Phenotypic Mutation 'Memorial'

• Allele: Memorial
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 19,546,409 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Bcl3
• Gene Name: B cell leukemia/lymphoma 3
• Synonym(s): Bcl-3
• Chromosomal Location: 19,542,387-19,556,691 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice lacking functional copies of this gene exhibit defects of the immune system including disruption of the humoral immune response and abnormal spleen and Peyer's patch organogenesis. Mutant mice show increased susceptibility to pathogens. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Asparagine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000113851] [ENSMUSP00000117754]
• AlphaFold: Q9Z2F6
• SMART Domains: Protein: ENSMUSP00000113851; Gene: ENSMUSG00000053175; AA Change: N142I

Domain	Start	End	E-Value	Type
ANK	129	162	4.01e0	SMART
ANK	166	195	4.43e-2	SMART
ANK	199	230	8.99e-3	SMART
ANK	236	265	3.23e-4	SMART
ANK	270	299	5.79e-6	SMART
ANK	303	332	1.4e1	SMART
low complexity region	377	402	N/A	INTRINSIC
low complexity region	425	447	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000120537)
• SMART Domains: Protein: ENSMUSP00000117754; Gene: ENSMUSG00000053175

Domain	Start	End	E-Value	Type
Pfam:Ank_5	1	52	7.2e-7	PFAM
low complexity region	85	94	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000116129; Gene: ENSMUSG00000053175

Domain	Start	End	E-Value	Type
ANK	66	99	4.01e0	SMART
ANK	103	132	4.43e-2	SMART

• Predicted Effect: noncoding transcript
• Meta Mutation Damage Score: 0.3889
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2020-07-29 6:45 PM by External Program
• Record Created: 2019-01-22 7:37 AM by Bruce Beutler
• Record Posted: 2019-04-03
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_033601; MGI:88140

Alleles Listed at MGI

All Mutations and Alleles(51) : Chemically induced (ENU)(2) Gene trapped(38) Targeted(11)

Phenotypic Description

Figure 1. Memorial mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells . Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The memorial phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R6232, some of which showed increased frequencies of central memory CD8 T cells in CD8 T cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased central memory CD8 T cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R6232. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. The increased central memory CD8 T cell frequency phenotype was linked by continuous variable mapping to a mutation in Bcl3:  an A to T transversion at base pair 19,812,484 (v38) on chromosome 7, or base pair 10,284 in the GenBank genomic region NC_000073. Linkage was found with an additive model of inheritance, wherein five variant homozygotes and 14 heterozygous mice departed phenotypically from nine homozygous reference mice with a P value of 0.000635  (Figure 2).  

The mutation corresponds to residue 503 in the mRNA sequence NM_033601 within exon 3 of 9 total exons.

487 GCTGTGGTCCAGAATAACATAGCCGCTGTCTAC 137 -A--V--V--Q--N--N--I--A--A--V--Y-

The mutated nucleotide is indicated in red. The mutation results in an asparagine to isoleucine substitution at position 142 (N142I) in the BCL3 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 1. Domain organization of Bcl-3. Bcl-3 has seven ankyrin repeats, a proline-rich N-terminal domain and a serine/proline-rich C-terminal domain. The memorial mutation results in substitution of asparagine 142 for isoleucine. Other mutations found in Bcl-3 are noted in red. Click on the mutations to view more information.

Bcl-3 (B cell leukemia-3) is a member of the atypical subfamily of the IκB family. The atypical IκB molecules are not degraded following NF-κB pathway activation and are localized primarily in the nucleus where they interact with NF-κB dimers to regulate transcription. IκB family members share a common feature: multiple ankyrin repeats. Bcl-3 has seven ankyrin repeats, a proline-rich N-terminal domain and a serine/proline-rich C-terminal domain (1). The ankyrin repeats mediate the interaction with the NF-κB subunit, p50 (2;3).

The memorial mutation results in an asparagine to isoleucine substitution at position 142 (N142I); residue 142 is within the first ankyrin repeat.

Please see the record sunrise for more information about Bcl3.

Putative Mechanism

The NF-κB family of transcription factors consists of the evolutionary conserved proteins p65/RelA, c-Rel, RelB, p50 and p52 (derived from the p100 precursor; see the record for xander). In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with IκB inhibitory molecules, including p105 and p100. Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes, including pro-inflammatory cytokines (e.g., TNFα (see the record for PanR1), IL-1, and IL-6), chemokines [e.g., MIP-1α (macrophage inflammatory protein-1α) and RANTES (regulated upon activation, normal T-cell expressed and secreted)], cell adhesion molecules [e.g., E-selectin and VCAM-1 (vascular cell adhesion molecule-1)], effector molecules [e.g., defensins], enzymes [e.g., inducible nitric oxide synthase], and growth factors to regulate the recruitment of immune cells to the site of infection [(4;5); reviewed in (6;7)]. Bcl-3 regulates both classical and non-canonical NF-κB signaling by selectively interacting with p50 and p52 homodimers, but not inhibiting DNA binding (8-11). Bcl-3-mediated suppression of the classical NF-κB signaling pathway is context- and/or stimulus-dependent. In noncanonical NF-κB signaling, Bcl-3 putatively acts as an adaptor that recruits nuclear coactivator and corepressors complexes to the p50/p52 homodimers (12). Bcl-3 enhances p50 homodimer binding to target DNA in thymocytes (13). In bone marrow-derived macrophages, Bcl-3 stabilizes DNA-bound p50 homodimers by inhibiting p50 ubiquitination and degradation (14). During Toll-like receptor and TNF receptor signaling, Bcl-3-stabilized p50 homodimers can block NF-κB target sites in the DNA, subsequently preventing the binding of active dimers to the DNA and gene transcription (14). Please see the records xander and Finlay for additional details about NF-κB signaling.

 

Bcl3^−/− mice are overtly normal and were born at the expected Mendelian frequency (15). The Bcl3^−/− mice exhibited a reduced B to T cell ratio in the spleen, blood, and lymph nodes (15). The Bcl3^−/− mice lacked germinal centers with the B cell follicular areas before and after challenge with influenza virus and with the parasite T. gondii. However, after exposure to TNP–keyhole limpet hemocyanin (TNP-KLH) antigen absorbed in alum, the Bcl3^−/− mice showed some PNA-stained cell clusters indicative of germinal center B cells, albeit at lower numbers then that in wild-type littermates. After infection with the T-dependent antigen, influenza, the Bcl3^−/− mice exhibited a reduced IgG2a antibody response, and other antibody isotypes were not significantly generated. The microarchitecture of the B cell follicular zones in the Bcl3^−/− mice were less well organized, although the T cell zones of the spleen were normal. In the marginal zone of the spleen, the number of marginal metallophilic macrophages and marginal zone macrophages were reduced in the Bcl3^−/− mice compared to that in wild-type littermates. Expression of cell surface markers CD4, CD8, B220, IgM, Igκ, Igλ, TCRαβ, TCRγδ, IL-2Rα, HAS, CD43, BP1, Mac1, and Gr1 were comparable between Bcl3^−/− and wild-type mice indicating that B and T cell subsets in the Bcl3^−/− mice were normal (16). Similar to Bcl3^−/− mice, the memorial mice exhibited immune defects indicative of diminished Bcl-3-associated function.

Primers

PCR Primer
Memorial_pcr_F: TGCCCTCTTGTCCCAGGATG
Memorial_pcr_R: TGATGTGACAGTCTGACAGGG

Sequencing Primer
Memorial_seq_F: ATGTGGATGCTGGCTCCC
Memorial_seq_R: TGTGACAGTCTGACAGGGCAAATAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 404 nucleotides is amplified (chromosome 7, - strand):

1   tgatgtgaca gtctgacagg gcaaatagaa gccagagagc tcaggggctg ggaggcagga
61  gttggggggc tgtaattaat gtccaagaaa gcgaatttgg gctgttccca ggtggttaaa
121 aatgaccaaa agcaccccac catgactttc aacaatccag tgaccagccc ctaatcccag
181 cgactgtccc atcgtcccct caggcctctc cacatcgctg tggtccagaa taacatagcc
241 gctgtctacc gaatactcag ccttttcaag cttgggagcc gcgaagtaga cgtccataac
301 aacctgcggc aggtgaggtg gccgggagtt gggcaccgcg aaggaggggt ccccagagga
361 aggatgcagg ggagccagca tccacatcct gggacaagag ggca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Fujita, T., Nolan, G. P., Liou, H. C., Scott, M. L., and Baltimore, D. (1993) The Candidate Proto-Oncogene Bcl-3 Encodes a Transcriptional Coactivator that Activates through NF-Kappa B p50 Homodimers. Genes Dev. 7, 1354-1363.

  2. Hatada, E. N., Nieters, A., Wulczyn, F. G., Naumann, M., Meyer, R., Nucifora, G., McKeithan, T. W., and Scheidereit, C. (1992) The Ankyrin Repeat Domains of the NF-Kappa B Precursor p105 and the Protooncogene Bcl-3 Act as Specific Inhibitors of NF-Kappa B DNA Binding. Proc Natl Acad Sci U S A. 89, 2489-2493.

  3. Wulczyn, F. G., Naumann, M., and Scheidereit, C. (1992) Candidate Proto-Oncogene Bcl-3 Encodes a Subunit-Specific Inhibitor of Transcription Factor NF-Kappa B. Nature. 358, 597-599.

  4. Chen, F., Castranova, V., Shi, X., and Demers, L. M. (1999) New Insights into the Role of Nuclear Factor-kappaB, a Ubiquitous Transcription Factor in the Initiation of Diseases. Clin Chem. 45, 7-17.

  5. Zhang, G., and Ghosh, S. (2001) Toll-Like Receptor-Mediated NF-kappaB Activation: A Phylogenetically Conserved Paradigm in Innate Immunity. J Clin Invest. 107, 13-19.

  6. Beinke, S., and Ley, S. C. (2004) Functions of NF-kappaB1 and NF-kappaB2 in Immune Cell Biology. Biochem J. 382, 393-409.

  7. Tang, E. D., Wang, C. Y., Xiong, Y., and Guan, K. L. (2003) A Role for NF-kappaB Essential modifier/IkappaB Kinase-Gamma (NEMO/IKKgamma) Ubiquitination in the Activation of the IkappaB Kinase Complex by Tumor Necrosis Factor-Alpha. J Biol Chem. 278, 37297-37305.

  8. Nolan, G. P., Fujita, T., Bhatia, K., Huppi, C., Liou, H. C., Scott, M. L., and Baltimore, D. (1993) The Bcl-3 Proto-Oncogene Encodes a Nuclear I Kappa B-Like Molecule that Preferentially Interacts with NF-Kappa B p50 and p52 in a Phosphorylation-Dependent Manner. Mol Cell Biol. 13, 3557-3566.

  9. Kerr, L. D., Duckett, C. S., Wamsley, P., Zhang, Q., Chiao, P., Nabel, G., McKeithan, T. W., Baeuerle, P. A., and Verma, I. M. (1992) The Proto-Oncogene Bcl-3 Encodes an I Kappa B Protein. Genes Dev. 6, 2352-2363.

  10. Inoue, J., Takahara, T., Akizawa, T., and Hino, O. (1993) Bcl-3, a Member of the I Kappa B Proteins, has Distinct Specificity Towards the Rel Family of Proteins. Oncogene. 8, 2067-2073.

  11. Paxian, S., Merkle, H., Riemann, M., Wilda, M., Adler, G., Hameister, H., Liptay, S., Pfeffer, K., and Schmid, R. M. (2002) Abnormal Organogenesis of Peyer's Patches in Mice Deficient for NF-kappaB1, NF-kappaB2, and Bcl-3. Gastroenterology. 122, 1853-1868.

  12. Dechend, R., Hirano, F., Lehmann, K., Heissmeyer, V., Ansieau, S., Wulczyn, F. G., Scheidereit, C., and Leutz, A. (1999) The Bcl-3 Oncoprotein Acts as a Bridging Factor between NF-kappaB/Rel and Nuclear Co-Regulators. Oncogene. 18, 3316-3323.

  13. Caamano, J. H., Perez, P., Lira, S. A., and Bravo, R. (1996) Constitutive Expression of Bc1-3 in Thymocytes Increases the DNA Binding of NF-kappaB1 (p50) Homodimers in Vivo. Mol Cell Biol. 16, 1342-1348.

  14. Carmody, R. J., Ruan, Q., Palmer, S., Hilliard, B., and Chen, Y. H. (2007) Negative Regulation of Toll-Like Receptor Signaling by NF-kappaB p50 Ubiquitination Blockade. Science. 317, 675-678.

  15. Franzoso, G., Carlson, L., Scharton-Kersten, T., Shores, E. W., Epstein, S., Grinberg, A., Tran, T., Shacter, E., Leonardi, A., Anver, M., Love, P., Sher, A., and Siebenlist, U. (1997) Critical Roles for the Bcl-3 Oncoprotein in T Cell-Mediated Immunity, Splenic Microarchitecture, and Germinal Center Reactions. Immunity. 6, 479-490.

  16. Schwarz, E. M., Krimpenfort, P., Berns, A., and Verma, I. M. (1997) Immunological Defects in Mice with a Targeted Disruption in Bcl-3. Genes Dev. 11, 187-197.