Phenotypic Mutation 'dissolute' (pdf version)
Alleledissolute
Mutation Type splice site
Chromosome18
Coordinate20,595,951 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Dsg2
Gene Name desmoglein 2
Synonym(s) D18Ertd293e
Chromosomal Location 20,558,074-20,604,521 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007883; MGI:1196466

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000057096 ]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect probably null
Meta Mutation Damage Score 0.6516 question?
Is this an essential gene? Probably nonessential (E-score: 0.153) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10 26115074
Candidate Explorer Status CE: excellent candidate; human score: 2.5; ML prob: 0.89
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(12) : Gene trapped(8) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20594211 missense probably benign 0.33
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably null
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4213:Dsg2 UTSW 18 20598514 missense probably benign 0.01
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20583036 missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20601802 missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:31 PM by Anne Murray
Record Created 2019-01-22 11:04 AM by Bruce Beutler
Record Posted 2019-01-30
Phenotypic Description
Figure 1. Dissolute mice exhibited susceptibility to dextran sodium sulfate-induced colitis at 10 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The dissolute phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4299, some of which showed susceptibility to dextran sodium sulfate-induced colitis on day 10 after DSS treatment (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the day 10 DSS phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R4299. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. The DSS susceptibility phenotype was linked by continuous variable mapping to mutations in two genes: Cdh7 (chromosome 1) and Dsg2 (chromosome 18). The mutation in Dsg2 was presumed causative because DSG2 has known functions in intestinal barrier maintenance. The Dsg2 mutation is a T to A transversion at base pair 20,595,951 (v38) on chromosome 18, or base pair 37,878 in the GenBank genomic region NC_000084 within intron 12 (9-base pairs upstream of exon 13 [out of 15 total exons]). Linkage was found with a recessive model of inheritance, wherein one variant homozygote departed phenotypically from three homozygous reference mice and 10 heterozygous mice with a P value of 0.000434 (Figure 2).  

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic site in exon 13. The mutation would cause a 2-base pair deletion of exon 13, causing a frame-shifted protein product beginning after amino acid 632 of the protein, which is normally 1,122 amino acids in length, and termination after the inclusion of 33 aberrant amino acids.

 

          <--exon 12        <--intron 12 exon 13-->
2093 ……CTGCTCCTGCTCC ……ctctttgctgtgtacag [TG]GTGCCGCTCTT……CCCTTGGAATAA……
628  ……-L--L--L--L--                         R--A--A--L-……-P--L--E--*-
         correct                                     aberrant

 

 

The acceptor splice site of intron 12 is indicated in blue lettering and the mutated nucleotide is indicated in red. The putative deleted nucleotides are bracketed.

Protein Prediction
Figure 3. Domain organization of DSG2. The dissolute mutation is within intron 12. Abbreviations: SP, signal peptide; PP, propeptide; EC, extracellular cadherin repeats; EA, extracellular anchor; TM, transmembrane domain; IA, intracellular anchor, ICS, intracellular cadherin-specific sequence; IPL, intracellular proline-rich linker; DSG, desmoglein repeat; DTD, desmoglein terminal domain. This image is interactive. Other mutations found in DSG2 are noted in red. Click on each mutation for more information.

DSG2 is a member of the desmoglein (DSG) family of cadherins. Dsg2 is part of the desmosomal cadherin gene cluster on chromosome 18. The mouse genome desmosomal cadherin gene cluster includes: Dsc3 (desmocollin 3)—Dsc2Dsc1Dsg1β (Dsg5)—Dsg1αDsg1γ (Dsg6)—Dsg4 (see the record for burrito)—Dsg3Dsg2 (1).

 

DSG2 has a signal peptide, four N-terminal extracellular cadherin (EC) repeats, an extracellular anchor, a transmembrane domain, an intracellular anchor, an intracellular cadherin-specific sequence (ICS), a proline rich linker region (IPL), six intracellular DSG repeat domains, and a desmoglein terminal domain (DTD) (Figure 3) (2).

 

The dissolute mutation is predicted to result in a frame-shifted protein beginning after amino acid 632 and termination after the inclusion of 33 aberrant amino acids. The aberrant amino acids would include portions of the transmembrane domain and the intracellular anchor.

 

Please see the record weg for more information about Dsg2.

Putative Mechanism

Desmosomes are multiprotein complexes that link cadherin to the intermediate filament, providing structural support for tissues that undergo mechanical stress. The desmocollins (DSC1 to DSC3) and DSGs are the adhesion molecules of desmosomes, and are collectively known as desmosomal cadherins. Within desmosomes, the extracellular domains of DSCs and DSGs from neighboring cells form heterophilic interactions in the extracellular space, while intracellularly they are linked to plakoglobin, plakophilins, and desmoplakin.  Desmoplakin binds to keratin intermediate filaments, thereby tethering the intermediate filaments to the plasma membrane to physically strengthen the junction.

 

DSG2 has several known functions. (i) DSG2 promotes tight junction integrity in the intestine, which is required for intestinal epithelial barrier integrity (3). (ii) DSG2 regulates intestinal epithelial cell apoptosis during differentiation and inflammation by facilitating the removal of cells after cell-cell adhesion has been compromised (4). Exposure of the epithelium to the cleaved ectodomain of DSG2 resulted in compromised intercellular adhesion, but increased cellular proliferation to promote repair in the inflamed intestine (5). (iii) DSG2 functions in vasculogenic mimicry in melanoma (6). Vasculogenic mimicry is the formation of vascular networks directly by tumor cells, which promotes cancer growth and metastasis. DSG2 regulates tube formation by melanoma cells through promoting cell-cell adhesion, subsequently stabilizing and strengthening vasculogenic mimicry networks (6). (iv) DSG2 functions in cardiomyocyte cohesion and function (7).

 

The intestinal epithelial barrier is maintained by a junctional complex consisting of tight junctions, adherens junctions, and desmosomes. Inflammatory bowel disease is marked by defects in permeability and alterations in tight junction morphology. DSG2 has known functions in regulating the intestinal epithelial barrier. Conditional villin-Cre DSG2 knockout mice showed increased intestinal permeability, a wider desmosomal space, and alterations in desmosomal and tight junction components (8). Treatment of the conditional knockout mice with DSS resulted in susceptibility to colitis and increased intestinal epithelial barrier disruption (8). The phenotype of the dissolute mice is similar to that of the conditional villin-Cre DSG2 knockout mice (8), suggesting a loss of DSG2-mediated maintenance of tight junction integrity of the intestinal epithelial barrier.

Primers PCR Primer
dissolute(F):5'- TCTCTGTGATGAGGAAGAACTTTGG -3'
dissolute(R):5'- AACCAGACCAGTAGCGGATC -3'

Sequencing Primer
dissolute_seq(F):5'- AGAGGACTCTGTCTGCCTC -3'
dissolute_seq(R):5'- CGGATCGCATCACTGTCTG -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 408 nucleotides is amplified (chromosome 18, + strand):


1   tctctgtgat gaggaagaac tttgggtcag aggactctgt ctgcctccgg actttggtat
61  aattctaccg aagcaaggtt ggaaagattg aatcaaggtg ttgaatcaaa gtgaaaagga
121 cagaaaacaa aaaaatgaag cttcaaatat gtaaagaggg gggctcgaga aatcaaatgt
181 gaattctaaa tgacatgggt ttagctggtg aatggacctc tgactcctct ttgctgtgta
241 cagtggtgcc gctcttgctg ttgatatgcc actgtggagg gggcgccaaa ggcttcaccc
301 ccattcctgg gacaatagag atgctgcacc cttggaataa tgaaggggca cctcctgagg
361 acaaggtcag tacatcagac agtgatgcga tccgctactg gtctggtt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer and Bruce Beutler