Phenotypic Mutation 'crusty'

• Allele: crusty
• Mutation Type: missense
• Chromosome: X
• Coordinate: 7,458,893 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Foxp3
• Gene Name: forkhead box P3
• Synonym(s): JM2, scurfin
• Chromosomal Location: 7,445,915-7,461,482 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: The protein encoded by this gene is a member of the forkhead/winged-helix family of transcriptional regulators. Defects in this gene result in the scurfy phenotype (sf). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015] ; PHENOTYPE: Hemizygous mutant males exhibit scaly skin, reddening and swelling of genital papilla, small undescended testes, depressed platelet and red cell counts, and lymphohistiocytic proliferation in various organs. Mutants die around weaning age. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Asparagine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q99JB6
• PDB Structure: Structural and Biological Features of FOXP3 Dimerization Relevant to Regulatory T Cell Function [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000041953; Gene: ENSMUSG00000039521; AA Change: I350N

Domain	Start	End	E-Value	Type
low complexity region	56	76	N/A	INTRINSIC
ZnF_C2H2	196	221	2.02e-1	SMART
low complexity region	232	252	N/A	INTRINSIC
FH	335	417	3.9e-35	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000045566)
• SMART Domains: Protein: ENSMUSP00000111403; Gene: ENSMUSG00000039521; AA Change: I350N

Domain	Start	End	E-Value	Type
low complexity region	56	76	N/A	INTRINSIC
ZnF_C2H2	196	221	2.02e-1	SMART
low complexity region	232	252	N/A	INTRINSIC
FH	335	417	3.9e-35	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000115738)
• SMART Domains: Protein: ENSMUSP00000111404; Gene: ENSMUSG00000039521; AA Change: I350N

Domain	Start	End	E-Value	Type
low complexity region	56	76	N/A	INTRINSIC
ZnF_C2H2	196	221	2.02e-1	SMART
low complexity region	232	252	N/A	INTRINSIC
FH	335	417	3.9e-35	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000115739)
• SMART Domains: Protein: ENSMUSP00000111405; Gene: ENSMUSG00000039521; AA Change: I350N

Domain	Start	End	E-Value	Type
low complexity region	56	76	N/A	INTRINSIC
ZnF_C2H2	196	221	2.02e-1	SMART
low complexity region	232	252	N/A	INTRINSIC
FH	335	417	3.9e-35	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000115740)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: X-linked Recessive
• Penetrance: 100%
• Mode of Inheritance: X-linked Recessive
• Local Stock: Sperm, Tail Fibroblasts, gDNA
• MMRRC Submission: 030822-UCD
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2008-11-14
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Elaine Pirie, Bruce Beutler

Accession Number

NCBI RefSeq: NM_054039; MGI: 1891436

Alleles Listed at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(11) Spontaneous(1) Chemically induced(1)

Phenotypic Description

Crusty is a visible phenotype identified in two ENU-mutagenized G2 brothers. Hemizygous male crusty mice are small and unhealthy looking, with hard, shriveled skin on their ears and tails (Figure 1). The tails appear scaly, with some open wounds and scar tissue. One of the mice also lost the skin and hair from the anterior part of the body at about 7 weeks of age. Genitalia are small and shriveled. Hemizygous males lack sperm, and therefore breeding is between heterozygous females and wild type C57BL/6J males. Heterozygous females appear normal, and homozygous females do not exist. Male crusty mice survive until at least 8 weeks of age. Overall, the phenotype resembles scurfy, which is caused by a mutation in Foxp3.

Nature of Mutation

Because of the similarity of the crusty and scurfy phenotypes, the Foxp3 gene on Chromosome X was sequenced, and found to have a mutation corresponding to a T to A transversion at position 1307 of the Foxp3 transcript, in exon 12 of 13 total exons.

 

1291 CTTATCCGATGGGCCATCCTGGAAGCCCCGGAG

345  -L--I--R--W--A--I--L--E--A--P--E-

 

The mutated nucleotide is indicated in red lettering, and results in an isoleucine to asparagine substitution at amino acid 350 of the Foxp3 protein.

Protein Prediction

Foxp3 is one of a large family of transcription factors that share a conserved ~100 amino acid forkhead box, or winged helix, DNA binding domain. The forkhead/winged-helix/HNF3 family is named for the Drosophila homeotic forkhead proteins, transcription factors which promote terminal rather than segmental development in fly embryos, as well as for the hepatocyte nuclear factor-3 (HNF-3) liver-specific transcription factors (1). The winged helix motif, a variation on the helix-turn-helix motif, is named for the two “wings” that flank the DNA recognition helix. The more than 100 forkhead genes from a variety of species (but not plants) are named according to a standardized nomenclature beginning with Fox (forkhead box) followed by a letter to designate one of seventeen subfamilies defined by phylogenetic analysis, and a number to distinguish the individual member (2). The Foxp subfamily consists of four members (Foxp1-Foxp4). Mouse (429 amino acids in length) and human (431 amino acids) Foxp3 are 86% identical. Humans also have two additional splice variants, one lacking exon 2 and another lacking both exons 2 and 7, both of which yield protein products reported to function when overexpressed in human CD4⁺ T cells (3;4).

 

The winged helix motif (hereafter forkhead domain) is a compact α/β structure consisting of two wings (W1 and W2), three α helices (H1-H3) and three β strands (S1-S3), arranged in the order H1-S1-H2-H3-S2-W1-S3-W2 in the linear amino acid sequence (1). Studies of crystal and NMR structures of several Fox forkhead domains including those of FoxA3/HNF-3γ, FoxD3/Genesis, and FoxP2 bound to their DNA consensus sequences reveal a three-helix fold, with the third helix (H3) sitting in the major groove of B-form DNA and β strands projecting along the axis of the DNA to contact one or both of the adjacent minor grooves (Figure 2, PDB ID 2A07) (5-7). Residues contacting the DNA are distributed along the length of winged helix motifs, as observed in FoxA3/HNF-3γ and FoxP2 (5;7). However, the primary binding interaction occurs through helix H3, the recognition helix, which helps to determine the specificity of binding. A high degree of conservation exists in the amino acid sequences of helix H3 among forkhead proteins, suggesting that, at least with respect to H3, they bind DNA in a similar manner and sequence specificity is conferred by other factors. Residues N-terminal to the recognition helix can contribute to this specificity, as can electrostatic interactions, and interactions of the two wings, especially W2, with adjacent minor grooves (5-9).

 

Other Fox subfamily proteins bind target DNA sequences as monomers, except for the Foxp subfamily. Foxp1, Foxp2, Foxp3, and Foxp4 have been shown to dimerize via a leucine zipper domain (10;11). A crystal structure of the Foxp3 forkhead domain has not been reported, but that of the Foxp2 forkhead domain reveals that dimerization leads to domain swapping of part of the forkhead domain, including the recognition helix, S2 and S3. Domain swapping is made possible by the substitution of a proline in other Fox proteins with alanine in Foxp2 (7). All Foxp subfamily members contain this proline to alanine substitution, suggesting that Foxp proteins bind DNA as dimers in similar fashion. The Foxp2 dimer structure does not permit binding to adjacent DNA segments, but instead requires binding sites to be well separated or on different DNA strands, suggesting that a function of Foxp proteins is to bring together more distant regions of DNA. The forkhead domain in Foxp3 is located near the C terminus of the protein (amino acids 337-420), in contrast to most other forkhead proteins where it is N-terminally located, but the significance of this is not known (12). The Foxp3 forkhead domain contains several basic residues at the ends of the motif, which are required to mediate nuclear localization (11;13).

 

Foxp3 contains a C₂H₂ zinc-finger domain and a leucine zipper domain in its central region, and a proline-rich region near the N-terminus (Figure 3) (11;12). Transcriptional repressor function has been mapped to this N-terminal portion of Foxp3 (amino acids 67-132). In addition, a slightly larger N-terminal region (amino acids 67-198) can suppress nuclear factor of activated T cells (NFAT)-mediated transcription (11).

 

The crusty mutation lies within helix H1, near the N terminus of the forkhead domain of Foxp3. The mutated isoleucine is conserved in mouse and human Foxp3, and in greater than 75% of forkhead domains of the mouse Fox proteins. The effect of the mutation on transcription, translation or protein stability is unknown.

Expression/Localization

Foxp3 mRNA is most highly expressed in the lymphoid tissues: spleen, thymus and lymph nodes (12). Within lymphocyte populations, Foxp3 is strongly expressed in TCRαβ⁺CD4⁺ T cells, with much lower (90% reduced) expression in CD8⁺ and B220⁺ cells (12;14). In particular, Foxp3 is expressed by CD25⁺CD4⁺CD8^- T cells [regulatory T cells (T_reg)], both in the thymus and periphery (15;16). Foxp3 mRNA can be detected in the subset of CD4⁺CD25^- cells that is CD45RB^low, but at 100-fold lower levels relative to expression in CD4⁺CD25⁺ cells (16). Expression of Foxp3 mRNA has been reported in some CD8⁺CD25⁺ T cells in humans and rats. This cell population possesses regulatory activity in vitro, and protected rats in a model of graft versus host disease in vivo (17;18). Foxp3 is constitutively localized to the nucleus (13;14).

Background

The scurfy mouse and human IPEX syndrome

The gene encoding Foxp3 was identified in 2001 through positional cloning, during efforts to identify the mutation responsible for the scurfy mutant mouse phenotype (12). Scurfy arose spontaneously in 1949 at the Oak Ridge National Laboratory, and early studies on the strain demonstrated the gene to be X-linked, with only X^scurfy/O females and X^scurfy/Y males affected (19). Shortly after birth, scurfy mice develop scaling of the skin that is prominent in the ears, eyelids, feet and tail, severe runting due to chronic diarrhea, reddening and swelling of genital papilla, and anemia. Scurfy mutants exhibit splenomegaly, hepatomegaly, enlarged lymph nodes, and massive lymphocytic infiltrates in lymph nodes, spleen, liver, and skin (20;21). They have reduced numbers of platelets and erythrocytes. The animals typically die by weaning age. The scurfy phenotype is caused by a two base pair insertion in exon 8 of Foxp3, which results in a frameshift and subsequent generation of a truncated transcript lacking the C-terminal forkhead domain.

 

The autoimmune and lymphoproliferative nature of the scurfy phenotype was further demonstrated in several studies. Neonatal thymectomy doubles the lifespan and attenuates disease in scurfy mice, while breeding the scurfy mutation to a nude or SCID background abolishes disease (22;23). Transgenic scurfy mice in which 75-90% of T cells express a T cell receptor (TCR) specific for exogenous antigen (ovalbumin) survive significantly longer than non-transgenic scurfy mice. Rag1 deficiency in these TCR transgenic mice results in 100% of T cells reactive only to ovalbumin peptides, and completely blocks disease (24). These data indicate a requirement for exposure of developing scurfy T cells to endogenous antigen for disease development. In particular, CD4⁺ T cells are absolutely required for disease progression, as antibody or genetic depletion of CD4⁺, but not CD8⁺ T cells, greatly delays the onset of disease (25). Conversely, disease is transferred to H-2 compatible nude mice by scurfy CD4⁺, but not CD8⁺, T cells. Scurfy CD4⁺ T cells are hyperresponsive to TCR stimulation, and exhibit increased expression of costimulatory molecules (26;27). Scurfy splenocytes also produce increased amounts of cytokines in vitro, including interleukin (IL)-4, IL-6, IL-7 and tumor necrosis factor (TNF) (28).

 

Transgenic mice overexpressing Foxp3 allowed examination of the consequences of Foxp3 expression (12;15;27). These animals have reduced peripheral CD4⁺ and CD8⁺ T cell numbers, with the extent of reduction correlated with transgene copy number. However, thymic cellularity and selection are unaffected by expression of the Foxp3 transgene. CD4⁺ T cells from Foxp3 transgenic mice display greatly reduced proliferation and IL-2 production upon TCR stimulation with α-CD3 antibodies. In contrast, scurfy CD4⁺ T cells produce increased amounts of IL-2 upon TCR stimulation. Together with the phenotype of scurfy mice, these data demonstrate that Foxp3 functions to negatively regulate peripheral CD4⁺ T cell number and function.

 

In humans, mutations in FOXP3 result in a disorder with features very similar to those observed in scurfy mice (29;30). The syndrome, known as immune dysregulation polyendocrinopathy, enteropathy, X-linked syndrome (IPEX; OMIM #304790), is characterized by watery, sometimes bloody diarrhea, eczema, hemolytic anemia, type I diabetes, and thyroiditis [reviewed in (31)]. Patients with IPEX lack CD4⁺CD25⁺Foxp3⁺ T cells. The disease affects males with hemizygous mutations in FOXP3, but not heterozygous females, and affected individuals typically develop symptoms in early infancy and die within the first two years of life. Mutations in human FOXP3 occur throughout the length of the gene, but appear to cluster in the N-terminal proline-rich repressor region, the leucine zipper domain, and the forkhead domain.

 

Regulatory T cells and Foxp3

Regulatory T cells (T_reg) are a subset of CD4⁺ T cells that constitutively express the IL-2 receptor α chain (CD25) and possess a high level of immune suppressive activity (32). Antibody depletion of CD25⁺ cells or reconstitution of lymphopenic mice with CD25^- cells results in development of autoimmune inflammation in multiple organs, and heightened immune responses to allogeneic cells. T_reg cells are anergic, but on activation suppress the proliferation and IL-2 production of naïve and memory effector T cells in the periphery through a contact-dependent, cytokine-independent mechanism (33). T_reg cells serve to downregulate the immune response to self and non-self antigens in an antigen-nonspecific manner, thereby establishing tolerance for potentially hazardous self-reactive lymphocytes that may have escaped clonal deletion, as well as limiting the response to foreign antigens.

 

The underlying cause of human IPEX syndrome and the scurfy phenotype (discussed here) is a lack of Foxp3⁺ T_reg cells. Neonatal transfer of CD4⁺CD25⁺ T_reg cells rescues the lymphoproliferative defect and disease of Foxp3-null and scurfy mice (34). Mice lacking Foxp3 throughout the body or only in CD4⁺ T cells mice fail to generate CD4⁺CD25⁺ T_reg cells, and develop a lymphoproliferative disease identical to that of scurfy mice (14;34). Conversely, ectopic expression through retroviral gene transfer of Foxp3 in nonregulatory naïve T cells converts them to a regulatory type which can suppress the proliferation of CD4⁺CD25^- T cells in vitro (16;34).  In vivo, transgenic expression of Foxp3 in mice also converts conventional CD4⁺ T cells to a regulatory phenotype (15). In addition, transfer of scurfy CD4⁺ T cells into Rag1^-/- hosts causes colitis and weight loss that can be prevented by cotransfer of CD4⁺ T cells retrovirally transduced with Foxp3. Thus, Foxp3 is necessary and sufficient for T_reg cell development and function. Notably, regulatory activity is conferred solely by Foxp3, regardless of the presence CD25, since CD4⁺CD25⁺ cells from scurfy mice lack suppressor activity, and Foxp3 transgenic CD4⁺ cells lacking CD25 have suppressor activity (15;34).

 

Mechanism of Foxp3 function

Both the factors inducing Foxp3, and induced by Foxp3, are under intense investigation. Identifying factors that specifically induce Foxp3 expression is particularly challenging because distinguishing between a direct role in Foxp3 induction versus a role in promoting T_reg expansion and survival through other mechanisms is often difficult. Foxp3 expression and T_reg cell health and function typically go together. Nonetheless, reports indicate that among the factors that may regulate Foxp3 expression are CD28, IL-2, transforming growth factor (TGF)-β, and TCR/MHC interactions (Figure 4). CD28 has been shown to be required for the survival and proliferation of T_reg cells (35). Further work using mixed bone marrow chimeras containing wild type- and Cd28^-/--derived donor cells, has provided support for the conclusion that CD28-mediated signaling during thymic development is required specifically for normal Foxp3 expression in CD4⁺CD25⁺ cells (36). IL-2 is absolutely required for T_reg cell expansion in the thymus and periphery [reviewed in (37)]. Mice lacking IL-2, IL-2Rα, IL-2Rβ, or Stat5, a downstream mediator of IL-2 signaling, all exhibit an approximately 50% reduction of CD4⁺CD25⁺ T_reg cells. However, Foxp3⁺ T_reg cells present in the thymus and periphery of Il2^-/-, Il2ra^-/-, and Il2rb^-/- mice display normal suppressive activity in vitro, suggesting that IL-2 is required for survival and expansion of T_reg cells rather than Foxp3 induction or Foxp3-dependent development/suppressor function (38). On the other hand, the presence of Stat5 binding sites within the promoter region of Foxp3 supports a direct role for IL-2 signaling in controlling Foxp3 induction (39). The role of TGF-β in Foxp3 induction remains unclear. Mice incapable of producing or responding to TGF-β, or with increased TGF-β signaling, have been used to demonstrate both that TGF-β is required and unessential for T_reg development and function (40-42). Further analysis of the promoter region of Foxp3 should reveal factors definitively required for Foxp3 induction.

 

The direct transcriptional targets of Foxp3 are actively being sought. Genome-wide analysis using chromatin immunoprecipitation assays followed by microarray analyses demonstrates that Foxp3 functions as both a transcriptional activator and repressor, binding to promoters of upwards of 1,000 genes, including many that modulate T cell activation and function (43;44). Several studies suggest that Foxp3 can also dimerize with other transcription factors, such as NFAT and NF-κB, (11;45;46), and may alter transactivation by these proteins. T cells from scurfy mice display increased NFAT and NF-κB transcriptional activity, consistent with a role for Foxp3 as a corepressor in vivo (46). Foxp3 has been suggested to inhibit transcription of Il2, and may do so through interaction with AML1/Runx1 or NFAT (45;47).  Despite these many findings, how Foxp3 controls T_reg cell development and maintenance remains unclear. Recent work using knockin mice that insert Gfp into the Foxp3 locus thereby inactivating Foxp3, suggests that Foxp3 is not required to initiate T_reg cell development (48). These mice still develop cells with some T_reg cell characteristics, although they lack suppressor activity, suggesting that Foxp3 functions to amplify or stabilize the regulatory state, which is initiated through other mechanisms.

Putative Mechanism

Although the appearance of scurfy and crusty mice is similar, the increased lifespan of crusty mice (3 weeks in scurfy versus >7 weeks in crusty mice) suggests that the Foxp3 mutation in these animals results in a protein with hypomorphic function. The cellular defects in crusty mice are presumed to be the same as those in scurfy mice. Protein expression has not been tested for Foxp3^crusty. The crusty mutation resides in the forkhead domain, but based on the crystal structure of Foxp2, the mutated isoleucine is not predicted to make direct contacts with the DNA. I350 is located two residues away from the corresponding amino acid in Foxp2 (tryptophan in Foxp3, glutamine in Foxp2) that is involved in intermolecular interactions in the domain swapped dimer, so it is possible that its mutation could disrupt dimer formation.

Primers

Primers cannot be located by automatic search.

Genotyping

Crusty genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.  This protocol has not been tested.

 

Primers

crusty (F): 5’- GGCTATGCCACTTGAGCTGCTTAC -3’

crusty (R): 5’- CCACAGCCTCAGTCTCATGGTTTTG -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C              ∞

 

Primers for sequencing

crusty_seq(F): 5’- GACTCCTTTTTAAAGTGAGGAGAGC -3’

crusty_seq(R): 5’- TGCGAAACTCAAATTCATCTACGG -3’

 

The following sequence of 1213 nucleotides (from Genbank genomic region NC_000086 for linear genomic sequence of Foxp3) is amplified:

 

12200                     g gctatgccac ttgagctgct tacatgcctt tgatgtacaa

12241 attacttgac tcctttttaa agtgaggaga gctatttggc aggagtactg caaagaagac

12301 acagcttacg gcgggtactc agtaaacagt actatgtgtg agcatagact gtccctcccc

12361 ccttggtgct agtggtagga attgagacct tggattcctg atgcagacaa aggtggggta

12421 gggggtgagg aggccaaagg ctctgatcta tgccaacctt ctgcagagtt cttccacaac

12481 atggactact tcaagtacca caatatgcga ccccctttca cctatgccac ccttatccga

12541 tgggtaagca gggcaataga ggcccagcag ctggtgggcg gcaggggggg agttgtggtg

12601 gggagtgctt gcctcctaca ttgcaccaag agcagaattc acccattaac aaacctcagc

12661 tctgaggagc cccaagatgt gatccttctt gatagcttca cctcagatct agccctcaac

12721 ccaaaactac tgcaagccag gtcagtgcaa agcaaactgt aacactacaa actacccttt

12781 cctttgtcca ccctatctct aacatcaccc ttgacctcat gcctcaccct attctttctc

12841 cttccccttg acccacaatt acaaagctat catagctcag agggccgaga gtaggctgct

12901 ccctcagcca caaccctgag gaacatgccc cttattccac ctgactccaa cttccaggcc

12961 atcctggaag ccccggagag gcagaggaca ctcaatgaaa tctaccattg gtttactcgc

13021 atgttcgcct acttcagaaa ccaccccgcc acctggaagg tgagttcctc tgtacacact

13081 ggcagctggg atggctccaa ggatggttag cctggggcta gacatgtggg gaaggagcag

13141 gtcagtctca gactcaggat gactgtcaac cctgtccctg actggggtcc cggtccccct

13201 tccacagaat gccatccgcc acaacctgag cctgcacaag tgctttgtgc gagtggagag

13261 cgagaaggga gcagtgtgga ccgtagatga atttgagttt cgcaagaaga ggagccaacg

13321 ccccaacaag tgctccaatc cctgcccttg acctcaaaac caagaaaagg tgggcggggg

13381 agggggccaa aaccatgaga ctgaggctgt gg

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is highlighted in red.

References

   1.  Gajiwala, K. S. and Burley, S. K. (2000) Winged helix proteins, Curr. Opin. Struct. Biol. 10, 110-116.

   2.  Kaestner, K. H., Knochel, W., and Martinez, D. E. (2000) Unified nomenclature for the winged helix/forkhead transcription factors, Genes Dev. 14, 142-146.

   3.  Smith, E. L., Finney, H. M., Nesbitt, A. M., Ramsdell, F., and Robinson, M. K. (2006) Splice variants of human FOXP3 are functional inhibitors of human CD4+ T-cell activation, Immunology 119, 203-211.

   4.  Allan, S. E., Passerini, L., Bacchetta, R., Crellin, N., Dai, M., Orban, P. C., Ziegler, S. F., Roncarolo, M. G., and Levings, M. K. (2005) The role of 2 FOXP3 isoforms in the generation of human CD4+ Tregs, J. Clin. Invest 115, 3276-3284.

   5.  Clark, K. L., Halay, E. D., Lai, E., and Burley, S. K. (1993) Co-crystal structure of the HNF-3/fork head DNA-recognition motif resembles histone H5, Nature 364, 412-420.

   6.  Jin, C., Marsden, I., Chen, X., and Liao, X. (1999) Dynamic DNA contacts observed in the NMR structure of winged helix protein-DNA complex, J. Mol. Biol. 289, 683-690.

   7.  Stroud, J. C., Wu, Y., Bates, D. L., Han, A., Nowick, K., Paabo, S., Tong, H., and Chen, L. (2006) Structure of the forkhead domain of FOXP2 bound to DNA, Structure. 14, 159-166.

   8.  Marsden, I., Jin, C., and Liao, X. (1998) Structural changes in the region directly adjacent to the DNA-binding helix highlight a possible mechanism to explain the observed changes in the sequence-specific binding of winged helix proteins, J. Mol. Biol. 278, 293-299.

   9.  Overdier, D. G., Porcella, A., and Costa, R. H. (1994) The DNA-binding specificity of the hepatocyte nuclear factor 3/forkhead domain is influenced by amino-acid residues adjacent to the recognition helix, Mol. Cell Biol. 14, 2755-2766.

 10.  Li, S., Weidenfeld, J., and Morrisey, E. E. (2004) Transcriptional and DNA binding activity of the Foxp1/2/4 family is modulated by heterotypic and homotypic protein interactions, Mol. Cell Biol. 24, 809-822.

 11.  Lopes, J. E., Torgerson, T. R., Schubert, L. A., Anover, S. D., Ocheltree, E. L., Ochs, H. D., and Ziegler, S. F. (2006) Analysis of FOXP3 reveals multiple domains required for its function as a transcriptional repressor, J. Immunol. 177, 3133-3142.

 12.  Brunkow, M. E., Jeffery, E. W., Hjerrild, K. A., Paeper, B., Clark, L. B., Yasayko, S. A., Wilkinson, J. E., Galas, D., Ziegler, S. F., and Ramsdell, F. (2001) Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse, Nat. Genet. 27, 68-73.

 13.  Schubert, L. A., Jeffery, E., Zhang, Y., Ramsdell, F., and Ziegler, S. F. (2001) Scurfin (FOXP3) acts as a repressor of transcription and regulates T cell activation, J. Biol. Chem. 276, 37672-37679.

 14.  Fontenot, J. D., Rasmussen, J. P., Williams, L. M., Dooley, J. L., Farr, A. G., and Rudensky, A. Y. (2005) Regulatory T cell lineage specification by the forkhead transcription factor foxp3, Immunity 22, 329-341.

 15.  Khattri, R., Cox, T., Yasayko, S. A., and Ramsdell, F. (2003) An essential role for Scurfin in CD4+CD25+ T regulatory cells, Nat. Immunol. 4, 337-342.

 16.  Hori, S., Nomura, T., and Sakaguchi, S. (2003) Control of regulatory T cell development by the transcription factor Foxp3, Science 299, 1057-1061.

 17.  Cosmi, L., Liotta, F., Lazzeri, E., Francalanci, M., Angeli, R., Mazzinghi, B., Santarlasci, V., Manetti, R., Vanini, V., Romagnani, P., Maggi, E., Romagnani, S., and Annunziato, F. (2003) Human CD8+CD25+ thymocytes share phenotypic and functional features with CD4+CD25+ regulatory thymocytes, Blood 102, 4107-4114.

 18.  Xystrakis, E., Dejean, A. S., Bernard, I., Druet, P., Liblau, R., Gonzalez-Dunia, D., and Saoudi, A. (2004) Identification of a novel natural regulatory CD8 T-cell subset and analysis of its mechanism of regulation, Blood 104, 3294-3301.

 19.  Russell, W. L., Russell, L. B., and Gower, J. S. (1959) EXCEPTIONAL INHERITANCE OF A SEX-LINKED GENE IN THE MOUSE EXPLAINED ON THE BASIS THAT THE X/O SEX-CHROMOSOME CONSTITUTION IS FEMALE, Proc. Natl. Acad. Sci. U. S. A 45, 554-560.

 20.  Godfrey, V. L., Wilkinson, J. E., and Russell, L. B. (1991) X-linked lymphoreticular disease in the scurfy (sf) mutant mouse, Am J. Pathol. 138, 1379-1387.

 21.  Lyon, M. F., Peters, J., Glenister, P. H., Ball, S., and Wright, E. (1990) The scurfy mouse mutant has previously unrecognized hematological abnormalities and resembles Wiskott-Aldrich syndrome, Proc. Natl. Acad. Sci. U. S. A 87, 2433-2437.

 22.  Godfrey, V. L., Rouse, B. T., and Wilkinson, J. E. (1994) Transplantation of T cell-mediated, lymphoreticular disease from the scurfy (sf) mouse, Am J. Pathol. 145, 281-286.

 23.  Godfrey, V. L., Wilkinson, J. E., Rinchik, E. M., and Russell, L. B. (1991) Fatal lymphoreticular disease in the scurfy (sf) mouse requires T cells that mature in a sf thymic environment: potential model for thymic education, Proc. Natl. Acad. Sci. U. S. A 88, 5528-5532.

 24.  Zahorsky-Reeves, J. L. and Wilkinson, J. E. (2001) The murine mutation scurfy (sf) results in an antigen-dependent lymphoproliferative disease with altered T cell sensitivity, Eur. J. Immunol. 31, 196-204.

 25.  Blair, P. J., Bultman, S. J., Haas, J. C., Rouse, B. T., Wilkinson, J. E., and Godfrey, V. L. (1994) CD4+CD8- T cells are the effector cells in disease pathogenesis in the scurfy (sf) mouse, J. Immunol. 153, 3764-3774.

 26.  Clark, L. B., Appleby, M. W., Brunkow, M. E., Wilkinson, J. E., Ziegler, S. F., and Ramsdell, F. (1999) Cellular and molecular characterization of the scurfy mouse mutant, J. Immunol. 162, 2546-2554.

 27.  Khattri, R., Kasprowicz, D., Cox, T., Mortrud, M., Appleby, M. W., Brunkow, M. E., Ziegler, S. F., and Ramsdell, F. (2001) The amount of scurfin protein determines peripheral T cell number and responsiveness, J. Immunol. 167, 6312-6320.

 28.  Kanangat, S., Blair, P., Reddy, R., Daheshia, M., Godfrey, V., Rouse, B. T., and Wilkinson, E. (1996) Disease in the scurfy (sf) mouse is associated with overexpression of cytokine genes, Eur. J. Immunol. 26, 161-165.

 29.  Wildin, R. S., Ramsdell, F., Peake, J., Faravelli, F., Casanova, J. L., Buist, N., Levy-Lahad, E., Mazzella, M., Goulet, O., Perroni, L., Bricarelli, F. D., Byrne, G., McEuen, M., Proll, S., Appleby, M., and Brunkow, M. E. (2001) X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy, Nat. Genet. 27, 18-20.

 30.  Bennett, C. L., Christie, J., Ramsdell, F., Brunkow, M. E., Ferguson, P. J., Whitesell, L., Kelly, T. E., Saulsbury, F. T., Chance, P. F., and Ochs, H. D. (2001) The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3, Nat. Genet. 27, 20-21.

 31.  Torgerson, T. R. and Ochs, H. D. (2007) Immune dysregulation, polyendocrinopathy, enteropathy, X-linked: forkhead box protein 3 mutations and lack of regulatory T cells, J. Allergy Clin. Immunol. 120, 744-750.

 32.  Sakaguchi, S., Sakaguchi, N., Asano, M., Itoh, M., and Toda, M. (1995) Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases, J. Immunol. 155, 1151-1164.

 33.  Randolph, D. A. and Fathman, C. G. (2006) Cd4+Cd25+ regulatory T cells and their therapeutic potential, Annu. Rev. Med. 57, 381-402.

 34.  Fontenot, J. D., Gavin, M. A., and Rudensky, A. Y. (2003) Foxp3 programs the development and function of CD4+CD25+ regulatory T cells, Nat. Immunol. 4, 330-336.

 35.  Tang, Q., Henriksen, K. J., Boden, E. K., Tooley, A. J., Ye, J., Subudhi, S. K., Zheng, X. X., Strom, T. B., and Bluestone, J. A. (2003) Cutting edge: CD28 controls peripheral homeostasis of CD4+CD25+ regulatory T cells, J. Immunol. 171, 3348-3352.

 36.  Tai, X., Cowan, M., Feigenbaum, L., and Singer, A. (2005) CD28 costimulation of developing thymocytes induces Foxp3 expression and regulatory T cell differentiation independently of interleukin 2, Nat. Immunol. 6, 152-162.

 37.  Malek, T. R., Yu, A., Zhu, L., Matsutani, T., Adeegbe, D., and Bayer, A. L. (2008) IL-2 Family of Cytokines in T Regulatory Cell Development and Homeostasis, J. Clin. Immunol.

 38.  Fontenot, J. D., Rasmussen, J. P., Gavin, M. A., and Rudensky, A. Y. (2005) A function for interleukin 2 in Foxp3-expressing regulatory T cells, Nat. Immunol. 6, 1142-1151.

 39.  Burchill, M. A., Yang, J., Vogtenhuber, C., Blazar, B. R., and Farrar, M. A. (2007) IL-2 receptor beta-dependent STAT5 activation is required for the development of Foxp3+ regulatory T cells, J. Immunol. 178, 280-290.

 40.  Schramm, C., Huber, S., Protschka, M., Czochra, P., Burg, J., Schmitt, E., Lohse, A. W., Galle, P. R., and Blessing, M. (2004) TGFbeta regulates the CD4+CD25+ T-cell pool and the expression of Foxp3 in vivo, Int. Immunol. 16, 1241-1249.

 41.  Huber, S., Schramm, C., Lehr, H. A., Mann, A., Schmitt, S., Becker, C., Protschka, M., Galle, P. R., Neurath, M. F., and Blessing, M. (2004) Cutting edge: TGF-beta signaling is required for the in vivo expansion and immunosuppressive capacity of regulatory CD4+CD25+ T cells, J. Immunol. 173, 6526-6531.

 42.  Piccirillo, C. A., Letterio, J. J., Thornton, A. M., McHugh, R. S., Mamura, M., Mizuhara, H., and Shevach, E. M. (2002) CD4(+)CD25(+) regulatory T cells can mediate suppressor function in the absence of transforming growth factor beta1 production and responsiveness, J. Exp. Med. 196, 237-246.

 43.  Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., and Rudensky, A. Y. (2007) Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells, Nature 445, 936-940.

 44.  Marson, A., Kretschmer, K., Frampton, G. M., Jacobsen, E. S., Polansky, J. K., MacIsaac, K. D., Levine, S. S., Fraenkel, E., von, B. H., and Young, R. A. (2007) Foxp3 occupancy and regulation of key target genes during T-cell stimulation, Nature 445, 931-935.

 45.  Wu, Y., Borde, M., Heissmeyer, V., Feuerer, M., Lapan, A. D., Stroud, J. C., Bates, D. L., Guo, L., Han, A., Ziegler, S. F., Mathis, D., Benoist, C., Chen, L., and Rao, A. (2006) FOXP3 controls regulatory T cell function through cooperation with NFAT, Cell 126, 375-387.

 46.  Bettelli, E., Dastrange, M., and Oukka, M. (2005) Foxp3 interacts with nuclear factor of activated T cells and NF-kappa B to repress cytokine gene expression and effector functions of T helper cells, Proc. Natl. Acad. Sci. U. S. A 102, 5138-5143.

 47.  Ono, M., Yaguchi, H., Ohkura, N., Kitabayashi, I., Nagamura, Y., Nomura, T., Miyachi, Y., Tsukada, T., and Sakaguchi, S. (2007) Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1, Nature 446, 685-689.

 48.  Gavin, M. A., Rasmussen, J. P., Fontenot, J. D., Vasta, V., Manganiello, V. C., Beavo, J. A., and Rudensky, A. Y. (2007) Foxp3-dependent programme of regulatory T-cell differentiation, Nature 445, 771-775.

 49. Feuerer, M., Hill, J. A., Kretschmer, K., von Boehmer, H., Mathis, D., and Benoist, C. (2010) Genomic Definition of Multiple Ex Vivo Regulatory T Cell Subphenotypes. Proc. Natl. Acad. Sci. U. S. A.. 107, 5919-5924.

 50. Feuerer, M., Hill, J. A., Mathis, D., and Benoist, C. (2009) Foxp3+ Regulatory T Cells: Differentiation, Specification, Subphenotypes. Nat. Immunol.. 10, 689-695.