Phenotypic Mutation 'm2sd3'

• Allele: m2sd3
• Mutation Type: missense
• Chromosome: 5
• Coordinate: 65,111,584 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Tlr6
• Gene Name: toll-like receptor 6
• Chromosomal Location: 65,109,374-65,117,440 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011] ; PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9EPW9
• SMART Domains: Protein: ENSMUSP00000062096; Gene: ENSMUSG00000051498; AA Change: I441T

Domain	Start	End	E-Value	Type
LRR_TYP	86	109	7.67e-2	SMART
LRR	131	155	2.76e1	SMART
LRR	461	482	6.23e1	SMART
LRR	483	507	4.57e0	SMART
LRRCT	540	594	4.06e-11	SMART
transmembrane domain	596	618	N/A	INTRINSIC
TIR	652	795	5.37e-37	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
  (Using ENSMUST00000062315)
• SMART Domains: Protein: ENSMUSP00000143865; Gene: ENSMUSG00000051498

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
LRR_TYP	86	109	3.3e-4	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.144)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Lost
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2009-02-03
• Science Writers: Eva Marie Y. Moresco, Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Owen M. Siggs, Bruce Beutler

Accession Number

NCBI RefSeq: NM_011604; MGI: 1341296

Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(1) Chemically induced(4)

Repository

MMRRC: 030960-UCD 

Phenotypic Description

Figure 1. Graph depicting impaired TNF-α production of m2sd3 peritoneal macrophages in response to MALP-2 (red circle). Also shown are the responses from macrophages isolated from other ENU-mutagenized G3 mice.

The m2sd3 (MALP-2-specific defect 3) mutant was discovered in a screen of ENU-mutagenized G3 mice for altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen).  Peritoneal macrophages from a single G3 male showed reduced tumor necrosis factor (TNF)-α production in response to the TLR2/6 ligand MALP-2 (macrophage-activating lipopeptide-2; Figure 1), but normal responses to the TLR2/1 ligand Pam₃CSK₄ (triacyl lipopeptide), the TLR4 ligand lipopolysaccharide (LPS), the TLR9 ligand CpG-DNA (single-stranded DNA), the TLR 7 ligand resiquimod/R-848 (single-stranded RNA mimetic), and the TLR3 ligand poly I:C (double-stranded RNA).  M2sd3 macrophages also responded normally to the TLR2/6 ligand peptidoglycan (PGN); contamination from a TLR1/2 ligand is likely as TLR6-deficient mice responded normally to this ligand, but TLR2-deficient animals did not.  The m2sd3 phenotype was confirmed on two additional occasions, including once by MALP-2 dose response, which revealed partial TNF responses at higher concentrations of MALP-2.   

 

The index m2sd3 male did not breed after 6 months, and was azoospermic. G2 parents have also not bred and the mutation is considered to be lost.

Nature of Mutation

Because the m2sd3 phenotype is almost identical to that of Tlr6^-/- mice, Tlr6 (Chromosome 5) from the m2sd3 mutant was sequenced.  A mutation corresponding to a T to C transition at position 1454 of the Tlr6 transcript, in exon 2 of 2 total exons, was identified.

 

1438 GCCTGGGCTGAGAGCATATTGGTGTTGAATTTG

436  -A--W--A--E--S--I--L--V--L--N--L-

 

The mutated nucleotide is indicated in red lettering, and results in conversion of isoleucine to threonine at residue 441 of the TLR6 protein.

Protein Prediction

Figure 2. Protein and domain structure of TLR6. A, Schematic representation of TLR6 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the m2sd3 mutation is highlighted. 3D image was created using UCSF Chimera. B, TLR6 is an 806 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The m2sd3 mutation (red asterisk) results in a conversion of isoleucine to threonine at residue 441 of the TLR6 protein.This image is interactive. Click on the image to view other mutations found in TLR6 (red). Click on the mutations for more specific information.

The isoleucine residue in TLR6 altered due to the m2sd3 mutation is located near the beginning of the eleventh leucine rich repeat (LRR) (Figure 2).  It is unknown if normal levels of the altered protein are expressed, but this residue is predicted to contribute to the characteristic structure of the LRR, and thus is likely to be critical for function (1).  

 

Please see the record for insouciant for information about Tlr6.

Primers

Primers cannot be located by automatic search.

Genotyping

M2sd3 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.   

 

Primers for PCR amplification

M2sd3(F): 5’- GTTGCAAAACATCTCTTGCTGCCC -3’

M2sd3(R): 5’- TGCTACATTGAGTTCCTGCAAAGCC -3’

 

PCR program (use SIGMA JumpStart REDTaq)

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

M2sd3_seq (F): 5’- TTACTTACTCGGAGACAGCACTG -3’

 

The following sequence of 1111 nucleotides (from Genbank genomic region NC_000071 for linear genomic sequence of Tlr6) is amplified: 

 

4838                                         gtt gcaaaacatc tcttgctgcc

4861 ctatggcgag cctgaggcat ctagacctct cattcaatga ctttgatgta ctgcctgtgt

4921 gtaaggaatt tggcaacctg acgaagctga ctttcctggg attaagtgct gcaaagttcc

4981 gacaactgga tctgctccca gttgctcact tgcatctaag ctgcattctt ctggacttag

5041 tgagttatca tataaaaggc ggggaaacag aaagtcttca gattcccaat accaccgttc

5101 tccatttggt ctttcatcca aatagcttgt tctctgttca agtgaacatg tctgtaaacg

5161 ctttaggaca tttacaactg agtaatatta aattgaatga tgaaaactgt caaaggttaa

5221 tgacattttt atcagaactc accagaggtc caaccttatt gaatgtgacc ctccagcaca

5281 tagaaacaac ctggaagtgc tcggttaaac ttttccaatt cttttggccc cgaccggtgg

5341 agtacctcaa tatttacaac ttaacgataa ctgagagaat cgacagggaa gaatttactt

5401 actcggagac agcactgaag tcactgatga tagagcacgt caaaaaccaa gtgttcctct

5461 tttcaaagga ggcgctatac tcggtgtttg ctgagatgaa catcaagatg ctctctatct

5521 cagacacccc tttcatccac atggtgtgcc cgccatcccc aagctcattt acatttctga

5581 actttaccca gaatgttttt actgacagtg tttttcaagg ctgttccacc ttaaagagat

5641 tgcagacact tatcttacaa aggaatggtt tgaagaactt ttttaaagta gctctcatga

5701 ctaagaatat gtcctctctg gaaactttgg atgttagttt gaattctttg aactctcatg

5761 catatgacag gacatgcgcc tgggctgaga gcatattggt gttgaatttg tcttcgaata

5821 tgcttacagg ctctgtcttc agatgcttac ctcccaaggt caaggtcctt gaccttcaca

5881 acaacaggat aatgagcatc cctaaagatg tcacccacct gcaggctttg caggaactca

5941 atgtagca

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

1. Jin, M. S., Kim, S. E., Heo, J. Y., Lee, M. E., Kim, H. M., Paik, S. G., Lee, H., and Lee, J. O. (2007) Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide, Cell 130, 1071-1082.