Phenotypic Mutation 'Poorly3' (pdf version)
AllelePoorly3
Mutation Type critical splice donor site (2 bp from exon)
Chromosome9
Coordinate72,015,636 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Tcf12
Gene Name transcription factor 12
Synonym(s) HTF-4, ALF1, HEB, bHLHb20, HEBAlt, REB, HTF4, ME1
Chromosomal Location 71,842,688-72,111,871 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011544 (variant 1), NM_001253862 (variant 2), NM_001253863 (variant 3), NM_001253864 (variant 4), NM_001253865 (variant 5); MGI:101877

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000034755] [ENSMUSP00000139365] [ENSMUSP00000138939] [ENSMUSP00000138952] [ENSMUSP00000139084] [ENSMUSP00000139284] [ENSMUSP00000139248] [ENSMUSP00000138832] [ENSMUSP00000139364] [ENSMUSP00000139233] [ENSMUSP00000138925]
SMART Domains Protein: ENSMUSP00000034755
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139365
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138939
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably null
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139084
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 5e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139284
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 85 108 4e-8 PDB
low complexity region 116 127 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
Predicted Effect probably benign
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000138832
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 173 196 6e-8 PDB
low complexity region 204 215 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 348 359 N/A INTRINSIC
low complexity region 554 568 N/A INTRINSIC
HLH 603 656 7.54e-10 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139364
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000138925
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 534 548 N/A INTRINSIC
HLH 583 636 7.54e-10 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
FACS B:T cells - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - increased
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(42) : Chemically induced (ENU)(2) Chemically induced (other)(1) Endonuclease-mediated(1) Gene trapped(35) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Tcf12 APN 9 71868118 missense probably damaging 0.98
IGL01311:Tcf12 APN 9 71858656 splice site probably benign
IGL01734:Tcf12 APN 9 71922648 splice site probably null
IGL01768:Tcf12 APN 9 71868996 splice site probably null
IGL02625:Tcf12 APN 9 71922757 missense probably damaging 1.00
IGL02671:Tcf12 APN 9 72109717 missense probably damaging 1.00
IGL03395:Tcf12 APN 9 71876022 missense probably damaging 1.00
Poorly UTSW 9 71944016 nonsense probably null
Poorly2 UTSW 9 71858929 missense probably damaging 1.00
Substandard UTSW 9 71858840 missense probably null 0.54
R0183:Tcf12 UTSW 9 71917027 missense probably damaging 0.99
R0257:Tcf12 UTSW 9 71858622 missense probably benign 0.05
R1126:Tcf12 UTSW 9 72000433 missense probably benign 0.09
R1520:Tcf12 UTSW 9 71883106 critical splice donor site probably null
R1690:Tcf12 UTSW 9 71870072 critical splice donor site probably null
R1819:Tcf12 UTSW 9 72109717 missense probably damaging 1.00
R1850:Tcf12 UTSW 9 71868215 missense probably damaging 1.00
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R2402:Tcf12 UTSW 9 71856510 missense probably damaging 1.00
R4445:Tcf12 UTSW 9 71869063 missense probably damaging 0.99
R4693:Tcf12 UTSW 9 71868967 intron probably benign
R4814:Tcf12 UTSW 9 71870041 intron probably benign
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4885:Tcf12 UTSW 9 71858840 missense probably null 0.54
R5347:Tcf12 UTSW 9 71885243 missense probably damaging 1.00
R5422:Tcf12 UTSW 9 71869038 missense probably damaging 1.00
R5650:Tcf12 UTSW 9 71885302 splice site probably null
R5713:Tcf12 UTSW 9 71885263 makesense probably null
R5789:Tcf12 UTSW 9 71885236 missense probably damaging 1.00
R5964:Tcf12 UTSW 9 71868240 missense probably damaging 1.00
R6012:Tcf12 UTSW 9 71858947 missense possibly damaging 0.62
R6119:Tcf12 UTSW 9 71868265 missense probably damaging 1.00
R6240:Tcf12 UTSW 9 71944016 nonsense probably null
R6299:Tcf12 UTSW 9 71858929 missense probably damaging 1.00
R6449:Tcf12 UTSW 9 71868268 missense probably damaging 1.00
R6489:Tcf12 UTSW 9 72015636 critical splice donor site probably null
R6984:Tcf12 UTSW 9 72006759 nonsense probably null
X0021:Tcf12 UTSW 9 71883172 missense probably damaging 0.99
X0022:Tcf12 UTSW 9 72109743 missense probably damaging 0.99
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-02-12 11:48 AM by Diantha La Vine
Record Created 2019-01-07 6:38 PM by Bruce Beutler
Record Posted 2019-01-09
Phenotypic Description
Figure 1. Poorly3 mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Poorly3 mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Poorly3 mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Poorly3 mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Poorly3 mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Poorly3 phenotype was identified among G3 mice of the pedigree R6489, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2) as well as reduced CD4 to CD8 T cell ratios (Figure 3) due to reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 4) with concomitant increased frequencies of CD8+ T cells (Figure 5), all in the peripheral blood.

Nature of Mutation

Figure 6. Linkage mapping of the increased CD8+ T cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R6489. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tcf12:  a T to C transition at base pair 72,015,636 (v38) on chromosome 9, or base pair 96,184 in the GenBank genomic region NC_000075 within the splice donor site of intron 4. The strongest association was found with an additive model of inheritance to the increased CD8+ T cell frequency, wherein two homozygotes and 14 heterozygous mice departed phenotypically from 12 homozygous reference mice with a P value of 7.292 x 10-7 (Figure 6).  

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in skipping of the 74-base pair exon 4. The mutation would cause a frame-shifted protein product beginning after amino acid 50 of the protein, which is normally 706 amino acids in length, and termination after the inclusion of eight aberrant amino acids.

 

          <--exon 3      <--exon 4 intron 4-->         exon 5-->
402 ……TTCAGCGGGTCAG ……GATTCATCTAGA gtaagttttcttaagtc…… GGTTTTACAGACAGCCCTCATTACAGTGA
46  ……-F--S--G--S-- ……-D--S--S--R-                     G--F--Y--R--Q--P--S--L--Q--*-
        correct         deleted                                   aberrant

 

The donor splice site of intron 4, which is destroyed by the Poorly3 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction
Figure 7. Domain organization of HEB. The Poorly3 mutation is within the donor splice site of intron 4. The mutation is predicted to result in skipping of the 74-base pair exon 4, causing a frame-shifted protein product beginning after amino acid 50 of the protein and termination after the inclusion of eight aberrant amino acids. Click on other mutations to view additional information. Abbreviations: AD1, activation domain 1; AD2, activation domain 2; bHLH, basic helix-loop-helix.

Tcf12 encodes HeLa E-box binding protein (HEB; alternatively, helix-loop-helix transcription factor-4 [HTF4] or ME1), a member of the class I basic helix-loop-helix (bHLH) transcription factor family. Class I bHLH transcription factors recognize the E box (sequence: CANNTG) in target DNA and are designated as E proteins. E proteins have several similar domains, including a C-terminal bHLH domain and two transcriptional activation domains (AD1 and AD2) [Figure 7; (1); reviewed in (2)]. HEB also has a leucine zipper. The bHLH domains facilitate the dimerization of bHLH proteins, which is required for their transcriptional activity [reviewed in (2)]. The bHLH domain also facilitates interaction with p300, a component of the transcriptional machinery (3). P300 subsequently recruits histone acetyltransferases and RNA polymerase II to the promoter or enhancers of target genes. The AD1 domain recruits the SAGA chromatin remodeling complex as well as the CBP and p300 histone acetyltransferases (4). The AD1 domain also represses transcription by recruiting a family of corepressors called ETO (5). The AD2 domain can drive the expression of reporter constructs containing bHLH target genes (4).

 

TCF12 has two transcription start sites and undergoes alternatively splicing to produce a shorter HEB variant, HEBalt (6). HEBalt lacks the AD1 domain, but shares the AD2 and bHLH domain with canonical HEB. HEBAlt has a unique domain, the Alt domain, upstream of AD2 compared to canonical HEB. HEBalt is expressed in pro-T cells and enhances the generation of T cell precursors. TCF12 also has two alternative acceptor sites preceding the second exon, which produces two distinct transcripts, HTF4a and HTF4b (7). HTF4a and HTF4b differ in their 5’-UTR, but share identical coding sequences. A cell-type specific protein, HTF4c, is produced by differential utilization of exon 15.

 

The Poorly3 mutation is predicted to result in a frame-shift after amino acid 50 and termination after the inclusion of eight amino acids.

 

Please see the record Poorly for more information about Tcf12.

Putative Mechanism

HEB and another E protein, E2A, regulate lymphocyte development and differentiation. E2A and HEB form homo- or heterodimers to activate the transcription of target genes. E2A homodimers are essential for B cell development, while E2A-HEB heterodimers are essential for T cell development (8). E2A and HEB cooperate to maintain DP T cell fate and to control the DP to SP transition until a functional alphabetaTCR is produced (9;10). HEB functions in TCRα and TCRβ gene rearrangement (11;12) as well as in the regulation of pTα (10;13;14) and CD4 (8) gene expression. HEB also putatively assists in the downregulation of IL7R signaling after β-selection. HEB is required for the development of CD73+ and CD73 γδT17 cells in the fetal thymus (15). In addition HEB is required for the expression of Sox4, Sox13, and Rorc in immature CD24+CD73 γδ T cells (15). HEB interacts with Notch1 and GATA3 to regulate T cell fate choice in developing thymocytes (16). HEB-deficient T cell precursors show compromised Notch1 function and lose T cell potential. After reconstitution of the HEB-deficient T cell precursors with Notch1, the cells adopted a DN1-like phenotype and could be induced to differentiate into thymic NK cells.

 

Tcf12-deficient (Tcf12-/-) mice on the 129/Sv * C57BL/6 genetic background exhibited postnatal lethality within two weeks of birth (17). Tcf12-/- mice showed a 50 percent reduction in the number of pro-B cells (17). Tcf12-/- mice on the 129S7/SvEvBrd genetic background showed reduced thymocyte numbers due to a block in T cell development at the immature single positive stage (18). Tcf12-/- mice on the 129S7/SvEvBrd * C57BL/6J genetic background showed thymus hypoplasia, increased numbers of double-negative T cells and CD8+ T cells with a concomitant reduction in the number of double-positive T cells (19). A Tcf12 mutant (HEBbm/bm) mouse with point mutations within the basic DNA-binding region (R611G, L612H, R613G) showed postnatal lethality within two weeks of birth and postnatal growth retardation (18). Some fetuses showed exencephaly. The HEBbm/bm mice also showed thymus hypoplasia; reduced thymocyte numbers; impaired B cell differentiation with reduced immature B cell, pro-B cell, and pre-B cell numbers; and aberrant T cell differentiation (i.e., severe block at the DN3 stage of T-cell development) with increased double-negative T cell number, reduced double-positive T cell number, and loss of single-positive T cells in the thymus (18). Approximately 10 to 20 percent of HEBbm/+ mice showed seizure episodes upon handling by the tail (18).

 

The phenotypes observed in the Poorly3 mice indicate loss of HEB-associated function in T and B cell development.

Primers PCR Primer
Poorly3(F):5'- ACTGTAGGCAAAGCAGATCTG -3'
Poorly3(R):5'- CATACCATCATGTGAACTTCGTTC -3'

Sequencing Primer
Poorly3_seq(F):5'- GCAAAGCAGATCTGGATAATACC -3'
Poorly3_seq(R):5'- GTTCTCTTATGCACTATCTGAAACG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler