Phenotypic Mutation 'prune' (pdf version)
List |< first << previous [record 6 of 17] next >> last >|
Alleleprune
Mutation Type missense
Chromosome14
Coordinate70,571,429 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Hr
Gene Name hairless
Synonym(s) ALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
Chromosomal Location 70,552,212-70,573,548 bp (+)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Accession Number
NCBI RefSeq: NM­_021877; MGI: 96223
Mapped Yes 
Amino Acid Change Tyrosine changed to Aspartic acid
Institutional SourceBeutler Lab
Ref Sequences
Y1082D in Ensembl: ENSMUSP00000022691 (fasta)
Y1111D in Ensembl: ENSMUSP00000124042 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 305 327 N/A INTRINSIC
low complexity region 345 359 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 701 715 N/A INTRINSIC
low complexity region 746 757 N/A INTRINSIC
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.67; Specificity: 0.97)
(Using Ensembl: ENSMUSP00000022691)
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (DSS Male) - decreased
DSS: sensitive day 10
DSS: sensitive day 7
FACS B cells - decreased
FACS B:T cells - decreased
FACS B1a cells in B1 cells - decreased
FACS B1b cells - increased
FACS B1b cells in B1 cells - increased
FACS B2 cells - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM MFI - increased
FACS IgM+ B cells - decreased
FACS macrophages - increased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS T cells - decreased
skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(25) : Targeted, knock-out(1) Targeted, other(2) Transgenic(1) Spontaneous(15) Chemically induced(6)  

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
angie UTSW 14 70567833 missense probably damaging 0.97
blofeld UTSW 14 70568085 missense probably damaging 1.00
kaburo UTSW 14 unclassified
mister_clean UTSW 14 70560065 critical splice donor site
mushroom UTSW 14 70568085 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2268:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3978:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5292:Hr UTSW 14 70571992 missense probably damaging 1.00
R5452:Hr UTSW 14 70556627 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6000:Hr UTSW 14 70567833 missense probably damaging 0.97
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 030821-UCD
Last Updated 2018-03-02 4:44 PM by Diantha La Vine
Record Created unknown
Record Posted 2008-09-02
Phenotypic Description

The prune phenotype was discovered in an N-ethyl-N-nitrosourea (ENU)-induced G3 mutant mouse.  Mutant mice develop a normal first coat, but beginning at two weeks of age hair loss begins from just above the eyes and progresses towards the posterior.  By three weeks of age, animals have an almost universal absence of hair, with occasional hairs retained on the feet and snout.  The skin is extremely loose and wrinkled, and the toenails are abnormally long (Figure 1).  The animal has normal thymocyte (T) cell counts in the peripheral blood.  The strain is being expanded for further analysis.

Nature of Mutation
The prune mutation is a T to G transversion at residue 3733 in the cDNA transcript ENSMUST00000163060, within exon 16 of 18 total exons. The mutated residue corresponds to position 3938 of the Hr transcript ENSMUST00000022691, in exon 18 of 20 total exons. 
 
17359 GCCCCAGGCAGCTGCTACTTGGATGCAGGGTTG
 1106 -A--P--G--S--C--Y--L--D--A--G--L- (ENSMUSP00000124042)
  1077 -A--P--G--S--C--Y--L--D--A--G--L- (ENSMUSP00000022691 & NP_068677
 
Genomic sequence and numbering are shown. The mutated nucleotide is indicated in red lettering, and results in a tyrosine to aspartic acid substitution at residue 1111 or 1082 in ENSMUSP00000124042 and ENSMUSP00000022691, respectively. 
Protein Prediction

Figure 2. HR functional domains. The N-terminal domain varies between the two isoforms of HR; only the longer isoform is shown. The position of the prune mutation is indiated in red and results in a tyrosine to aspartic acid substitution at residue 1111 of the HR protein encoded by the ENSMUST00000163060 cDNA transcript, or at position 1082 of the isoform encoded by the ENSMUST00000022691 cDNA transcript (not shown). NMTS, nuclear matrix targeting signal; RD, repression domain; NLS, nuclear localization signal; ID, interacting domain; ZF, zinc finger domain; ROR, retinoic acid receptor related orphan receptor; TR, thyroid hormone receptor. Click on the image to view other mutations found in HR. Click on each mutation for more specific information.

The mouse Hairless protein contains 1211 amino acids (a shorter 1182 amino acid isoform differs only at the N-terminus), and is well conserved with 80% identity to the human protein (1-4).  The HR protein contains a potential DNA-binding zinc finger domain consisting of a highly conserved six cysteine motif located within a loop region at amino acids 585-620 (for mouse HR) (1-3).  The zinc finger motif is homologous to those found in the GATA family of transcription factors (5).  For a depiction of the Hairless functional domains, see Figure 2 (see mister clean, Kaburo, and ren for other Hr mutations).   
 
The N-terminal region of the HR protein has no clearly defined secondary structure, but the rest of the HR protein (from amino acid 378) is predicted to form three α-helical regions interrupted by long loop regions including the region containing the zinc finger.  The actual structure of the HR protein remains to be determined.  A novel bipartite nuclear localization signal (NLS) was identified at amino acids 409-427 consisting of the sequence KRA(X13)PKR (6).  Subsequently, a novel nuclear matrix targeting signal (NMTS) was also found in the HR protein at amino acids 111-156 that is necessary for its nuclear sub-localization (7).   
 
Along with the potential DNA-binding domain, the HR protein contains several domains that suggest it is a nuclear receptor corepressor, including multiple nuclear receptor interacting domains and three repression domains capable of mediating nuclear receptor repressive activity in vitro (8).  In the mouse protein, these repressive domains (RD) are located at amino acids 210-423 (RD1), 725-839 (RD2), and 839-956 (RD3).  The RD2 domain contains regions that interact with the thyroid hormone receptor (TR), the retinoic acid receptor related orphan receptor α (RORα) and the vitamin D receptor (VDR) (8-10).  Domains that have been shown to interact with TR are located at amino acids 792-805 (TR-ID1 for TR interacting domain 1) and amino acids 1001-1013 (TR-ID2) (8).  RORα-interacting domains (ROR-ID) are located at amino acids 561-565 and 753-757 (9).  The nuclear receptor interacting domains of HR consist of hydrophobic motifs, and are similar to nuclear receptor interacting motifs present in other nuclear receptor interacting proteins (6;8;9).  Specifically, HR contains two LXXLL motifs known as nuclear receptor (NR) boxes that are present in nuclear receptor coactivators, and are known to interact with the α-helical AF-2 motif present in the ligand binding domain (LBD) of nuclear receptors (6;11).  These motifs correspond to the RORα-interacting domains (9).  The TR interacting motifs are similar to nuclear receptor interacting domains found in other nuclear receptor corepressors, and are thought to form amphipathic α helices (8;12;13).
 
The HR protein also contains a JmjC domain at amino acids 968-1179, which encompasses the TR-ID2 motif and partially overlaps with RD3 (7).  Two proteins carrying this domain, JHDM1 (JmjC domain-containing histone demethylase 1) and JHDM2A, were found to have histone demethylase activity and be involved in transcriptional regulation (14).  An alternatively spliced form of the Hr gene has been reported in humans that splices out exon 17 and removes part of the JmjC domain at amino acids 1072-1126 (4).
 
The prune mutation results in the substitution of a tyrosine with an aspartic acid in the JmjC domain.  This amino acid is highly conserved across species.
Expression/Localization
Northern analysis in the mouse found only significant mRNA in the brain and skin, and in situ hybridization found expression in the skin to be in hair follicles (1).  During embryonic development in the mouse, in situ hybridization found expression beginning at embryonic day (E)12.5 with strong mRNA levels in cartilage, and low levels in the epidermis, vibrissae, oral epithelium, tooth buds, submandibular gland, nasal epithelium, brain and inner ear.  Other types of epithelium did not show any expression.  At E16.5, strong expression continued in the cartilage, with low levels of hairless mRNA at later stages corresponding with the decrease in cartilage tissue.  From E16.5 to later embryonic stages, moderate to strong expression levels of hr were found in epidermis, hair follicles, vibrissae, tooth buds, submandibular gland, and most epithelial layers.  Hr was expressed throughout the brain at all stages with strongest expression found in the cortex, and some expression in the retina and optic nerve. In the tooth buds, hr mRNA was expressed in the epithelial cells of the tooth, consistent with its general expression in epithelial tissue and cells of epithelial origin (15). 
 
In the mouse, the expression of both hr mRNA and protein has been examined in detail during hair follicle (HF) morphogenesis and cycling (16;17).  During HF morphogenesis (see Background), hr mRNA is consistently expressed in the undifferentiated suprabasal cell layers of the interfollicular epidermis, the HF infundibulum, the hair matrix, and in the inner root sheath (IRS).  The dermal papilla (DP) and outer root sheath (ORS) were negative for hr mRNA (16).  During the mouse hair cycle, follicles actively growing hair in anagen do not contain detectable HR protein.  HR is detected as follicles enter catagen, and is present in keratin 14 (K14)-positive progenitor cells in the ORS, which includes the bulge region.  HR is also detected in K14-negative hair bulb cells.  This expression is maintained through the resting telogen phase and into the early part of the next anagen.  HR protein again becomes undetectable once the hair bulb has formed.  Hr mRNA shows a slightly different expression pattern during the hair cycle with hr mRNA being present throughout anagen (16).  
 
In the rat, Northern analysis of RNA isolated from embryonic and postnatal brain shows that hr is expressed at high levels shortly after birth, reaching a peak between postnatal days (P) 14 and 21.  Neonatal expression of hr is abundant in brain and skin and is also detected at low levels in other tissues, including gut, lung, muscle, pituitary, testes, and thymus.  The expression pattern is similar in adult tissues (2).  In situ hybridization experiments show that hr is broadly expressed at low levels throughout the forebrain and midbrain at P14 and P15, with high levels in the cortex, hippocampus, thalamus, and cerebellum (2;18).  In the cerebellum, this expression was restricted to the differentiated cells of the internal granule cell layer (IGL) (2).  Hr is also expressed in the cochlear nucleus and inferior colliculus of the auditory system.  In addition, hr is expressed in several fiber tracts including the corpus callosum, optic tract, internal capsule, and cerebral peduncle, indicating expression may also be in glial cells (18).  Western blot analysis is agreement with these results, finding high levels of HR expression in the brain and skin with lower levels detected in lung and pituitary.  In the CNS, HR protein is expressed in the cerebellum, somatosensory cortex, inferior colliculus, olfactory bulb, thalamus, optic tract, and spinal cord. In the cerebellum, HR protein is first detected at P10, remains high during postnatal development, and decreases in the adult (18).
 
Northern analysis of human Hairless mRNA was consistent with mouse and rat data, with substantial expression in the brain and skin, moderate expression in the heart and trace expression in all other tissues (3).  RT-PCR analysis supported these findings with HR mRNA expressed in skin, small intestine, brain, testes, and colon with trace levels detected in liver, kidney, pancreas, spleen and thymus.  Interestingly, RT-PCR analysis suggested that human skin only expressed the shorter Hairless isoform (see Protein Prediction) (4).
 

Transfection studies of tagged rat and mouse Hairless protein found HR to be localized to the nucleus and associated with the nuclear matrix and matrix-associated deacetylase (MAD) bodies (6-8;19).

Background
Figure 2. Hair follicle and cycle. (A) The hair follicle consists of eight epithelial layers including the outer root sheath, companion layer, inner root sheath (consisting of Henle’s, Huxley’s and cuticle layers) and the hair shaft (consisting of cuticle, cortex and medulla).  All layers, with the exception of the outer root sheath, are derived from proliferative cells of the hair matrix, located around the dermal papilla at the base of the hair bulb.  (B) After hair follicles are established, hair is periodically shed and replaced, involving periodic destruction and regeneration of hair follicles. The hair cycle is divided into three periods: Anagen Phase (follicle growth), Catagen Phase (regression), and Telogen Phase (rest). Several signaling pathways are implicated in hair follicle regeneration. Mutations that affect the indicated stages of the cycle are noted in red text. Genes affected by these mutations are noted in black, italic text. Click on the image to view mutations. Click each mutation for more specific information.
Mutations of the hr gene cause alopecia and the presence of dermal cysts in both mice and humans (1;3).  The skin serves an important function as a barrier to the environment, and maintains its integrity by continuously renewing the epidermis, while also maintaining associated structures such as hair.  The surface epithelium of the skin is composed primarily of keratinocytes and is constantly regenerated as cells in the outer cornified layer are sloughed off and replaced by newly differentiated cells.  Hair is produced and maintained by the pilosebaceous unit consisting of a hair-producing follicle and a sebaceous gland composed of many different cell types (Figure 2A).  The hair follicle can be divided into 3 regions: the lower segment (bulb and suprabulb), the middle segment (isthmus), and the upper segment (infundibulum).  Eight epithelial layers are present in the hair follicle including the outer root sheath (ORS) that is continuous with the epidermis, the companion layer (CL), the inner root sheath (IRS) consisting of three layers (Henle’s, Huxley’s and cuticle) and the hair shaft, which also consists of three layers (cuticle, cortex and medulla) (20).  The layers of the hair follicle are derived from stem cells present in a specialized part of the ORS known as the bulge (21;22).  After hair follicles are established, hair is periodically shed and then replaced, involving periodic destruction and regeneration of hair follicles.  The hair cycle is divided into periods of follicle growth (anagen), followed by regression (catagen) and rest (telogen) (Figure 2B) (21;23).  During the regression phase, the lower half of the follicle undergoes apoptosis.  During the anagen phase, hair follicle growth is reinitiated as follicle stem cells are induced to proliferate.  A number of signaling pathways are implicated in skin and hair follicle morphogenesis and regeneration including Sonic hedgehog (Shh), Wnts, and TGF-β family members [reviewed in (22)].
 
In the mouse, the classical hairless (hr) and rhino (hrrh) homozygous mutants with mutations in the hairless gene develop a normal first coat, but do not reinitiate subsequent hair cycles resulting in alopecia (1;15;24).  Histologically, the skin of hairless and rhino mice are normal until the first hair cycle is nearly complete.  Just before the normal loss of the first coat, the hair follicles of these mutants appear altered.  The pilary canals widen, hair club formation is abnormal, with the IRS coalescing around the terminal part of the hair shaft so that the lower part of the ORS fails to follow the ascending hair club and becomes stranded in the dermis.  As the mutant animals age there is hypertrophy of the sebaceous glands, loss of adipose tissue, and the development of various types of cysts from the hyperkeratotic upper part of the hair canals, and the sheaths of the abnormal follicles stranded in the dermis (24-26).  Some dermal cysts may arise from sebaceous glands as they express stearoyl-coenzyme A desaturase 1 mRNA (Scd1; mutated in flake), and most cysts contain lipids.  Cells in the cysts remain undifferentiated (26).  Toward the end of HF morphogenesis, the proximal hair bulb undergoes premature and massive apoptosis associated with a lack of coordination of cell proliferation in defined HF compartments (25).  Although the hair follicle defects in both hairless and rhino mutants are similar, animals homozygous for rhino alleles also develop thickened and severely wrinkled skin (15).  The hr allele is caused by an integration of the murine leukemia virus pmv43 in intron 6 of the hr gene (1), and the presence of some correctly spliced mRNA is observed in hr/hr animals.  In contrast, most rhino mutations cause protein truncation and likely lead to non-functional HR proteins (15;26).  The generation of hr knockout mice resulted in animals with a phenotype similar to the most severe rhino mutants (24;26). 
 
Along with alopecia, mice with mutations in the hr gene exhibit various other defects including abnormalities found in the colon, retina, inner ear and thymus.  The thickness of the inner plexiform and ganglion cell layers in the retina was reduced in hrrh relative to wild type controls, while the number of neurons in the cochlea was also reduced and animals had a severe loss of both inner and outer hair cells with most of the remaining hair cells lacking stereocilia.  In addition, hr homozygous mice were found to have defects in gravity receptor neural function of the inner ear (27).  In the colon, mutant animals had an increased number of villi, while villi in the ileum area were shorter and extremely fragile (15).  The thymus of hairless mouse mutants show significant atrophy that increases with age (15;28).  Accordingly, various immunological defects have been reported for hr mutant mice including increased incidences of leukemia due to higher viral titers (29) and a lower cellular immune response to tumor viruses (30).  Hr animals display a relative deficiency in spleen T helper CD5+ cells at 3 months of age, and decreased cell proliferation in response to alloantigens and mitogen stimulation (31-33).  Although one report suggests hr animals have a defect in natural killer (NK) cell function (34), other data suggests cytotoxic NK and T cell responses are normal (33).  Mice homozygous for the hr mutation are much more sensitive to UV and chemically induced skin tumors than shaved controls (35;36).  
 
Multiple studies have established that HR is a nuclear receptor corepressor.  Nuclear receptors are transcription factors whose function is regulated by the binding of lipophilic ligands.  Upon binding of ligands, nuclear receptors are transported into the nucleus where they most often activate target gene transcription.  A subset of nuclear receptors, including the thyroid hormone receptors (TRs), vitamin D receptor (VDR), and retinoic acid receptors (RARs/RXRs) also repress transcription in the absence of their ligand.  The transcriptional activity of nuclear receptors depends on the association of coactivators and corepressors, many of which function in chromatin remodeling.  Most nuclear receptor corepressors facilitate repression via their association with histone deacetylases (HDACs) (37;38).  HR interacts with and mediates the repressive activity of multiple nuclear receptors including TRs, retinoic acid receptor-related orphan receptor α (RORα), and VDR (8-10;19).  Although HR does not directly interact with HDACs, it is a component of HDAC protein complexes and colocalizes with HDAC proteins in the nuclear matrix (7;8;18).  
 
In humans, at least 28 different mutations in the Hairless gene cause Alopecia Universalis Congenita or congenital atrichia (AUC; OMIM #203655) and Atrichia with Papular Lesions (APL; OMIM #209500), including missense, nonsense, splice-site and deletion/insertion mutations (3;39).  Patients with these conditions are normally born with hair that subsequently falls out resulting in a complete or nearly complete absence of all hair.  Histological studies show malformation of the hair follicles, similar to mice carrying pathogenic alleles of the hr gene (24;40).  Patients with APL also exhibit papular lesions, analogous to the cysts found in hairless mutant mice.  Despite the presence of immunological defects and other abnormalities present in hr mutant mice, humans with mutations in the HR gene do not have any evidence of immune dysfunction, susceptibility to skin tumors, or deafness (3).  HR does not appear to be involved in the development of androgenetic alopecia (AGA; OMIM %109200), as no polymorphic differences were found in the HR gene in patients with AGA (41). 
Putative Mechanism
Increasing evidence supports the model that HR acts as a repressor in vivo to regulate hair and skin morphogenesis.  Detailed examination of skin and hair follicles in hr-/- mice suggests that the skin wrinkling observed in certain hairless mutants is due to increased cell proliferation in the epidermis, and analysis of gene expression in hr-/- skin revealed upregulation of keratinocyte terminal differentiation markers including caspase 14 and Keratin 10 (mutated in Rough-fur) (26).  Additionally, expression of early markers of hair differentiation including sonic hedgehog (Shh) and components of the Wnt signaling pathway are not detected in hr-/- skin as the hair cycle fails in these animals.  It is likely that HR acts through the Wnt signaling pathway to regulate hair cycling as HR inhibits the expression of Wise (Wnt modulator in surface ectoderm) during follicle regeneration (17;23).  Importantly, Wise can inhibit signaling by Wnt10b (17), one of two Wnts expressed in hair follicles (49).  Through Wise, HR may also regulate BMP (bone morphogenetic protein) signaling in the hair follicle as Wise is a potential inhibitor of BMP signaling (50).  Finally, it is likely that HR negatively regulates the expression of ornithine decarboxylase (ODC) in the skin.  Transgenic mice overexpressing ornithine decarboxylase (ODC) in the outer root sheath of the hair follicle develop a skin phenotype that is similar to homozygous hr and rhino mice (51;52).  Chemical or UV stimulation of hr/hr skin produces a significant increase in ODC activity in the epidermis suggesting that overexpression of ODC may cause the susceptibility to skin tumors seen in mice carrying different mutations at hairless (35;36).
 
HR is likely to regulate hair cell cycling by modulating gene expression through its interaction with various nuclear receptors.  In vitro testing of HR proteins generated with point mutations found in pathogenic human alleles of HR discovered that these HR proteins were capable of interacting with nuclear receptors, but were not capable of repressive activity and were defective in HDAC interaction in vitro (42).  The alopecia and papular lesions induced by VDR mutations in humans are very similar to those seen in patients with Hr mutations (40;43).  VDR null mice also have initial hair growth that subsequently fails (44), and hr and VDR mRNAs are coexpressed in the hair follicle (10).  An activation defective VDR can rescue hair loss in VDR null mice, suggesting that the activation function of VDR is not required for hair growth.  This mutant is able to interact with HR and repress basal transcription, providing evidence that the repressive role of VDR through HR is important for regulating hair cycling (29).  Although HR does not interact directly with retinoid X receptors (RXRs), RXR receptors are known to form heterodimers with other nuclear receptors including VDR.  A skin-specific RXRα knockout, as well as an ENU-generated missense mutation in RXRα, result in animals exhibiting progressive alopecia and cyst formation (please see the record for pinkie) (45-47).  Interestingly, it appears that hr is itself repressed by VDR as hr mRNA is upregulated in VDR-deficient animals (44).  These results suggest that HR and the VDR/RXRα heterodimer may be involved in the same pathway during regulation of the hair follicle.  However, VDR-null mice do not exhibit the severe wrinkling found in many hr mutant animals, suggesting that HR also acts through other pathways in the skin.  Since thyroid hormone deficient humans and mice exhibit hair loss and skin defects, and TRs are expressed in most cells of the hair follicle, it is possible HR also interacts with TR in the skin and hair follicle to regulate skin and hair cycling (48). 
 
Hr was found to be a thyroid hormone (TH) responsive gene in the developing rat brain (2), and is expressed at high levels in the brains of rats, mice and humans (1-3;15;18), suggesting it may have a role in brain development or maintenance.  Hr expression is significantly lower in the brains of TRα- and TRα1-deficient animals and hypothyroid rats (2;18), and alterations in the size of cerebellar Purkinje cells have been reported for hr mutant mice and TH-deficient animals (54;55).  In humans, the lack of thyroid hormone during a critical perinatal period leads to mental retardation and cerebellar ataxia (55), although no neurological defects have been noted for either mice or humans with mutations in the HR gene (3;15).  However, the cochlear defects seen in hr mutant mice are similar to those found in congenital hypothyroid mutant mice and human TH deficiency disorders (15;55;56).  
 
The immunological defects found in some alleles of hairless are likely due to thymic abnormalities caused by defects in thymic epithelial cells as hr is expressed in and may have function in many epithelial cell types (15;28).  Hr is not expressed in mouse thymus, although low levels of thymic expression have been reported in rats and humans (2;4).  It is possible that hairless is expressed at low levels in the mouse or transiently during development, causing later thymic atrophy.  Mice with mutations in RXRα, which may interact with VDR and HR to regulate hair cycling, also exhibit alterations in T cell differentiation displaying a progressive impairment in T helper type 2 (Th2) antigen-specific IgG1 production following immunization with ovalbumin and alum (45).  This suggests that RXRα may also interact with HR to regulate T cell differentiation.  However, not all alleles of hr have immunological defects (53), and some reports are inconsistent (33;34), making it unclear if the immunological deficiencies observed in hairless mutant mice may be due to genetic background or modifiers.  
 
Prune, with its extremely wrinkled skin, closely resembles the rhino and knockout alleles of hr, suggesting that tyrosine 1082 is critical for HR repressive activity.  Tyrosine 1082 is highly conserved across species (1-3) and is located in the JmjC domain, which may mediate histone demethylase activity (14).  In humans, the region of the JmjC domain containing this tyrosine does not appear to be present in the skin-specific isoform of HR (4).  Moreover, none of the pathogenic human mutations causing APL/AUC are located in this region, although several are found in other parts of the JmjC domain (39).  Our results suggest a possible difference between the mouse and human HR proteins despite the high conservation found in this region.  Unlike mice, which exhibit phenotypic differences depending on the severity of the mutation, the phenotypic severity in humans has not been correlated with genotype, although several of the human alleles do cause protein truncations (39).  Immunological phenotypes of prune are currently being investigated.
Primers Primers cannot be located by automatic search.
Genotyping
Prune genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  
 
Primers for PCR amplification
Prune(F): 5’- TCCTGGGTTTTGGAGAAAGGGACAC -3’
Prune(R): 5’- AGCCGCCTTTACTGCTTGGAACAC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Prune_seq(F): 5’- CCAGGGTCACAGAAGCTATG -3’
Prune_seq(R): 5’- GAATGCTGTATGATCAGGACTCC -3’
 
The following sequence of 1248 nucleotides (from Genbank genomic region NC_000080 for linear DNA sequence of hr) is amplified:
 
16975                                                            tcctgg
16981 gttttggaga aagggacacg gagagaacaa ggggtcaggc cagggtcaca gaagctatga
17041 aaagcacatc ccagggaagg cagggattta gatccctcct cccaccccca gcttgagtgt
17101 cccttactct aagctccttc caatccaacc tggacctacc cccatcctgt cctatccctt
17161 accaccaacc ctcctctctc ctacctcttc cttcttttgc ctgcccttca agacagcttc
17221 agcaccctat tgaacctgat cttccaaaga gtccactccc cttcctctct gaatgcttgc
17281 cttcatcccc actgacattc atcttccttt ctcttcttga aggtgtgccc agctggagca
17341 ggaaccttgg agcctggtgc cccaggcagc tgctacttgg atgcagggtt gcgccgacgg
17401 ctaagagaag agtggggtgt gagctgctgg accctgctgc aggctcctgg ggaagcggtg
17461 ctggtcccgg ctggggcgcc ccatcaggtg cttacctggt gggtgggggt taacaaaaga
17521 tcagagtatc agaagtagca aggagtcctg atcatacagc attctctacc tgatagaaag
17581 ctaggcaggg caggaagcca tggagataga aagccaaggg tcttgaagtc ttcaaagcta
17641 tgtgggactc tctccagcat ccctcaggtc ttgttctggc catggccttt tgaatgtctg
17701 gttctgtaac tagggttggt tactgttttc tgaaagttgg ataaggaagt agacttagtg
17761 atcagaggca tggaggggga atgtggtttg agcctcaact caccctctct tgcccttgtt
17821 ccgcccccct ccctgcccac cccacggcac aggtgcaggg cctggtgagc acaatcagtg
17881 tcactcagca ctttctgtct cctgagacct ctgccctctc tgctcagctc taccaccagg
17941 gagccagcct accccctgac caccgtatgc tttatgccca ggtgagtgtg gtactggctt
18001 gaaggcagag tgtgctgctg ccctagtctc cttggggcac agccgcagta ggcaggacag
18061 atctgtctga gtggaatggg ctgctagcct gtcagtgcta gataaaggtg ttcttgagaa
18121 gggtagggag tgagggttgg tgctggaacg cgattgaaaa ttctgtgtca tttttctttt
18181 tcccagatgg accgggctgt gttccaagca gtaaaggcgg ct
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Bruce Beutler
List |< first << previous [record 6 of 17] next >> last >|
Edit History
2011-01-28 6:58 PM (current)
2010-11-08 10:26 AM
2010-11-02 2:54 PM
2010-11-02 2:54 PM
2010-02-03 4:28 PM