Phenotypic Mutation 'cadence' (pdf version)
Allelecadence
Mutation Type missense
Chromosome9
Coordinate45,001,128 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Cd3e
Gene Name CD3 antigen, epsilon polypeptide
Synonym(s) T3e, CD3, CD3epsilon
Chromosomal Location 44,998,740-45,009,627 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. Defects in this gene cause immunodeficiency. This gene has also been linked to a susceptibility to type I diabetes in women. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous null for this mutation lack peripherial T cells and have a block of thymocyte development at the DN3 stage. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007648; MGI:88332

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Valine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000099896]
PDB Structure
CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct [SOLUTION NMR]
CD3 EPSILON AND DELTA ECTODOMAIN FRAGMENT COMPLEX IN SINGLE-CHAIN CONSTRUCT [SOLUTION NMR]
Mouse CD3epsilon Cytoplasmic Tail [SOLUTION NMR]
Crystal structure of mouse cd3epsilon in complex with antibody 2C11 Fab [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000099896
Gene: ENSMUSG00000032093
AA Change: E106V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 33 90 3.79e-13 SMART
transmembrane domain 111 133 N/A INTRINSIC
ITAM 167 187 2.96e-4 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000102832)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS naive CD8 T cells in CD8 T cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (ENU)(1) Targeted(9)Transgenic(10)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
tumormouse UTSW 9 45006150 intron probably benign
R0504:Cd3e UTSW 9 45002254 missense probably benign
R3237:Cd3e UTSW 9 45002310 nonsense probably null
R6054:Cd3e UTSW 9 45002161 missense possibly damaging 0.87
R6374:Cd3e UTSW 9 45009363 missense probably benign 0.41
R6404:Cd3e UTSW 9 45001128 missense probably damaging 1.00
R6701:Cd3e UTSW 9 45001053 missense probably damaging 1.00
X0025:Cd3e UTSW 9 45000976 splice site probably null
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2018-11-30 9:00 AM by Anne Murray
Record Created 2018-11-17 3:40 PM by Bruce Beutler
Record Posted 2018-11-30
Phenotypic Description

Figure 1. Cadence mice exhibit reduced CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Cadence mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Cadence mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Cadence mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Cadence mice exhibit increased frequencies of peripheral central memory CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Cadence mice exhibit decreased frequencies of peripheral naive CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Cadence mice exhibit increased CD44 expression on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Cadence mice exhibit increased CD44 expression on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The cadence phenotype was identified among G3 mice of the pedigree R6404, some of which showed reduced CD4+ to CD8+ T cell ratios (Figure 1) due to reduced frequencies of CD4+ T cells (Figure 2), CD4+ T cells in CD3+ T cells (Figure 3) with concomitant increased frequencies of CD8+ T cells in CD3+ T cells (Figure 4) in the peripheral blood. Some mice also showed increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 5) and reduced frequencies of naïve CD8 T cells in CD8 T cells (Figure 6) in the peripheral blood. The expression of CD44 was increased on peripheral blood T cells (Figure 7) and CD8+ T cells (Figure 8).

Nature of Mutation

Figure 9. Linkage mapping of the increased central memory CD8+ T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 42 mutations (X-axis) identified in the G1 male of pedigree R6404. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 42 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd3e:  an A to T transversion at base pair 45,001,128 (v38) on chromosome 9, or base pair 8,537 in the GenBank genomic region NC_000075 encoding Cd3e.  The strongest association was found with a recessive model of inheritance to the normalized frequency of central memory CD8+ T cells, wherein 13 variant homozygotes departed phenotypically from 34 homozygous reference mice and 33 heterozygous mice with a P value of 6.505 x 10-11 (Figure 9).  

 

The mutation corresponds to residue 416 in the mRNA sequence NM_007648 within exon 6 of 8 total exons.

 

400 TGTGAGTACTGTGTGGAGGTGGACCTGACAGCA

101 -C--E--Y--C--V--E--V--D--L--T--A-

 

The mutated nucleotide is indicated in red. The mutation results in a glutamic acid to valine substitution at position 106 (E106V) in the CD3ε protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction
Figure 10. Structure of CD3ε.  A, Domain structure of the CD3ε protein. B, Chimera UCSF 3D structure of the extracellular domain of CD3ε based on PDB ID 1XIW. The cadence mutation results in a glutamic acid to valine substitution at position 106 (E106V) in the CD3ε protein (unsolved section of the protein shown). Click on the 3D structure to view it rotate.

Cd3e encodes the 189-amino acid protein, CD3ε. CD3ε has an 88-amino acid extracellular N-terminus, a 26-amino acid transmembrane domain, and a 65-amino acid cytoplasmic region (Figure 10A) (1). CD3ε belongs to the immunoglobulin superfamily and its extracellular domain adopts a similar fold, with an eight-stranded β-sheet bilayer (Figure 10B) (1;2). Trimeric transmembrane interactions (CD3ε-CD3δ-TCRβ and CD3ε-CD3δ-TCRα) are essential for the assembly and surface expression of TCR/CD3 complexes (3); extracellular interactions enhance these interactions and are mediated by residues conserved among mammals (2).

 

The cytoplasmic domain of CD3ε contains a basic amino acid-rich region (4), a proline-rich region (5), and an immunoreceptor tyrosine-based activation motif (ITAM) (6). These motifs mediate interactions with downstream signaling molecules.

 

The cadence mutation replaces glutamic acid 106 with a valine (E106V); Glu106 is within the extracellular N-terminus, close to the transmembrane domain.

 

See the record tumormouse for more information about Cd3e.

Putative Mechanism

The T cell receptor (TCR) consists of a complex including TCR α/β or γ/δ chains, several invariant CD3 chains, and ζ chains (see allia) (7). CD3γ, CD3δ and CD3ε constitute the three types of CD3 chains, and combine to form TCRs with stoichiometry TCRαβ or TCRγδ /CD3γε/CD3δε/ζζ. Recognition and binding of MHC/antigen ligands is carried out by TCRαβ or TCRγδ heterodimers, while CD3 chains are responsible for signal transduction, and recruited Syk (see poppy) and Src family members provide tyrosine kinase activity (8). Upon TCR crosslinking, signaling by the TCR complex relies on the ten ITAMs present in the CD3γ, δ, ε, and ζ chains [reviewed in (6;9)]. The Src family kinases Lck (see Lemon) and Fyn are recruited and activated, specifically phosphorylating ITAMs in CD3γ, δ, ε and ζ. These phosphorylated ITAMs then recruit ZAP-70 (ζ-chain-associated protein of 70 kDa; see murdock) and Syk, which trans- and auto-phosphorylate, forming binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. ZAP-70 and Syk may also phosphorylate the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (6). These phosphorylation events lead to activation of multiple serine/threonine kinases, including MAP kinases, IκB kinases, and PKC family members, which ultimately regulate transcription factor activity.

 

Development of thymocytes into mature T cells occurs in the thymus, where thymocytes follow a program of differentiation characterized by expression of distinct combinations of cell surface proteins including CD4, CD8, CD44 and CD25. The most immature thymocytes are CD4-CD8- double negative (DN). This group can be further subdivided into 4 groups that differentiate in the following order: CD44+CD25- (DN1) to CD44+CD25+ (DN2) to CD44-CD25+ (DN3) to CD44-CD25- (DN4). During this process, expression of pre-TCRα (pTα), TCRα, TCRβ and CD3 proteins is activated in temporal sequence to promote T cell development. Studies of CD3ε-deficient mice demonstrate that CD3ε specifically contributes to formation of a pre-TCR complex with TCRβ and pTα at the CD44-CD25+ DN3 stage, and these animals have no mature T cells (10-12). Interestingly, one group reported that CD3ε null thymocytes were severely, but not completely arrested at the DN3 stage, suggesting that expression of the other components of the pre-TCR may assemble a partial complex that can weakly induce transition out of the DN3 stage (12). Similar to other CD3ε mutants, the cadence mice exhibit thymocyte development arrests at the DN3 stage resulting in a loss of mature T cells.

Primers PCR Primer
cadence(F):5'- GAATCTGCTGTAGACTTGGTGC -3'
cadence(R):5'- TCCTCATTGGACACCACTGC -3'

Sequencing Primer
cadence_seq(F):5'- AGGCTAGATGTCTCCTGACC -3'
cadence_seq(R):5'- CCACTGCAGGAAAGACTCTGG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler