Phenotypic Mutation 'crusty' (pdf version)
List |< first << previous [record 91 of 511] next >> last >|
Allelecrusty
Mutation Type missense
ChromosomeX
Coordinate7,592,654 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Foxp3
Gene Name forkhead box P3
Synonym(s) scurfin, JM2
Chromosomal Location 7,579,676-7,595,243 bp (+)
MGI Phenotype Hemizygous mutant males exhibit scaly skin, reddening and swelling of genital papilla, small undescended testes, depressed platelet and red cell counts, and lymphohistiocytic proliferation in various organs. Mutants die around weaning age.
Accession Number

NCBI RefSeq: NM_054039; MGI: 1891436

Mapped Yes 
Amino Acid Change Isoleucine changed to Asparagine
Institutional SourceBeutler Lab
Ref Sequences
I350N in Ensembl: ENSMUSP00000041953 (fasta)
Gene Model not available
PDB Structure
Structural and Biological Features of FOXP3 Dimerization Relevant to Regulatory T Cell Function [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
low complexity region 56 76 N/A INTRINSIC
ZnF_C2H2 196 221 2.02e-1 SMART
coiled coil region 232 261 N/A INTRINSIC
FH 335 417 3.9e-35 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000041953)
Phenotypic Category growth/size, hematopoietic system, immune system, lethality-postnatal, limbs/digits/tail phenotype, reproductive system, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(11) Spontaneous(1) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03233:Foxp3 APN X 7587423 splice site 0.00
R0479:Foxp3 UTSW X 7587344 missense possibly damaging 0.68
R0654:Foxp3 UTSW X 7591400 missense probably benign 0.02
Mode of Inheritance X-linked Recessive
Local Stock Sperm, Tail Fibroblasts, gDNA
MMRRC Submission 030822-UCD
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 11/14/2008
Phenotypic Description
Crusty is a visible phenotype identified in two ENU-mutagenized G2 brothers. Hemizygous male crusty mice are small and unhealthy looking, with hard, shriveled skin on their ears and tails (Figure 1). The tails appear scaly, with some open wounds and scar tissue. One of the mice also lost the skin and hair from the anterior part of the body at about 7 weeks of age. Genitalia are small and shriveled. Hemizygous males lack sperm, and therefore breeding is between heterozygous females and wild type C57BL/6J males. Heterozygous females appear normal, and homozygous females do not exist. Male crusty mice survive until at least 8 weeks of age. Overall, the phenotype resembles scurfy, which is caused by a mutation in Foxp3.

 

Nature of Mutation
Because of the similarity of the crusty and scurfy phenotypes, the Foxp3 gene on Chromosome X was sequenced, and found to have a mutation corresponding to a T to A transversion at position 1307 of the Foxp3 transcript, in exon 12 of 13 total exons.
 
1291 CTTATCCGATGGGCCATCCTGGAAGCCCCGGAG
345  -L--I--R--W--A--I--L--E--A--P--E-
 
The mutated nucleotide is indicated in red lettering, and results in an isoleucine to asparagine substitution at amino acid 350 of the Foxp3 protein.
Protein Prediction
Foxp3 is one of a large family of transcription factors that share a conserved ~100 amino acid forkhead box, or winged helix, DNA binding domain. The forkhead/winged-helix/HNF3 family is named for the Drosophila homeotic forkhead proteins, transcription factors which promote terminal rather than segmental development in fly embryos, as well as for the hepatocyte nuclear factor-3 (HNF-3) liver-specific transcription factors (1). The winged helix motif, a variation on the helix-turn-helix motif, is named for the two “wings” that flank the DNA recognition helix. The more than 100 forkhead genes from a variety of species (but not plants) are named according to a standardized nomenclature beginning with Fox (forkhead box) followed by a letter to designate one of seventeen subfamilies defined by phylogenetic analysis, and a number to distinguish the individual member (2). The Foxp subfamily consists of four members (Foxp1-Foxp4). Mouse (429 amino acids in length) and human (431 amino acids) Foxp3 are 86% identical. Humans also have two additional splice variants, one lacking exon 2 and another lacking both exons 2 and 7, both of which yield protein products reported to function when overexpressed in human CD4+ T cells (3;4).
 
The winged helix motif (hereafter forkhead domain) is a compact α/β structure consisting of two wings (W1 and W2), three α helices (H1-H3) and three β strands (S1-S3), arranged in the order H1-S1-H2-H3-S2-W1-S3-W2 in the linear amino acid sequence (1). Studies of crystal and NMR structures of several Fox forkhead domains including those of FoxA3/HNF-3γ, FoxD3/Genesis, and FoxP2 bound to their DNA consensus sequences reveal a three-helix fold, with the third helix (H3) sitting in the major groove of B-form DNA and β strands projecting along the axis of the DNA to contact one or both of the adjacent minor grooves (Figure 2, PDB ID 2A07) (5-7). Residues contacting the DNA are distributed along the length of winged helix motifs, as observed in FoxA3/HNF-3γ and FoxP2 (5;7). However, the primary binding interaction occurs through helix H3, the recognition helix, which helps to determine the specificity of binding. A high degree of conservation exists in the amino acid sequences of helix H3 among forkhead proteins, suggesting that, at least with respect to H3, they bind DNA in a similar manner and sequence specificity is conferred by other factors. Residues N-terminal to the recognition helix can contribute to this specificity, as can electrostatic interactions, and interactions of the two wings, especially W2, with adjacent minor grooves (5-9).
 
Other Fox subfamily proteins bind target DNA sequences as monomers, except for the Foxp subfamily. Foxp1, Foxp2, Foxp3, and Foxp4 have been shown to dimerize via a leucine zipper domain (10;11). A crystal structure of the Foxp3 forkhead domain has not been reported, but that of the Foxp2 forkhead domain reveals that dimerization leads to domain swapping of part of the forkhead domain, including the recognition helix, S2 and S3. Domain swapping is made possible by the substitution of a proline in other Fox proteins with alanine in Foxp2 (7). All Foxp subfamily members contain this proline to alanine substitution, suggesting that Foxp proteins bind DNA as dimers in similar fashion. The Foxp2 dimer structure does not permit binding to adjacent DNA segments, but instead requires binding sites to be well separated or on different DNA strands, suggesting that a function of Foxp proteins is to bring together more distant regions of DNA. The forkhead domain in Foxp3 is located near the C terminus of the protein (amino acids 337-420), in contrast to most other forkhead proteins where it is N-terminally located, but the significance of this is not known (12). The Foxp3 forkhead domain contains several basic residues at the ends of the motif, which are required to mediate nuclear localization (11;13).
 
Foxp3 contains a C2H2 zinc-finger domain and a leucine zipper domain in its central region, and a proline-rich region near the N-terminus (Figure 3) (11;12). Transcriptional repressor function has been mapped to this N-terminal portion of Foxp3 (amino acids 67-132). In addition, a slightly larger N-terminal region (amino acids 67-198) can suppress nuclear factor of activated T cells (NFAT)-mediated transcription (11).
 
The crusty mutation lies within helix H1, near the N terminus of the forkhead domain of Foxp3. The mutated isoleucine is conserved in mouse and human Foxp3, and in greater than 75% of forkhead domains of the mouse Fox proteins. The effect of the mutation on transcription, translation or protein stability is unknown.
Expression/Localization
Foxp3 mRNA is most highly expressed in the lymphoid tissues: spleen, thymus and lymph nodes (12). Within lymphocyte populations, Foxp3 is strongly expressed in TCRαβ+CD4+ T cells, with much lower (90% reduced) expression in CD8+ and B220+ cells (12;14). In particular, Foxp3 is expressed by CD25+CD4+CD8- T cells [regulatory T cells (Treg)], both in the thymus and periphery (15;16). Foxp3 mRNA can be detected in the subset of CD4+CD25- cells that is CD45RBlow, but at 100-fold lower levels relative to expression in CD4+CD25+ cells (16). Expression of Foxp3 mRNA has been reported in some CD8+CD25+ T cells in humans and rats. This cell population possesses regulatory activity in vitro, and protected rats in a model of graft versus host disease in vivo (17;18). Foxp3 is constitutively localized to the nucleus (13;14).
Background
The scurfy mouse and human IPEX syndrome
The gene encoding Foxp3 was identified in 2001 through positional cloning, during efforts to identify the mutation responsible for the scurfy mutant mouse phenotype (12). Scurfy arose spontaneously in 1949 at the Oak Ridge National Laboratory, and early studies on the strain demonstrated the gene to be X-linked, with only Xscurfy/O females and Xscurfy/Y males affected (19). Shortly after birth, scurfy mice develop scaling of the skin that is prominent in the ears, eyelids, feet and tail, severe runting due to chronic diarrhea, reddening and swelling of genital papilla, and anemia. Scurfy mutants exhibit splenomegaly, hepatomegaly, enlarged lymph nodes, and massive lymphocytic infiltrates in lymph nodes, spleen, liver, and skin (20;21). They have reduced numbers of platelets and erythrocytes. The animals typically die by weaning age. The scurfy phenotype is caused by a two base pair insertion in exon 8 of Foxp3, which results in a frameshift and subsequent generation of a truncated transcript lacking the C-terminal forkhead domain.
 
The autoimmune and lymphoproliferative nature of the scurfy phenotype was further demonstrated in several studies. Neonatal thymectomy doubles the lifespan and attenuates disease in scurfy mice, while breeding the scurfy mutation to a nude or SCID background abolishes disease (22;23). Transgenic scurfy mice in which 75-90% of T cells express a T cell receptor (TCR) specific for exogenous antigen (ovalbumin) survive significantly longer than non-transgenic scurfy mice. Rag1 deficiency in these TCR transgenic mice results in 100% of T cells reactive only to ovalbumin peptides, and completely blocks disease (24). These data indicate a requirement for exposure of developing scurfy T cells to endogenous antigen for disease development. In particular, CD4+ T cells are absolutely required for disease progression, as antibody or genetic depletion of CD4+, but not CD8+ T cells, greatly delays the onset of disease (25). Conversely, disease is transferred to H-2 compatible nude mice by scurfy CD4+, but not CD8+, T cells. Scurfy CD4+ T cells are hyperresponsive to TCR stimulation, and exhibit increased expression of costimulatory molecules (26;27). Scurfy splenocytes also produce increased amounts of cytokines in vitro, including interleukin (IL)-4, IL-6, IL-7 and tumor necrosis factor (TNF) (28).
 
Transgenic mice overexpressing Foxp3 allowed examination of the consequences of Foxp3 expression (12;15;27). These animals have reduced peripheral CD4+ and CD8+ T cell numbers, with the extent of reduction correlated with transgene copy number. However, thymic cellularity and selection are unaffected by expression of the Foxp3 transgene. CD4+ T cells from Foxp3 transgenic mice display greatly reduced proliferation and IL-2 production upon TCR stimulation with α-CD3 antibodies. In contrast, scurfy CD4+ T cells produce increased amounts of IL-2 upon TCR stimulation. Together with the phenotype of scurfy mice, these data demonstrate that Foxp3 functions to negatively regulate peripheral CD4+ T cell number and function.
 
In humans, mutations in FOXP3 result in a disorder with features very similar to those observed in scurfy mice (29;30). The syndrome, known as immune dysregulation polyendocrinopathy, enteropathy, X-linked syndrome (IPEX; OMIM #304790), is characterized by watery, sometimes bloody diarrhea, eczema, hemolytic anemia, type I diabetes, and thyroiditis [reviewed in (31)]. Patients with IPEX lack CD4+CD25+Foxp3+ T cells. The disease affects males with hemizygous mutations in FOXP3, but not heterozygous females, and affected individuals typically develop symptoms in early infancy and die within the first two years of life. Mutations in human FOXP3 occur throughout the length of the gene, but appear to cluster in the N-terminal proline-rich repressor region, the leucine zipper domain, and the forkhead domain.
 
Regulatory T cells and Foxp3
Regulatory T cells (Treg) are a subset of CD4+ T cells that constitutively express the IL-2 receptor α chain (CD25) and possess a high level of immune suppressive activity (32). Antibody depletion of CD25+ cells or reconstitution of lymphopenic mice with CD25- cells results in development of autoimmune inflammation in multiple organs, and heightened immune responses to allogeneic cells. Treg cells are anergic, but on activation suppress the proliferation and IL-2 production of naïve and memory effector T cells in the periphery through a contact-dependent, cytokine-independent mechanism (33). Treg cells serve to downregulate the immune response to self and non-self antigens in an antigen-nonspecific manner, thereby establishing tolerance for potentially hazardous self-reactive lymphocytes that may have escaped clonal deletion, as well as limiting the response to foreign antigens.
 
The underlying cause of human IPEX syndrome and the scurfy phenotype (discussed here) is a lack of Foxp3+ Treg cells. Neonatal transfer of CD4+CD25+ Treg cells rescues the lymphoproliferative defect and disease of Foxp3-null and scurfy mice (34). Mice lacking Foxp3 throughout the body or only in CD4+ T cells mice fail to generate CD4+CD25+ Treg cells, and develop a lymphoproliferative disease identical to that of scurfy mice (14;34). Conversely, ectopic expression through retroviral gene transfer of Foxp3 in nonregulatory naïve T cells converts them to a regulatory type which can suppress the proliferation of CD4+CD25- T cells in vitro (16;34).  In vivo, transgenic expression of Foxp3 in mice also converts conventional CD4+ T cells to a regulatory phenotype (15). In addition, transfer of scurfy CD4+ T cells into Rag1-/- hosts causes colitis and weight loss that can be prevented by cotransfer of CD4+ T cells retrovirally transduced with Foxp3. Thus, Foxp3 is necessary and sufficient for Treg cell development and function. Notably, regulatory activity is conferred solely by Foxp3, regardless of the presence CD25, since CD4+CD25+ cells from scurfy mice lack suppressor activity, and Foxp3 transgenic CD4+ cells lacking CD25 have suppressor activity (15;34).
 
Mechanism of Foxp3 function
Both the factors inducing Foxp3, and induced by Foxp3, are under intense investigation. Identifying factors that specifically induce Foxp3 expression is particularly challenging because distinguishing between a direct role in Foxp3 induction versus a role in promoting Treg expansion and survival through other mechanisms is often difficult. Foxp3 expression and Treg cell health and function typically go together. Nonetheless, reports indicate that among the factors that may regulate Foxp3 expression are CD28, IL-2, transforming growth factor (TGF)-β, and TCR/MHC interactions (Figure 4). CD28 has been shown to be required for the survival and proliferation of Treg cells (35). Further work using mixed bone marrow chimeras containing wild type- and Cd28-/--derived donor cells, has provided support for the conclusion that CD28-mediated signaling during thymic development is required specifically for normal Foxp3 expression in CD4+CD25+ cells (36). IL-2 is absolutely required for Treg cell expansion in the thymus and periphery [reviewed in (37)]. Mice lacking IL-2, IL-2Rα, IL-2Rβ, or Stat5, a downstream mediator of IL-2 signaling, all exhibit an approximately 50% reduction of CD4+CD25+ Treg cells. However, Foxp3+ Treg cells present in the thymus and periphery of Il2-/-, Il2ra-/-, and Il2rb-/- mice display normal suppressive activity in vitro, suggesting that IL-2 is required for survival and expansion of Treg cells rather than Foxp3 induction or Foxp3-dependent development/suppressor function (38). On the other hand, the presence of Stat5 binding sites within the promoter region of Foxp3 supports a direct role for IL-2 signaling in controlling Foxp3 induction (39). The role of TGF-β in Foxp3 induction remains unclear. Mice incapable of producing or responding to TGF-β, or with increased TGF-β signaling, have been used to demonstrate both that TGF-β is required and unessential for Treg development and function (40-42). Further analysis of the promoter region of Foxp3 should reveal factors definitively required for Foxp3 induction.
 
The direct transcriptional targets of Foxp3 are actively being sought. Genome-wide analysis using chromatin immunoprecipitation assays followed by microarray analyses demonstrates that Foxp3 functions as both a transcriptional activator and repressor, binding to promoters of upwards of 1,000 genes, including many that modulate T cell activation and function (43;44). Several studies suggest that Foxp3 can also dimerize with other transcription factors, such as NFAT and NF-κB, (11;45;46), and may alter transactivation by these proteins. T cells from scurfy mice display increased NFAT and NF-κB transcriptional activity, consistent with a role for Foxp3 as a corepressor in vivo (46). Foxp3 has been suggested to inhibit transcription of Il2, and may do so through interaction with AML1/Runx1 or NFAT (45;47).  Despite these many findings, how Foxp3 controls Treg cell development and maintenance remains unclear. Recent work using knockin mice that insert Gfp into the Foxp3 locus thereby inactivating Foxp3, suggests that Foxp3 is not required to initiate Treg cell development (48). These mice still develop cells with some Treg cell characteristics, although they lack suppressor activity, suggesting that Foxp3 functions to amplify or stabilize the regulatory state, which is initiated through other mechanisms.
Putative Mechanism
Although the appearance of scurfy and crusty mice is similar, the increased lifespan of crusty mice (3 weeks in scurfy versus >7 weeks in crusty mice) suggests that the Foxp3 mutation in these animals results in a protein with hypomorphic function. The cellular defects in crusty mice are presumed to be the same as those in scurfy mice. Protein expression has not been tested for Foxp3crusty. The crusty mutation resides in the forkhead domain, but based on the crystal structure of Foxp2, the mutated isoleucine is not predicted to make direct contacts with the DNA. I350 is located two residues away from the corresponding amino acid in Foxp2 (tryptophan in Foxp3, glutamine in Foxp2) that is involved in intermolecular interactions in the domain swapped dimer, so it is possible that its mutation could disrupt dimer formation.
Primers Primers cannot be located by automatic search.
Genotyping
Crusty genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.  This protocol has not been tested.
 
Primers
crusty (F): 5’- GGCTATGCCACTTGAGCTGCTTAC -3’
crusty (R): 5’- CCACAGCCTCAGTCTCATGGTTTTG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
Primers for sequencing
crusty_seq(F): 5’- GACTCCTTTTTAAAGTGAGGAGAGC -3’
crusty_seq(R): 5’- TGCGAAACTCAAATTCATCTACGG -3’
 
The following sequence of 1213 nucleotides (from Genbank genomic region NC_000086 for linear genomic sequence of Foxp3) is amplified:
 
12200                     g gctatgccac ttgagctgct tacatgcctt tgatgtacaa
12241 attacttgac tcctttttaa agtgaggaga gctatttggc aggagtactg caaagaagac
12301 acagcttacg gcgggtactc agtaaacagt actatgtgtg agcatagact gtccctcccc
12361 ccttggtgct agtggtagga attgagacct tggattcctg atgcagacaa aggtggggta
12421 gggggtgagg aggccaaagg ctctgatcta tgccaacctt ctgcagagtt cttccacaac
12481 atggactact tcaagtacca caatatgcga ccccctttca cctatgccac ccttatccga
12541 tgggtaagca gggcaataga ggcccagcag ctggtgggcg gcaggggggg agttgtggtg
12601 gggagtgctt gcctcctaca ttgcaccaag agcagaattc acccattaac aaacctcagc
12661 tctgaggagc cccaagatgt gatccttctt gatagcttca cctcagatct agccctcaac
12721 ccaaaactac tgcaagccag gtcagtgcaa agcaaactgt aacactacaa actacccttt
12781 cctttgtcca ccctatctct aacatcaccc ttgacctcat gcctcaccct attctttctc
12841 cttccccttg acccacaatt acaaagctat catagctcag agggccgaga gtaggctgct
12901 ccctcagcca caaccctgag gaacatgccc cttattccac ctgactccaa cttccaggcc
12961 atcctggaag ccccggagag gcagaggaca ctcaatgaaa tctaccattg gtttactcgc
13021 atgttcgcct acttcagaaa ccaccccgcc acctggaagg tgagttcctc tgtacacact
13081 ggcagctggg atggctccaa ggatggttag cctggggcta gacatgtggg gaaggagcag
13141 gtcagtctca gactcaggat gactgtcaac cctgtccctg actggggtcc cggtccccct
13201 tccacagaat gccatccgcc acaacctgag cctgcacaag tgctttgtgc gagtggagag
13261 cgagaaggga gcagtgtgga ccgtagatga atttgagttt cgcaagaaga ggagccaacg
13321 ccccaacaag tgctccaatc cctgcccttg acctcaaaac caagaaaagg tgggcggggg
13381 agggggccaa aaccatgaga ctgaggctgt gg
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is highlighted in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsElaine Pirie, Bruce Beutler
List |< first << previous [record 91 of 511] next >> last >|
Edit History
06/26/2011 2:44 PM (current)
04/12/2011 10:14 AM
03/31/2011 11:20 AM
03/31/2011 11:19 AM
03/31/2011 11:18 AM
01/07/2011 9:02 AM
12/29/2010 9:13 AM
12/29/2010 9:13 AM
12/28/2010 4:05 PM
10/08/2010 1:43 PM
06/28/2010 4:58 PM
06/28/2010 3:05 PM
02/03/2010 5:30 PM