport of KDELR1 and associated proteins back to the ER (5).

Background

Figure 7. KDELR in vesicle trafficking. Newly synthesized proteins enter the ER and move on to the Golgi, where they are modified prior to being distributed through the secretory pathway to their final location. These newly synthesized proteins are folded into their proper conformation with the aid of ER-resident proteins known as chaperones. Chaperones often leave the ER and enter the Golgi along with their substrates via COPII vesicles. The COPII coat assembles by the stepwise deposition of Sar1p∙GTP, Sec23p∙Sec24p, and Sec13p∙Sec31p at ER exit sites.  Cytosolic Sar1p∙GDP is converted to membrane bound Sar1p∙GTP by the transmembrane GEF Sec12p.  Sar1p∙GTP then recruits the Sec23p∙Sec24p subcomplex by binding to Sec23p. Transmembrane cargo proteins are concentrated in COPII-coated buds by binding to Sec24p using a variety of ER export signals. Sec13p∙Sec31p polymerizes onto Sec23p∙Sec24p to form a mesh-like scaffold Yip1p may promote the process of vesicle budding by interacting with Sec13p, Sec31p, Sec23p, or Sec24p.  As COPII vesicles travel towards the Golgi, they are thought to become uncoated. Once inside the Golgi, the retrieval of chaperones back to the ER is dependent upon the recognition of C-terminal KDEL-like motifs by KDEL receptors, and subsequent transportation in COPI vesicles. During COPI vesicle formation, coat proteins are recruited from the cytosol to the Golgi membrane as ARF1-GDP binds with p23. GBF1 activates ARF1 by promoting nucleotide exchange. ARF1-GTP then dissociates from p23 and stablizes on the membrane. ARF1-GTP then associates with p23/p24 heterooligomers, recruiting the coatomer from the cytosol to the Golgi membrane. Coatomer and ARFGAP1 act as coat proteins and drive the budding and fission stages of vesicle formation. ARFGAP also drives inactivation of ARF1 by the hydrolysis of GTP to GDP, causing the vesicles to become uncoated at their target. The fission stage requires the catalyzation of PC to PA by PLD2. BARS and PA can then associate, promoting fission of the vesicle. Ligand-bound KDELR1 is able to associate with ARFGAP1. Retrograde transport of KDELR is also dependent on the motor protein, kinesin-2, and may be modulated by Src activity as overexpression of activated Src relocated KDELR1 from the Golgi to the ER. Under the more neutral conditions in the ER, the chaperones are released from the receptor.

Newly synthesized proteins enter the ER and move on to the Golgi, where they are modified prior to being distributed through the secretory pathway to their final location (Figure 7). These newly synthesized proteins are folded into their proper conformation with the aid of ER-resident proteins known as chaperones. As chaperones often leave the ER and enter the Golgi along with their substrates, the retrieval of chaperones back to the ER is dependent upon the recognition of C-terminal KDEL-like motifs by KDEL receptors, and subsequent transportation in COPI vesicles (27;28). As described above, ligand-bound KDELR1 is able to associate with the machinery required for COPI vesicle budding from the Golgi membrane. Activation of ARF1 by its binding to GTP recruits COPI from the cytosol to the membrane (29), while ARF1 inactivation by the hydrolysis of GTP to GDP (catalyzed by ARFGAP) is required for the inclusion of cargo during the budding of COP1-coated vesicles (30;31) as well as the uncoating of COP1 vesicles near the target membrane (32). Retrograde transport of KDELR1 is also dependent on the motor protein, kinesin-2 (33), and may be modulated by Src activity as overexpression of activated Src relocated KDELR1 from the Golgi to the ER (34). The affinity of the KDELR for KDEL ligands is dependent on pH with stronger binding occurring under acidic conditions. This suggests that the binding of ER-resident proteins to the KDELR in the Golgi is favored due to the more acidic conditions present in this compartment. Under the more neutral conditions of the ER, chaperones are then released from the receptor (35). 

Bacterial toxins that require retrograde transportation to the ER can utilize the KDELR retrograde transport system. Certain bacterial toxins enter the cell through the endocytic pathway where they eventually reach the ER and use the ER translocon Sec61p complex to enter the cytosol and bind to their targets [reviewed by (36)]. Some of these toxins, like the A-fragment of cholera toxin, Escherichia coli heat labile toxin LT1, and Pseudomonas exotoxin A, have a KDEL-like motif at their C-terminus and can bind to KDELRs. In the case of Pseudomonas exotoxin A, KDELR-mediated transport is essential for its activity (37), but mutating the KDEL sequence present in the A-fragment of cholera toxin does not completely inhibit its toxicity, although this sequence is necessary for more efficient transport to the ER (38).  

KDELRs play an important role not only in retrograde trafficking from the Golgi to the ER, but also in anterograde trafficking through the Golgi. A general role in Golgi trafficking became apparent with the generation of the ER-retention defective (erd) yeast mutants (3). These mutants not only failed to retain chaperones in the ER, but also accumulated intracellular membranes and displayed inhibition of secretory protein transport through the Golgi complex. This phenotype suggested that KDELR might also recognize and retrieve components necessary for anterograde trafficking, in addition to ER-resident proteins. It has now been shown that KDELR has signal transduction capabilities that allow it to regulate trafficking through the Golgi. Upon arrival of incoming traffic from the ER, ligand binding to KDELR activates SFKs that are present at the Golgi membrane. This initiates a phosphorylation cascade that is required for the progression of cargo molecules through and from the Golgi complex to the plasma membrane. Inhibiting KDELR function (and binding of ligands) in cells reduced SFK activation on the Golgi and subsequent protein trafficking, while stimulation or overexpression of KDELR1 stimulated SFK activation (11).  

In addition to being critical for ER and Golgi transport, KDELRs appear to be important for the regulation of ER quality control (39). The proper folding of proteins in the ER can be disrupted by various stresses such as ischemia, oxidative stress, and genetic mutations. These stresses can lead to the accumulation of misfolded proteins in the ER, which triggers the unfolded protein response (UPR). The UPR reduces the amount of misfolded proteins by upregulating the amount of ER chaperones such as GRP78 (also known as BIP;immunoglobulin-heavy-chain-binding protein) that promote protein folding, reducing general protein synthesis, and enhancing the degradation of misfolded proteins via the proteosome. The mammalian ER stress response is coordinately induced by ER transmembrane proteins such as ATF6 (activating transcription factor 6), IRE1 (inositol-requiring transmembrane kinase/endonuclease 1), and PERK (pancreatic ER kinase). Normally these proteins bind to GRP78 in the ER and are retained in inactive complexes. Upon ER stress, GRP78 dissociation leads to autophosphorylation of IRE1 and PERK, and mobilization of ATF6 to the Golgi where it is cleaved into an active form by the site 1 protease (S1P; mutated in woodrat). These events lead to the activation of c-Jun amino-terminal kinases (JNKs), and other factors that can initiate apoptosis like the transcription factor CHOP (CCAAT/enhancer-binding protein homologous protein) [reviewed by (40)]. In cells, expression of a mutant KDELR1 that lacked the ability to bind ligands, led to the impaired retrieval of GRP78 resulting in the accumulation of misfolded proteins in the ER and increased CHOP expression. These cells also displayed reduced p38 mitogen-activated protein (MAP) kinase phosphorylation, which sensitized the cells to ER stress. Activation of KDELR by ligand-induced p38 phosphorylation suggesting that the KDELR participates in the ER stress response not only by its retrieval ability, but also by modulating MAP kinase signaling (41).

Little is known about mammalian KDELR1 function in vivo. A transgenic mouse was generated that expressed the D193N dominant-negative mutant of KDELR1 (42), which perturbs ER and Golgi trafficking, as well as ER quality control (11;42). Mice expressing this protein had problems breathing, showed reduced movement, and generally died at 14 months of age due to dilated cardiomyopathy. Animals displayed increased ventricular chamber size, reduced contractility of the heart, and enlarged cardiomyocytes that contained aggregates of misfolded protein. CHOP was upregulated in these animals, and apoptosis in the mutant hearts was increased (42). In humans, loss of the chromosomal region containing the KDELR1 gene is frequently found in gliomas (43). As a number of genes are found in this region, it is unknown if KDELR1 can act as a tumor suppressor in neuronal cells. However, the KDELR1 gene is a direct transcriptional target of the transcription factor NPAS2 (neuronal PAS domain-containing protein 2), a basic helix-loop-helix (bHLH) protein that is thought to be a tumor suppressor and is involved in regulating the 24-hour circadian rhythm (44).

Putative Mechanism

Mutation in Kdelr1 is likely to affect the retrieval of ER-resident proteins back to the ER, trafficking from the Golgi, and the regulation of ER stress. As yeast with defects in erd2 causes the accumulation of membrane structure and disturbs transport through the Golgi resulting in cell death (3), it is possible that the absence of KDELR1 function in mammals is likely to have significant consequences. This assumption is supported by the phenotype of mice expressing a dominant-negative version of KDELR1. Although these animals develop normally, they have a reduced lifespan due to congestive heart failure caused by the accumulation of misfolded proteins in the ER of cardiomyocytes leading to ER stress and apoptosis (42). It is possible that a complete knockout of KDELR1 function in mice would result in a more severe phenotype. Alternatively, the KDELR1 protein may share considerable functional redundancy with KDELR2 and the KDELR3 isoforms as suggested by ligand binding studies (6), and the expression of dominant-negative KDELR1 protein in mice may perturb the function of all of these proteins. Due to this ambiguity, it is unclear whether the Kdelr1 missense mutation found in daniel gray mice represents a hypomorphic allele or whether the alteration of Y158 severely affects KDELR1 function. Within the helical transmembrane domain, Y158 is predicted to lie adjacent to one of the essential residues required for ligand binding (Y162) (9;10). It is likely that replacement of this amino acid for a cysteine will affect the structure of TMD6 and binding of KDELR1 to KDEL-like motifs.   

Although it is possible that lack of KDELR1 function results in abnormal cytotoxic activity due to defects in lytic granules, daniel gray mice exhibit normal resistance to various infections including MCMV, which requires intact NK cell activity.  T cell function may also be normal in these mice as T-dependent antibody responses are intact, despite the reduced numbers of CD4⁺ cells. It is possible that the reduced numbers of T cells in daniel gray mice is caused by a sensitization of these cells to ER stress and subsequent apoptosis. The T cell defect in daniel gray mice cannot be rescued by overexpression of BCL2, suggesting that they do not have a defect in the intrinsic apoptotic signaling pathway that helps to mediate homeostatic cell survival (2). However, BCL2 may not be able to rescue the ER stress and apoptosis caused by a Kdelr1 mutation.   

As daniel gray mice display reduced thymic cellularity, it is possible that developing T cells are more sensitive to KDELR1 perturbation and that the effects of ER stress and apoptosis may occur during T cell development rather than in mature, peripheral T cells. 

Kamimura et al. described a mouse strain (Kdelr1^S123P) in which they attributed an observed T cell phenotype to an increased integrated stress response due to a reduced activation of protein phosphatase 1 (PP1) and subsequent reduced dephosphorylation of eIF2a and increased expression of stress response genes (e.g., Bcl2l11) (45). However, daniel gray mice on the Bcl2l11^-/- genetic background (Kdelr1^dgy/dgy;Bcl2l11^-/-) did not exhibit changes in cell death compared to daniel gray homozygotes. The precise mechanism of T lymphopenia in Kdelr1 mutants remains to be determined.

Primers

Primers cannot be located by automatic search.

Genotyping

Daniel gray genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

Daniel Gray(F): 5’- TTCTGTGATGCTGACAGTGCCTC -3’

Daniel Gray(R): 5’- GAAGTCAGGAAAGGAAGCCCCATTC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Daniel Gray _seq(F): 5'- GCTGACAGTGCCTCATCCTG -3'

Daniel Gray _seq(R): 5’- GGAAGCCCCATTCCTTAAGTG -3’

 

The following sequence of 420 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 7, bases 53,136,825 to 53,137,244) is amplified:

 

ttctgtgatg ctgacagtgc ctcatcctgt ctcttatctc tgcagatcct ctggaccttc
tccatctacc tggagtcagt ggctatcttg ccacagttgt tcatggtgag caagacgggt
gaggcggaga ccatcaccag ccattacctg tttgcactgg gtgtctaccg tacactctat
ctcttcaatt ggatctggcg ctaccacttc gagggctttt ttgacctcat cgccatcgtt
gctggcctgg tccagacagt cctctactgc gatttcttct acctctatat caccaaaggt
agctgggatg cagggctggc tgaaaggggt ctgctctctc cccactcctg tattccatgg
gcccagggtc tgtttattct tacatatcac ttaaggaatg gggcttcctt tcctgacttc

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.

References

  1. Siggs, O. M., Popkin, D. L., Krebs, P., Li, X., Tang, M., Zhan, X., Zeng, M., Lin, P., Xia, Y., Oldstone, M. B. A., Cornall, R. J., and Beutler, B. (2015) Mutation of the ER Retention Receptor KDELR1 Leads to Cell-Intrinsic Lymphopenia and a Failure to Control Viral Infection. Proc Natl Acad Sci ,USA. Oct 5.

  2. Strasser, A., Whittingham, S., Vaux, D. L., Bath, M. L., Adams, J. M., Cory, S., and Harris, A. W. (1991) Enforced BCL2 Expression in B-Lymphoid Cells Prolongs Antibody Responses and Elicits Autoimmune Disease. Proc Natl Acad Sci ,USA. 88, 8661-8665.

  3. Semenza, J. C., Hardwick, K. G., Dean, N., and Pelham, H. R. (1990) ERD2, a Yeast Gene Required for the Receptor-Mediated Retrieval of Luminal ER Proteins from the Secretory Pathway. Cell. 61, 1349-1357.

  4. Capitani, M., and Sallese, M. (2009) The KDEL Receptor: New Functions for an Old Protein. FEBS Lett. 583, 3863-3871.

  5. Lewis, M. J., and Pelham, H. R. (1992) Ligand-Induced Redistribution of a Human KDEL Receptor from the Golgi Complex to the Endoplasmic Reticulum. Cell. 68, 353-364.

  6. Raykhel, I., Alanen, H., Salo, K., Jurvansuu, J., Nguyen, V. D., Latva-Ranta, M., and Ruddock, L. (2007) A Molecular Specificity Code for the Three Mammalian KDEL Receptors. J Cell Biol. 179, 1193-1204.

  7. Lewis, M. J., and Pelham, H. R. (1990) A Human Homologue of the Yeast HDEL Receptor. Nature. 348, 162-163.

  8. Lewis, M. J., and Pelham, H. R. (1992) Sequence of a Second Human KDEL Receptor. J Mol Biol. 226, 913-916.

  9. Townsley, F. M., Wilson, D. W., and Pelham, H. R. (1993) Mutational Analysis of the Human KDEL Receptor: Distinct Structural Requirements for Golgi Retention, Ligand Binding and Retrograde Transport. EMBO J. 12, 2821-2829.

  10. Scheel, A. A., and Pelham, H. R. (1998) Identification of Amino Acids in the Binding Pocket of the Human KDEL Receptor. J Biol Chem. 273, 2467-2472.

  11. Pulvirenti, T., Giannotta, M., Capestrano, M., Capitani, M., Pisanu, A., Polishchuk, R. S., San Pietro, E., Beznoussenko, G. V., Mironov, A. A., Turacchio, G., Hsu, V. W., Sallese, M., and Luini, A. (2008) A Traffic-Activated Golgi-Based Signalling Circuit Coordinates the Secretory Pathway. Nat Cell Biol. 10, 912-922.

  12. Janson, I. M., Toomik, R., O'Farrell, F., and Ek, P. (1998) KDEL Motif Interacts with a Specific Sequence in Mammalian erd2 Receptor. Biochem Biophys Res Commun. 247, 447-451.

  13. Luttrell, L. M. (2008) Reviews in Molecular Biology and Biotechnology: Transmembrane Signaling by G Protein-Coupled Receptors. Mol Biotechnol. 39, 239-264.

  14. Aoe, T., Cukierman, E., Lee, A., Cassel, D., Peters, P. J., and Hsu, V. W. (1997) The KDEL Receptor, ERD2, Regulates Intracellular Traffic by Recruiting a GTPase-Activating Protein for ARF1. EMBO J. 16, 7305-7316.

  15. Aoe, T., Lee, A. J., van Donselaar, E., Peters, P. J., and Hsu, V. W. (1998) Modulation of Intracellular Transport by Transported Proteins: Insight from Regulation of COPI-Mediated Transport. Proc Natl Acad Sci U S A. 95, 1624-1629.

  16. Aoe, T., Huber, I., Vasudevan, C., Watkins, S. C., Romero, G., Cassel, D., and Hsu, V. W. (1999) The KDEL Receptor Regulates a GTPase-Activating Protein for ADP-Ribosylation Factor 1 by Interacting with its Non-Catalytic Domain. J Biol Chem. 274, 20545-20549.

  17. Majoul, I., Straub, M., Hell, S. W., Duden, R., and Soling, H. D. (2001) KDEL-Cargo Regulates Interactions between Proteins Involved in COPI Vesicle Traffic: Measurements in Living Cells using FRET. Dev Cell. 1, 139-153.

  18. Cabrera, M., Muniz, M., Hidalgo, J., Vega, L., Martin, M. E., and Velasco, A. (2003) The Retrieval Function of the KDEL Receptor Requires PKA Phosphorylation of its C-Terminus. Mol Biol Cell. 14, 4114-4125.

  19. Nilsson, T., Jackson, M., and Peterson, P. A. (1989) Short Cytoplasmic Sequences Serve as Retention Signals for Transmembrane Proteins in the Endoplasmic Reticulum. Cell. 58, 707-718.

  20. Jackson, M. R., Nilsson, T., and Peterson, P. A. (1993) Retrieval of Transmembrane Proteins to the Endoplasmic Reticulum. J Cell Biol. 121, 317-333.

  21. Jackson, M. R., Nilsson, T., and Peterson, P. A. (1990) Identification of a Consensus Motif for Retention of Transmembrane Proteins in the Endoplasmic Reticulum. EMBO J. 9, 3153-3162.

  22. McGarrigle, D., and Huang, X. Y. (2007) GPCRs Signaling Directly through Src-Family Kinases. Sci STKE. 2007, pe35.

  23. Rual, J. F., Venkatesan, K., Hao, T., Hirozane-Kishikawa, T., Dricot, A., Li, N., Berriz, G. F., Gibbons, F. D., Dreze, M., Ayivi-Guedehoussou, N., Klitgord, N., Simon, C., Boxem, M., Milstein, S., Rosenberg, J., Goldberg, D. S., Zhang, L. V., Wong, S. L., Franklin, G., Li, S., Albala, J. S., Lim, J., Fraughton, C., Llamosas, E., Cevik, S., Bex, C., Lamesch, P., Sikorski, R. S., Vandenhaute, J., Zoghbi, H. Y., Smolyar, A., Bosak, S., Sequerra, R., Doucette-Stamm, L., Cusick, M. E., Hill, D. E., Roth, F. P., and Vidal, M. (2005) Towards a Proteome-Scale Map of the Human Protein-Protein Interaction Network. Nature. 437, 1173-1178.

  24. Verrier, S. E., Willmann, M., Wenzel, D., Winter, U., von Mollard, G. F., and Soling, H. D. (2008) Members of a Mammalian SNARE Complex Interact in the Endoplasmic Reticulum in Vivo and are found in COPI Vesicles. Eur J Cell Biol. 87, 863-878.

  25. Miller, J. P., Lo, R. S., Ben-Hur, A., Desmarais, C., Stagljar, I., Noble, W. S., and Fields, S. (2005) Large-Scale Identification of Yeast Integral Membrane Protein Interactions. Proc Natl Acad Sci U S A. 102, 12123-12128.

  26. Ewing, R. M., Chu, P., Elisma, F., Li, H., Taylor, P., Climie, S., McBroom-Cerajewski, L., Robinson, M. D., O'Connor, L., Li, M., Taylor, R., Dharsee, M., Ho, Y., Heilbut, A., Moore, L., Zhang, S., Ornatsky, O., Bukhman, Y. V., Ethier, M., Sheng, Y., Vasilescu, J., Abu-Farha, M., Lambert, J. P., Duewel, H. S., Stewart, I. I., Kuehl, B., Hogue, K., Colwill, K., Gladwish, K., Muskat, B., Kinach, R., Adams, S. L., Moran, M. F., Morin, G. B., Topaloglou, T., and Figeys, D. (2007) Large-Scale Mapping of Human Protein-Protein Interactions by Mass Spectrometry. Mol Syst Biol. 3, 89.

  27. Hsu, V. W., Shah, N., and Klausner, R. D. (1992) A Brefeldin A-Like Phenotype is Induced by the Overexpression of a Human ERD-2-Like Protein, ELP-1. Cell. 69, 625-635.

  28. Griffiths, G., Ericsson, M., Krijnse-Locker, J., Nilsson, T., Goud, B., Soling, H. D., Tang, B. L., Wong, S. H., and Hong, W. (1994) Localization of the Lys, Asp, Glu, Leu Tetrapeptide Receptor to the Golgi Complex and the Intermediate Compartment in Mammalian Cells. J Cell Biol. 127, 1557-1574.

  29. Donaldson, J. G., Cassel, D., Kahn, R. A., and Klausner, R. D. (1992) ADP-Ribosylation Factor, a Small GTP-Binding Protein, is Required for Binding of the Coatomer Protein Beta-COP to Golgi Membranes. Proc Natl Acad Sci U S A. 89, 6408-6412.

  30. Lanoix, J., Ouwendijk, J., Stark, A., Szafer, E., Cassel, D., Dejgaard, K., Weiss, M., and Nilsson, T. (2001) Sorting of Golgi Resident Proteins into Different Subpopulations of COPI Vesicles: A Role for ArfGAP1. J Cell Biol. 155, 1199-1212.

  31. Malsam, J., Gommel, D., Wieland, F. T., and Nickel, W. (1999) A Role for ADP Ribosylation Factor in the Control of Cargo Uptake during COPI-Coated Vesicle Biogenesis. FEBS Lett. 462, 267-272.

  32. Tanigawa, G., Orci, L., Amherdt, M., Ravazzola, M., Helms, J. B., and Rothman, J. E. (1993) Hydrolysis of Bound GTP by ARF Protein Triggers Uncoating of Golgi-Derived COP-Coated Vesicles. J Cell Biol. 123, 1365-1371.

  33. Stauber, T., Simpson, J. C., Pepperkok, R., and Vernos, I. (2006) A Role for Kinesin-2 in COPI-Dependent Recycling between the ER and the Golgi Complex. Curr Biol. 16, 2245-2251.

  34. Bard, F., Mazelin, L., Pechoux-Longin, C., Malhotra, V., and Jurdic, P. (2003) Src Regulates Golgi Structure and KDEL Receptor-Dependent Retrograde Transport to the Endoplasmic Reticulum. J Biol Chem. 278, 46601-46606.

  35. Wilson, D. W., Lewis, M. J., and Pelham, H. R. (1993) PH-Dependent Binding of KDEL to its Receptor in Vitro. J Biol Chem. 268, 7465-7468.

  36. Watson, P., and Spooner, R. A. (2006) Toxin Entry and Trafficking in Mammalian Cells. Adv Drug Deliv Rev. 58, 1581-1596.

  37. Jackson, M. E., Simpson, J. C., Girod, A., Pepperkok, R., Roberts, L. M., and Lord, J. M. (1999) The KDEL Retrieval System is Exploited by Pseudomonas Exotoxin A, but Not by Shiga-Like Toxin-1, during Retrograde Transport from the Golgi Complex to the Endoplasmic Reticulum. J Cell Sci. 112 ( Pt 4), 467-475.

  38. Lencer, W. I., Constable, C., Moe, S., Jobling, M. G., Webb, H. M., Ruston, S., Madara, J. L., Hirst, T. R., and Holmes, R. K. (1995) Targeting of Cholera Toxin and Escherichia Coli Heat Labile Toxin in Polarized Epithelia: Role of COOH-Terminal KDEL. J Cell Biol. 131, 951-962.

  39. Yamamoto, K., Fujii, R., Toyofuku, Y., Saito, T., Koseki, H., Hsu, V. W., and Aoe, T. (2001) The KDEL Receptor Mediates a Retrieval Mechanism that Contributes to Quality Control at the Endoplasmic Reticulum. EMBO J. 20, 3082-3091.

  40. Todd, D. J., Lee, A. H., and Glimcher, L. H. (2008) The Endoplasmic Reticulum Stress Response in Immunity and Autoimmunity. Nat Rev Immunol. 8, 663-674.

  41. Yamamoto, K., Hamada, H., Shinkai, H., Kohno, Y., Koseki, H., and Aoe, T. (2003) The KDEL Receptor Modulates the Endoplasmic Reticulum Stress Response through Mitogen-Activated Protein Kinase Signaling Cascades. J Biol Chem. 278, 34525-34532.

  42. Hamada, H., Suzuki, M., Yuasa, S., Mimura, N., Shinozuka, N., Takada, Y., Suzuki, M., Nishino, T., Nakaya, H., Koseki, H., and Aoe, T. (2004) Dilated Cardiomyopathy Caused by Aberrant Endoplasmic Reticulum Quality Control in Mutant KDEL Receptor Transgenic Mice. Mol Cell Biol. 24, 8007-8017.

  43. Smith, J. S., Tachibana, I., Lee, H. K., Qian, J., Pohl, U., Mohrenweiser, H. W., Borell, T. J., Hosek, S. M., Soderberg, C. L., von Deimling, A., Perry, A., Scheithauer, B. W., Louis, D. N., and Jenkins, R. B. (2000) Mapping of the Chromosome 19 q-Arm Glioma Tumor Suppressor Gene using Fluorescence in Situ Hybridization and Novel Microsatellite Markers. Genes Chromosomes Cancer. 29, 16-25.

  44. Yi, C., Mu, L., de la Longrais, I. A., Sochirca, O., Arisio, R., Yu, H., Hoffman, A. E., Zhu, Y., and Katsaro, D. (2009) The Circadian Gene NPAS2 is a Novel Prognostic Biomarker for Breast Cancer. Breast Cancer Res Treat. .

  45. Kamimura, D., Katsunuma, K., Arima, Y., Atsumi, T., Jiang, J. J., Bando, H., Meng, J., Sabharwal, L., Stofkova, A., Nishikawa, N., Suzuki, H., Ogura, H., Ueda, N., Tsuruoka, M., Harada, M., Kobayashi, J., Hasegawa, T., Yoshida, H., Koseki, H., Miura, I., Wakana, S., Nishida, K., Kitamura, H., Fukada, T., Hirano, T., and Murakami, M. (2015) KDEL Receptor 1 Regulates T-Cell Homeostasis Via PP1 that is a Key Phosphatase for ISR. Nat Commun. 6, 7474.