Phenotypic Mutation 'americas'

• Allele: americas
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 87,642,864 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Inpp5d
• Gene Name: inositol polyphosphate-5-phosphatase D
• Synonym(s): SHIP1, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP, SHIP-1
• Chromosomal Location: 87,548,034-87,648,229 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014] ; PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Proline changed to Glutamine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000044647] [ENSMUSP00000072763] [ENSMUSP00000126569] [ENSMUSP00000131244] [ENSMUSP00000127941] [ENSMUSP00000132384]
• AlphaFold: Q9ES52
• SMART Domains: Protein: ENSMUSP00000044647; Gene: ENSMUSG00000026288; AA Change: P935Q

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	954	979	N/A	INTRINSIC
low complexity region	1045	1057	N/A	INTRINSIC
low complexity region	1119	1131	N/A	INTRINSIC
low complexity region	1139	1148	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000042275)
• SMART Domains: Protein: ENSMUSP00000072763; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	932	953	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000126569; Gene: ENSMUSG00000026288; AA Change: P673Q

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	692	717	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
  (Using ENSMUST00000167032)
• SMART Domains: Protein: ENSMUSP00000131244; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	4.5e-104	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1059	1071	N/A	INTRINSIC
low complexity region	1079	1088	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000127941; Gene: ENSMUSG00000026288; AA Change: P936Q

Domain	Start	End	E-Value	Type
SH2	6	95	4.6e-31	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	2.2e-106	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	955	980	N/A	INTRINSIC
low complexity region	1046	1058	N/A	INTRINSIC
low complexity region	1120	1132	N/A	INTRINSIC
low complexity region	1140	1149	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
  (Using ENSMUST00000169754)
• SMART Domains: Protein: ENSMUSP00000132384; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	796	808	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.6467
• Is this an essential gene?: Probably essential (E-score: 0.914)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2020-05-29 3:31 PM by Thomas Gallagher
• Record Created: 2019-01-22 11:54 AM by Bruce Beutler
• Record Posted: 2019-02-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Hexin Shi, Ying Wang, Doan Dao, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010566; NM_001110192, NM_001110193; MGI: 107357

Alleles Listed at MGI

All Mutations and Alleles(67) : Chemically induced (ENU)(5) Chemically induced (other)(1) Gene trapped(53) Radiation induced(1) Targeted(7)

Phenotypic Description

Figure 1. Americas mice exhibited increased IFN b secretion in response to dsDNA . IFN b levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Americas mice exhibited increased TNFα secretion in response to the TLR1/2 ligand, Pam 3 CSK 4 . TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Americas mice exhibited increased TNFα secretion in response to the TLR7 ligand, R848 . TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The americas phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4676, some of which showed increased type I interferon production in response to dsDNA (Figure 1). Some mice also showed increased TNFa secretion in response to the TLR1/2 ligand Pam₃CSK₄ (Figure 2) and the TLR7 ligand R848 (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the increased IFN b secretion after dsDNA stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R4676. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. All of the above phenotypes were linked by continuous variable mapping to mutations in five genes: Cul3 (chr. 1), Inpp5d (chr. 1), Ugt1a6a (chr. 1), Scrt1 (chr. 15), and Kctd17 (chr. 15). The mutation in Inpp5d was presumed causative as the immune phenotypes in the americas mice are similar to those in mice expressing other mutant Inpp5d alleles (see MGI and styx). The mutation in Inpp5d is a C to A transversion at base pair 87,715,142 (v38) on chromosome 1, or base pair or 94,831 in the GenBank genomic region NC_000067. The strongest association was found with a recessive model of inheritance to the increased dsDNA response phenotype, wherein one homozygous variant departed phenotypically from eight homozygous reference mice and eight heterozygous mice with a P value of 1.637 x 10^-17 (Figure 4).

The mutation corresponds to residue 2,984 in the mRNA sequence NM_010566 within exon 25 of 27 total exons.

2968 AAATCAACCCTGTCCCCAGATCAGCAACTCACA 931  -K--S--T--L--S--P--D--Q--Q--L--T-

The mutated nucleotide is indicated in red. The mutation results in a proline to glutamine substitution at amino acid 936 (P936Q) in the SHIP-1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.991).

Protein Prediction

Figure 5. Domain structure of SHIP protein isoforms. SHIPβ and SHIPδ arise from alternative splicing that occurs adjacent to the first NPXY motif. SHIPβ arises from in-frame splicing, while SHIPδ arises from out-of-frame splicing that results in an alternative C-terminal domain. The sSHIP isoform has an alternative promoter. The SH2 containing isoforms have been shown to be expressed in differentiated hematopoietic cells, mouse embyronic fibroblasts (MEF) and vascular endothelial cells. The sSHIP isoform is expressed by embryonic stem (ES) cells and HSC. Full-length SHIP is also expressed in HSC. Other potential isoforms have been described (not shown). The americas mutation results in a proline to glutamine substitution at amino acid 936 (P936Q). The image is interactive. Other Inpp5d mutations are noted in red. Click on each allele for more information.

Inpp5d encodes SHIP-1, an 1191-amino acid Src homology 2 (SH2) domain-containing inositol polyphosphate 5-phosphatase (Figure 5). The SHIP-1 (hereafter SHIP) protein contains an N-terminal SH2 domain (residues 8-100), two centrally located inositol polyphosphate 5-phosphatase motifs (residues 585-596 and 667-694), two NPXY motifs that, if phosphorylated, could be bound by phosphotyrosine-binding (PTB) domains (residues 913-917 and 1016-1020), and a C-terminal proline-rich domain with several SH3 binding motifs. The Americas mutation results in a proline to glutamine substitution at amino acid 936 (P936Q) in the SHIP-1 protein; amino acid 936 is within an undefined region of SHIP-1 between the NPXY motifs. The americas mutation is predicted to only affect the canonical SHIP-1 and sSHIP isoforms (Figure 5).

Please see the record styx Salamander for information about Inpp5d.

Putative Mechanism

In hematolymphoid cells, SHIP can be recruited to a wide variety of receptor complexes including growth factor receptors and immune receptors. SHIP is recruited to receptor-associated signaling complexes via adaptors (e.g. Shc, Grb2, Dok3), scaffold proteins like Gab1 or directly via its SH2 domain. After recruitment to the plasma membrane, SHIP can then hydrolyze PIP₃. Hydrolysis of PIP₃ inhibits recruitment of PH domain containing kinases like Akt, Btk (Bruton’s tyrosine kinase), and phospholipase C (PLC)-γ to the plasma membrane and thus limits the activity of several different PI3K effectors that promote cell survival, migration, differentiation or proliferation. These include distal kinases like MAP/ERK, JNK/SAPK, p38 MAPK and key transcription factors such as NF-κB and NFAT.

Inpp5d knockout mice [MGI:2386884; (1;2)] and myeloid-specific conditional knockout mice [MGI:3715983; (3)] exhibit reduced levels of B cells. The changes in B cell number was attributed to high levels of the cytokine interleukin-6 (IL-6), which directly contributes to the reduced level of B cells seen in these mice as IL-6 is known to inhibit B cell development while enhancing myeloid cell development (1). In addition to the expansion of other myeloid cell types, SHIP-deficient animals carry large numbers of myeloid suppressor cells that are potent antagonists of allogeneic T cell activation by host APCs in vitro (4). In addition, SHIP-deficient T cells do not produce a type 2 T helper (Th2) response, which is important in determining B cell antibody class switching, when exposed to the proper stimuli (5). An ENU-induced model with a mutation in Inpp5d [Iso651Thr; MGI:5050823; (6)] exhibited decreased levels of double-positive thymocytes and a reduced number of circulating lymphocytes. This study determined that a SHIP1 isoform expressed in stem and progenitor cells (s-SHIP), and lost upon the ENU-induced mutation, is necessary for SHIP1 function in hematopoiesis (6).

The phenotypes observed in the americas mice indicates loss of SHIP-1-associated function.

Primers

PCR Primer
americas_pcr_F: GTTGTGCCCAAGAAATAAAGGTACTG
americas_pcr_R: TCAGAGGACACTCACCTTGC

Sequencing Primer
americas_seq_F: CTGAGAAGCTGAGGAACATTTTC
americas_seq_R: GAGGACACTCACCTTGCCTCTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 407 nucleotides is amplified (chromosome 1, + strand):

1   gttgtgccca agaaataaag gtactgagag gctgagaagc tgaggaacat tttcctcagg
61  ctggtgccag ccaagaaggg aagaggcttc aggtgtgcct ccacatcttc ctacagggtc
121 cctgcatgtg gtgtctccag cctcaatgag atgatcaatc caaactacat tggtatgggg
181 ccttttggac agcccctgca tgggaaatca accctgtccc cagatcagca actcacagct
241 tggagttatg accagctacc caaagactcc tccctggggc ctgggagggg ggagggtcct
301 ccaacccctc cctcccaacc acctctgtcg ccaaagaagt tttcatcttc cacagccaac
361 cgaggtccct gccccagggt gcaagaggca aggtgagtgt cctctga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Nakamura, K., Kouro, T., Kincade, P. W., Malykhin, A., Maeda, K., and Coggeshall, K. M. (2004) Src Homology 2-Containing 5-Inositol Phosphatase (SHIP) Suppresses an Early Stage of Lymphoid Cell Development through Elevated Interleukin-6 Production by Myeloid Cells in Bone Marrow. J Exp Med. 199, 243-254.

  2. Maeda, K., Baba, Y., Nagai, Y., Miyazaki, K., Malykhin, A., Nakamura, K., Kincade, P. W., Sakaguchi, N., and Coggeshall, K. M. (2005) IL-6 Blocks a Discrete Early Step in Lymphopoiesis. Blood. 106, 879-885.

  3. Karlsson, M. C., Guinamard, R., Bolland, S., Sankala, M., Steinman, R. M., and Ravetch, J. V. (2003) Macrophages Control the Retention and Trafficking of B Lymphocytes in the Splenic Marginal Zone. J Exp Med. 198, 333-340.

  4. Ghansah, T., Paraiso, K. H., Highfill, S., Desponts, C., May, S., McIntosh, J. K., Wang, J. W., Ninos, J., Brayer, J., Cheng, F., Sotomayor, E., and Kerr, W. G. (2004) Expansion of Myeloid Suppressor Cells in SHIP-Deficient Mice Represses Allogeneic T Cell Responses. J Immunol. 173, 7324-7330.

  5. Tarasenko, T., Kole, H. K., Chi, A. W., Mentink-Kane, M. M., Wynn, T. A., and Bolland, S. (2007) T Cell-Specific Deletion of the Inositol Phosphatase SHIP Reveals its Role in Regulating Th1/Th2 and Cytotoxic Responses. Proc Natl Acad Sci U S A. 104, 11382-11387.

  6. Nguyen, N. Y., Maxwell, M. J., Ooms, L. M., Davies, E. M., Hilton, A. A., Collinge, J. E., Hilton, D. J., Kile, B. T., Mitchell, C. A., Hibbs, M. L., Jane, S. M., and Curtis, D. J. (2011) An ENU-Induced Mouse Mutant of SHIP1 Reveals a Critical Role of the Stem Cell Isoform for Suppression of Macrophage Activation. Blood. 117, 5362-5371.