Phenotypic Mutation 'debil' (pdf version)
Alleledebil
Mutation Type missense
Chromosome13
Coordinate20,373,161 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Elmo1
Gene Name engulfment and cell motility 1
Synonym(s) C230095H21Rik, 6330578D22Rik, CED-12
Chromosomal Location 20,090,596-20,608,353 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired Sertoli cell phagocytosis of apoptotic male germ cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_198093, NM_080288; MGI:2153044

Mapped Yes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000072334]
SMART Domains Protein: ENSMUSP00000072334
Gene: ENSMUSG00000041112
AA Change: L424P

DomainStartEndE-ValueType
Pfam:DUF3361 115 280 3.8e-64 PFAM
Pfam:ELMO_CED12 303 481 2.8e-42 PFAM
PH 555 676 2.32e0 SMART
low complexity region 704 717 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000072519)
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD8 T cells in CD8 T cells - decreased
FACS NK cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(20) : Gene trapped(16) Radiation induced(1) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Elmo1 APN 13 20261579 missense probably benign
IGL00814:Elmo1 APN 13 20286724 missense probably damaging 0.97
IGL00849:Elmo1 APN 13 20582323 nonsense probably null
IGL01417:Elmo1 APN 13 20251175 critical splice donor site probably null
IGL01994:Elmo1 APN 13 20342464 missense probably damaging 0.99
IGL02435:Elmo1 APN 13 20589656 missense probably damaging 1.00
IGL02605:Elmo1 APN 13 20605202 missense probably damaging 1.00
IGL02716:Elmo1 APN 13 20449502 missense probably damaging 0.98
IGL03389:Elmo1 APN 13 20342426 missense probably damaging 0.98
Edinburg UTSW 13 20290383 nonsense probably null
sesame UTSW 13 20600212 nonsense probably null
H8562:Elmo1 UTSW 13 20280863 missense probably damaging 1.00
R0360:Elmo1 UTSW 13 20564493 nonsense probably null
R0364:Elmo1 UTSW 13 20564493 nonsense probably null
R0372:Elmo1 UTSW 13 20572459 critical splice donor site probably null
R0975:Elmo1 UTSW 13 20251137 missense probably damaging 0.98
R1167:Elmo1 UTSW 13 20185455 missense probably damaging 1.00
R1511:Elmo1 UTSW 13 20290477 missense possibly damaging 0.60
R1671:Elmo1 UTSW 13 20287884 splice site probably benign
R1677:Elmo1 UTSW 13 20589671 missense probably benign 0.22
R1868:Elmo1 UTSW 13 20589653 missense possibly damaging 0.78
R2941:Elmo1 UTSW 13 20600212 nonsense probably null
R3508:Elmo1 UTSW 13 20605232 missense probably damaging 1.00
R4344:Elmo1 UTSW 13 20261552 splice site probably null
R4378:Elmo1 UTSW 13 20373116 missense possibly damaging 0.96
R4423:Elmo1 UTSW 13 20600212 nonsense probably null
R4425:Elmo1 UTSW 13 20600212 nonsense probably null
R4516:Elmo1 UTSW 13 20282914 missense probably benign 0.11
R4862:Elmo1 UTSW 13 20449512 missense probably benign
R4990:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4991:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4992:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R5197:Elmo1 UTSW 13 20564437 missense probably benign 0.20
R5269:Elmo1 UTSW 13 20449486 missense probably benign 0.00
R5386:Elmo1 UTSW 13 20600210 missense probably benign 0.01
R5471:Elmo1 UTSW 13 20572385 missense probably benign 0.01
R5922:Elmo1 UTSW 13 20605169 missense probably damaging 1.00
R5947:Elmo1 UTSW 13 20290383 nonsense probably null
R6512:Elmo1 UTSW 13 20373161 missense probably damaging 1.00
R6531:Elmo1 UTSW 13 20572446 missense possibly damaging 0.91
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-01-07 11:30 AM by Anne Murray
Record Created 2018-12-28 11:58 AM by Bruce Beutler
Record Posted 2019-01-07
Phenotypic Description

Figure 1. Debil mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Debil mice exhibit reduced frequencies of peripheral central memory CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Debil mice exhibit reduced frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The debil phenotype was identified among G3 mice of the pedigree R6512, some of which showed increased frequencies of CD8+ T cells in CD3+ T cells (Figure 1) with concomitant reduced frequencies of central memory CD8 T cells in CD8 T cells (Figure 2) and NK cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the reduced NK cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R6512. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Elmo1:  a T to C transition at base pair 20,373,161 (v38) on chromosome 13, or base pair 282,655 in the GenBank genomic region NC_000079 encoding Elmo1. The strongest association was found with a recessive model of inheritance to the normalized NK cell frequency, wherein 14 variant homozygotes departed phenotypically from 25 homozygous reference mice and 34 heterozygous mice with a P value of 6.542 x 10-7 (Figure 4).

 

The mutation corresponds to residue 1,609 in the mRNA sequence NM_080288 within exon 15 of 22 total exons.

 

1593 GAGCTGACCAAGATGCTGTGTGAGATCCTCAAA
419  -E--L--T--K--M--L--C--E--I--L--K-

 

The mutated nucleotide is indicated in red. The mutation results in a leucine to proline substitution at position 424 (L424P) in the ELMO1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction
Figure 5 Domain organization of ELMO1. The debil mutation results in a leucine to proline substitution at position 424. Mutations found in the ELMO1 protein are shown in red. Click on each mutation for more information. Abbreviations: PH, pleckstrin homology domain; SH3, SH3-binding motif.

ELMO1 (engulfment and cell motility protein 1; alternatively, CED-12) has an ELMO domain (amino acids 391 to 492), a pleckstrin homology (PH) domain (amino acids 555 to 676), and a Pro-rich SH3-binding motif (amino acids 707 to 714) (Figure 5). Amino acids 1 to 280 bind to RhoG (1), ezrin/radixin/moesin (ERM) proteins (2), and Salmonella IpgB1 (3). The function of the ELMO domain is unknown. PH domains domains bind proteins such as the beta/gamma subunits of heterotrimeric G proteins and protein kinase C as well as phosphatidylinositol within biological membranes. PH domains recruit proteins to different membranes, thus targeting them to appropriate cellular compartments or enabling them to interact with other components of the signal transduction pathways. The ELMO and PH domains as well as the SH3-binding motif as well as an α-helical extension of the PH domain mediate the interaction with DOCK180 (4-6).

 

The debil mutation results in a leucine to proline substitution at position 424 (L424P) in the ELMO1 protein; residue 646 is within the ELMO domain. 

 

Please see the record Edinburg for more information about Elmo1.

Putative Mechanism

ELMO1 is an adaptor protein that interacts with members of the DOCK family (see the records frazz, moonlight, and snowdrop for information about DOCK2, DOCK7, and DOCK8, respectively) to promote the activation of the small GTPase RAC, phagocytosis, and cell migration (7-10).

 

ELMO1 functions downstream of the phagocytic receptor BAI1 (see the record for bunting) during apoptotic cell clearance (11;12).  BAI1 functions in the recognition and subsequent internalization of apoptotic cells (12). In macrophages, BAI1 functions as a pattern recognition receptor in the phagocytic uptake of Gram-negative bacteria (12). BAI1 interacts with ELMO1, which subsequently activates DOCK180 (13).

 

ELMO1 functions in G-protein coupled receptor (GPCR)-mediated chemotaxis upon stimulation of CXCR4 and CCR7 (see the record for lanzhou) (14-16). CD4+ T cells from Elmo1-deficient (Elmo1-/-) mice exhibited impaired polarization, Rac activation, and chemotaxis in response to CCR7 and CXCR4 stimulation (15;16). GPCRs couple with a heterotrimeric G protein to mediate its downstream effects. G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex. Activation of chemokine receptors promotes an interaction between ELMO1 and Gβγ, which causes translocation of ELMO1 to the membrane. ELMO1/DOCK180 or ELMO1/DOCK2 subsequently activate Rac1.

 

ELMO1 interacts with ERM proteins (2), which function in cell migration, cell adhesion, cell shape maintenance, and microvilli formation by cross-linking the plasma membrane with the actin cytoskeleton. ERM proteins are involved in cell cortex organization at two important stages of T lymphocyte physiology: during the polarization and migration in response to chemokines, and during the formation of the immunological synapse upon antigen recognition.

 

Elmo1-deficient (Elmo1-/-; Elmo1tm1.2Ravi/tm1.2Ravi) mice are overtly normal (11). Elmo1-/- mice exhibited disrupted seminiferous epithelium, multinucleated giant cells, uncleared apoptotic germ cells, and decreased sperm output (11). A second Elmo1-/- mouse model (Elmo1tm1a(EUCOMM)Wtsi/tm1a(EUCOMM)Wtsi) exhibited reduced numbers of mature B cells, natural killer T cells, and CD4+ CD25+ regulatory T cells with concomitant increased numbers of effector memory CD4+ T cells. Some mice also exhibited decreased fasted circulating glucose levels.

 

The phenotype of the debil mice indicate loss of ELMO1-associated function.

Primers PCR Primer
debil(F):5'- ATCAAAGTCTGTGTTCTCTGTGTTC -3'
debil(R):5'- ATGTAGGAAACCCGAGCCAG -3'

Sequencing Primer
debil_seq(F):5'- AGAGGCTGTCGTGATCCACTTTAC -3'
debil_seq(R):5'- CCCGAGCCAGAGAAGGGAC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, and Bruce Beutler