Allele | cadence | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 45,001,128 bp (GRCm38) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Cd3e | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | CD3 antigen, epsilon polypeptide | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | T3e, CD3, CD3epsilon | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 44,998,740-45,009,627 bp (-) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. Defects in this gene cause immunodeficiency. This gene has also been linked to a susceptibility to type I diabetes in women. [provided by RefSeq, Jul 2008] PHENOTYPE: Mice homozygous null for this mutation lack peripherial T cells and have a block of thymocyte development at the DN3 stage. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Glutamic Acid changed to Valine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000099896] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000099896 Gene: ENSMUSG00000032093 AA Change: E106V
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(20) : Chemically induced (ENU)(1) Targeted(9)Transgenic(10) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-11-30 9:00 AM by Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2018-11-17 3:40 PM by Bruce Beutler | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-11-30 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The cadence phenotype was identified among G3 mice of the pedigree R6404, some of which showed reduced CD4+ to CD8+ T cell ratios (Figure 1) due to reduced frequencies of CD4+ T cells (Figure 2), CD4+ T cells in CD3+ T cells (Figure 3) with concomitant increased frequencies of CD8+ T cells in CD3+ T cells (Figure 4) in the peripheral blood. Some mice also showed increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 5) and reduced frequencies of naïve CD8 T cells in CD8 T cells (Figure 6) in the peripheral blood. The expression of CD44 was increased on peripheral blood T cells (Figure 7) and CD8+ T cells (Figure 8). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 42 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd3e: an A to T transversion at base pair 45,001,128 (v38) on chromosome 9, or base pair 8,537 in the GenBank genomic region NC_000075 encoding Cd3e. The strongest association was found with a recessive model of inheritance to the normalized frequency of central memory CD8+ T cells, wherein 13 variant homozygotes departed phenotypically from 34 homozygous reference mice and 33 heterozygous mice with a P value of 6.505 x 10-11 (Figure 9).
The mutation corresponds to residue 416 in the mRNA sequence NM_007648 within exon 6 of 8 total exons.
The mutated nucleotide is indicated in red. The mutation results in a glutamic acid to valine substitution at position 106 (E106V) in the CD3ε protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Cd3e encodes the 189-amino acid protein, CD3ε. CD3ε has an 88-amino acid extracellular N-terminus, a 26-amino acid transmembrane domain, and a 65-amino acid cytoplasmic region (Figure 10A) (1). CD3ε belongs to the immunoglobulin superfamily and its extracellular domain adopts a similar fold, with an eight-stranded β-sheet bilayer (Figure 10B) (1;2). Trimeric transmembrane interactions (CD3ε-CD3δ-TCRβ and CD3ε-CD3δ-TCRα) are essential for the assembly and surface expression of TCR/CD3 complexes (3); extracellular interactions enhance these interactions and are mediated by residues conserved among mammals (2).
The cytoplasmic domain of CD3ε contains a basic amino acid-rich region (4), a proline-rich region (5), and an immunoreceptor tyrosine-based activation motif (ITAM) (6). These motifs mediate interactions with downstream signaling molecules.
The cadence mutation replaces glutamic acid 106 with a valine (E106V); Glu106 is within the extracellular N-terminus, close to the transmembrane domain.
See the record tumormouse for more information about Cd3e. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The T cell receptor (TCR) consists of a complex including TCR α/β or γ/δ chains, several invariant CD3 chains, and ζ chains (see allia) (7). CD3γ, CD3δ and CD3ε constitute the three types of CD3 chains, and combine to form TCRs with stoichiometry TCRαβ or TCRγδ /CD3γε/CD3δε/ζζ. Recognition and binding of MHC/antigen ligands is carried out by TCRαβ or TCRγδ heterodimers, while CD3 chains are responsible for signal transduction, and recruited Syk (see poppy) and Src family members provide tyrosine kinase activity (8). Upon TCR crosslinking, signaling by the TCR complex relies on the ten ITAMs present in the CD3γ, δ, ε, and ζ chains [reviewed in (6;9)]. The Src family kinases Lck (see Lemon) and Fyn are recruited and activated, specifically phosphorylating ITAMs in CD3γ, δ, ε and ζ. These phosphorylated ITAMs then recruit ZAP-70 (ζ-chain-associated protein of 70 kDa; see murdock) and Syk, which trans- and auto-phosphorylate, forming binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. ZAP-70 and Syk may also phosphorylate the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (6). These phosphorylation events lead to activation of multiple serine/threonine kinases, including MAP kinases, IκB kinases, and PKC family members, which ultimately regulate transcription factor activity.
Development of thymocytes into mature T cells occurs in the thymus, where thymocytes follow a program of differentiation characterized by expression of distinct combinations of cell surface proteins including CD4, CD8, CD44 and CD25. The most immature thymocytes are CD4-CD8- double negative (DN). This group can be further subdivided into 4 groups that differentiate in the following order: CD44+CD25- (DN1) to CD44+CD25+ (DN2) to CD44-CD25+ (DN3) to CD44-CD25- (DN4). During this process, expression of pre-TCRα (pTα), TCRα, TCRβ and CD3 proteins is activated in temporal sequence to promote T cell development. Studies of CD3ε-deficient mice demonstrate that CD3ε specifically contributes to formation of a pre-TCR complex with TCRβ and pTα at the CD44-CD25+ DN3 stage, and these animals have no mature T cells (10-12). Interestingly, one group reported that CD3ε null thymocytes were severely, but not completely arrested at the DN3 stage, suggesting that expression of the other components of the pre-TCR may assemble a partial complex that can weakly induce transition out of the DN3 stage (12). Similar to other CD3ε mutants, the cadence mice exhibit thymocyte development arrests at the DN3 stage resulting in a loss of mature T cells. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer cadence(F):5'- GAATCTGCTGTAGACTTGGTGC -3' cadence(R):5'- TCCTCATTGGACACCACTGC -3' Sequencing Primer cadence_seq(F):5'- AGGCTAGATGTCTCCTGACC -3' cadence_seq(R):5'- CCACTGCAGGAAAGACTCTGG -3' |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Xue Zhong, Jin Huk Choi, and Bruce Beutler |