Phenotypic Mutation 'm2sd3' (pdf version)
Allelem2sd3
Mutation Type missense
Chromosome5
Coordinate64,954,241 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Tlr6
Gene Name toll-like receptor 6
Chromosomal Location 64,953,106-64,960,048 bp (-)
MGI Phenotype Inactivation of this gene results in abnormal macrophage function.
Accession Number

NCBI RefSeq: NM_011604; MGI: 1341296

Mapped Yes 
Amino Acid Change Isoleucine changed to Threonine
Institutional SourceBeutler Lab
Ref Sequences
I441T in Ensembl: ENSMUSP00000062096 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 7.67e-2 SMART
Blast:LRR 110 129 N/A BLAST
LRR 131 155 2.76e1 SMART
Blast:LRR 387 410 N/A BLAST
Blast:LRR 413 437 N/A BLAST
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
(Using Ensembl: ENSMUSP00000062096)
Phenotypic Category immune system, TLR signaling defect: TNF production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(1) Chemically induced(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense possibly damaging 0.77
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 0.99
IGL01705:Tlr6 APN 5 64954130 missense possibly damaging 0.91
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.02
insouciant UTSW 5 64954583 missense possibly damaging 0.75
m2sd1 UTSW 5 6540276 nonsense
m2sd2 UTSW 5 6540076 nonsense
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense possibly damaging 0.89
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Lost
Repository

MMRRC: 030960-UCD 

Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 02/03/2009
Phenotypic Description
Figure 1. Graph depicting impaired TNF-α production of m2sd3 peritoneal macrophages in response to MALP-2 (red circle). Also shown are the responses from macrophages isolated from other ENU-mutagenized G3 mice.
The m2sd3 (MALP-2-specific defect 3) mutant was discovered in a screen of ENU-mutagenized G3 mice for altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen).  Peritoneal macrophages from a single G3 male showed reduced tumor necrosis factor (TNF)-α production in response to the TLR2/6 ligand MALP-2 (macrophage-activating lipopeptide-2; Figure 1), but normal responses to the TLR2/1 ligand Pam3CSK4 (triacyl lipopeptide), the TLR4 ligand lipopolysaccharide (LPS), the TLR9 ligand CpG-DNA (single-stranded DNA), the TLR 7 ligand resiquimod/R-848 (single-stranded RNA mimetic), and the TLR3 ligand poly I:C (double-stranded RNA).  M2sd3 macrophages also responded normally to the TLR2/6 ligand peptidoglycan (PGN); contamination from a TLR1/2 ligand is likely as TLR6-deficient mice responded normally to this ligand, but TLR2-deficient animals did not.  The m2sd3 phenotype was confirmed on two additional occasions, including once by MALP-2 dose response, which revealed partial TNF responses at higher concentrations of MALP-2.   
 
The index m2sd3 male did not breed after 6 months, and was azoospermic. G2 parents have also not bred and the mutation is considered to be lost.

 

Nature of Mutation
Because the m2sd3 phenotype is almost identical to that of Tlr6-/- mice, Tlr6 (Chromosome 5) from the m2sd3 mutant was sequenced.  A mutation corresponding to a T to C transition at position 1454 of the Tlr6 transcript, in exon 2 of 2 total exons, was identified.
 
1438 GCCTGGGCTGAGAGCATATTGGTGTTGAATTTG
436  -A--W--A--E--S--I--L--V--L--N--L-
 
The mutated nucleotide is indicated in red lettering, and results in conversion of isoleucine to threonine at residue 441 of the TLR6 protein.
Protein Prediction
Figure 2. Protein and domain structure of TLR6. A, Schematic representation of TLR6 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the m2sd3 mutation is highlighted. 3D image was created using UCSF Chimera. B, TLR6 is an 806 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The m2sd3 mutation (red asterisk) results in a conversion of isoleucine to threonine at residue 441 of the TLR6 protein.This image is interactive. Click on the image to view other mutations found in TLR6 (red). Click on the mutations for more specific information.
The isoleucine residue in TLR6 altered due to the m2sd3 mutation is located near the beginning of the eleventh leucine rich repeat (LRR) (Figure 2).  It is unknown if normal levels of the altered protein are expressed, but this residue is predicted to contribute to the characteristic structure of the LRR, and thus is likely to be critical for function (1).  
 
Please see the record for insouciant for information about Tlr6.
Primers Primers cannot be located by automatic search.
Genotyping
M2sd3 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.   
 
Primers for PCR amplification
M2sd3(F): 5’- GTTGCAAAACATCTCTTGCTGCCC -3’
M2sd3(R): 5’- TGCTACATTGAGTTCCTGCAAAGCC -3’
 
PCR program (use SIGMA JumpStart REDTaq)
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
M2sd3_seq (F): 5’- TTACTTACTCGGAGACAGCACTG -3’
 
The following sequence of 1111 nucleotides (from Genbank genomic region NC_000071 for linear genomic sequence of Tlr6) is amplified: 
 
4838                                         gtt gcaaaacatc tcttgctgcc
4861 ctatggcgag cctgaggcat ctagacctct cattcaatga ctttgatgta ctgcctgtgt
4921 gtaaggaatt tggcaacctg acgaagctga ctttcctggg attaagtgct gcaaagttcc
4981 gacaactgga tctgctccca gttgctcact tgcatctaag ctgcattctt ctggacttag
5041 tgagttatca tataaaaggc ggggaaacag aaagtcttca gattcccaat accaccgttc
5101 tccatttggt ctttcatcca aatagcttgt tctctgttca agtgaacatg tctgtaaacg
5161 ctttaggaca tttacaactg agtaatatta aattgaatga tgaaaactgt caaaggttaa
5221 tgacattttt atcagaactc accagaggtc caaccttatt gaatgtgacc ctccagcaca
5281 tagaaacaac ctggaagtgc tcggttaaac ttttccaatt cttttggccc cgaccggtgg
5341 agtacctcaa tatttacaac ttaacgataa ctgagagaat cgacagggaa gaatttactt
5401 actcggagac agcactgaag tcactgatga tagagcacgt caaaaaccaa gtgttcctct
5461 tttcaaagga ggcgctatac tcggtgtttg ctgagatgaa catcaagatg ctctctatct
5521 cagacacccc tttcatccac atggtgtgcc cgccatcccc aagctcattt acatttctga
5581 actttaccca gaatgttttt actgacagtg tttttcaagg ctgttccacc ttaaagagat
5641 tgcagacact tatcttacaa aggaatggtt tgaagaactt ttttaaagta gctctcatga
5701 ctaagaatat gtcctctctg gaaactttgg atgttagttt gaattctttg aactctcatg
5761 catatgacag gacatgcgcc tgggctgaga gcatattggt gttgaatttg tcttcgaata
5821 tgcttacagg ctctgtcttc agatgcttac ctcccaaggt caaggtcctt gaccttcaca
5881 acaacaggat aatgagcatc cctaaagatg tcacccacct gcaggctttg caggaactca
5941 atgtagca
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
Science Writers Eva Marie Y. Moresco, Nora G. Smart
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Bruce Beutler
Edit History
06/01/2011 10:46 AM (current)
06/01/2011 10:28 AM
06/01/2011 10:28 AM
05/27/2011 10:46 AM
05/27/2011 10:41 AM
11/08/2010 11:40 AM
06/25/2010 12:11 PM
06/25/2010 11:50 AM
06/25/2010 11:49 AM
02/03/2010 5:18 PM