Phenotypic Mutation 'm2sd1' (pdf version)
Allelem2sd1
Mutation Type nonsense
Chromosome5
Coordinate6,540,276 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Tlr6
Gene Name toll-like receptor 6
Chromosomal Location 64,953,106-64,960,048 bp (-)
MGI Phenotype Inactivation of this gene results in abnormal macrophage function.
Accession Number

NCBI RefSeq: NM_011604; MGI: 1341296

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
R457* in Ensembl: ENSMUSP00000062096 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 7.67e-2 SMART
Blast:LRR 110 129 N/A BLAST
LRR 131 155 2.76e1 SMART
Blast:LRR 387 410 N/A BLAST
Blast:LRR 413 437 N/A BLAST
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Phenotypic Category immune system, TLR signaling defect: TNF production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(1) Chemically induced(4

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
insouciant UTSW 5 64954583 missense possibly damaging 0.75
m2sd2 UTSW 5 6540076 nonsense
m2sd3 UTSW 5 64954241 missense possibly damaging 0.95
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 030959-UCD
Last Updated 03/28/2017 9:14 AM by Katherine Timer
Record Created unknown
Record Posted 02/03/2009
Phenotypic Description
Figure 1. A, Peritoneal macrophages from two siblings (A7363 and A7367) produced reduced amounts of TNF-α in response to the TLR 2/6 ligand, MALP-2 (red arrows). Macrophages responses of the IRAK4 mutant otiose, which has altered responses to most TLR ligands, are shown as controls. B, M2sd1 macrophages fail to produce normal levels of TNF-α in response to a range of MALP-2 concentrations. Tirap mutant macrophages from torpid mice, which show altered responses to MALP-2, are used as controls. Also shown are macrophage responses from wild type siblings (A7364 and A7366).

The m2sd1 (MALP-2-specific defect 1) mutant was discovered in a screen of ENU-mutagenized G3 mice for altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from two siblings, one male and one female, displayed reduced tumor necrosis factor (TNF)-α production in response to the TLR2/6 ligand MALP-2 (macrophage-activating lipopeptide-2; Figure 1), but normal TNF-α responses to the TLR2/1 ligand Pam3CSK4 (triacyl lipopeptide), the TLR4 ligand lipopolysaccharide (LPS), the TLR9 ligand CpG-DNA (single-stranded DNA), the TLR 7 ligand resiquimod/R-848 (single-stranded RNA mimetic), and the TLR3 ligand poly I:C (double-stranded RNA).  M2sd1 macrophages also responded normally to the TLR2/6 ligand peptidoglycan (PGN); contamination from a TLR1/2 ligand is likely as TLR6-deficient mice responded normally to this ligand, but TLR2-deficient animals did not. 

Nature of Mutation
Because the m2sd1 phenotype is almost identical to that of Tlr6-/- mice, Tlr6 (Chromosome 5) from m2sd1 mice was sequenced.  A mutation corresponding to an A to T transversion at position 1501 of the Tlr6 transcript, in exon 2 of 2 total exons, was identified.
 
1486 ACAGGCTCTGTCTTCAGATGCTTACCTCCCAAG 
452  -T--G--S--V--F--R--C--L--P--P--K-...
                         deleted
 
The mutated nucleotide is indicated in red lettering, and results in a conversion of an arginine to a stop codon at residue 457 and truncation of 349 amino acids from the C-terminus of the protein.
Protein Prediction
Figure 2. Protein and domain structure of TLR6. A) Schematic representation of TLR6 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the m2sd1 mutation is highlighted. 3D image was created using UCSF Chimera. B) TLR6 is an 806 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The m2sd1 mutation (red asterisk) results in a conversion of an arginine to a stop codon at residue 457 and truncation of 349 amino acids from the C-terminus of the protein.This image is interactive. Click on the image to view other mutations found in TLR6 (red). Click on the mutations for more specific information.
The m2sd1 mutation results in protein truncation at arginine 457 of the TLR6 protein (Figure 2).  This residue lies at the end of the sixteenth leucine rich repeat (LRR).  It is unknown if normal levels of the altered protein are expressed, but truncation would result in a protein missing four LRR repeats, the transmembrane domain and the Toll/IL-1R (TIR) domain, which binds to adaptor proteins and is necessary for signaling. 
 
Please see the record for insouciant for information about Tlr6.
Primers Primers cannot be located by automatic search.
Genotyping
M2sd1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
M2sd1(F): 5’- GGAGACAGCACTGAAGTCACTGATG -3’
M2sd1(R): 5’- TGGCACCACTCACTCTGGATGAAG -3’
 
PCR program (use SIGMA JumpStart REDTaq)
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
M2sd1_seq (F): 5’- TTTCAAAGGAGGCGCTATACTCG -3’
 
The following sequence of 1239 nucleotides (from Genbank genomic region NC_000071 for linear genomic sequence of Tlr6) is amplified:
 
5405     ggagac agcactgaag tcactgatga tagagcacgt caaaaaccaa gtgttcctct
5461 tttcaaagga ggcgctatac tcggtgtttg ctgagatgaa catcaagatg ctctctatct
5521 cagacacccc tttcatccac atggtgtgcc cgccatcccc aagctcattt acatttctga
5581 actttaccca gaatgttttt actgacagtg tttttcaagg ctgttccacc ttaaagagat
5641 tgcagacact tatcttacaa aggaatggtt tgaagaactt ttttaaagta gctctcatga
5701 ctaagaatat gtcctctctg gaaactttgg atgttagttt gaattctttg aactctcatg
5761 catatgacag gacatgcgcc tgggctgaga gcatattggt gttgaatttg tcttcgaata
5821 tgcttacagg ctctgtcttc agatgcttac ctcccaaggt caaggtcctt gaccttcaca
5881 acaacaggat aatgagcatc cctaaagatg tcacccacct gcaggctttg caggaactca
5941 atgtagcatc caactcctta actgaccttc ctgggtgtgg ggccttcagc agcctttctg
6001 tgctggtcat cgaccataac tcagtttccc atccctctga ggatttcttc cagagctgtc
6061 agaatattag atccctaaca gcgggaaaca acccattcca atgcacatgt gagctgaggg
6121 actttgtcaa gaacataggc tgggtagcaa gagaagtggt ggagggctgg cctgactctt
6181 acaggtgtga ctacccagaa agctctaagg gaactgcact gagggacttc cacatgtctc
6241 cactgtcctg tgatactgtt ctgctgactg tcaccatcgg ggccactatg ctggtgctgg
6301 ctgtcactgg ggctttcctc tgtctctact ttgacctgcc ctggtatgtg aggatgctgt
6361 gtcagtggac acagaccagg cacagggcca ggcacatccc cttagaggaa ctccagagaa
6421 acctccagtt ccatgctttt gtctcataca gtgagcatga ttctgcctgg gtgaagaacg
6481 aattactacc caacctagag aaagatgaca tccgggtttg cctccatgag aggaactttg
6541 tccctggcaa gagcattgtg gagaacatca tcaatttcat tgagaagagt tacaaggcca
6601 tctttgtgct gtctccccac ttcatccaga gtgagtggtg cca
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
Science Writers Eva Marie Y. Moresco, Nora G. Smart
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Bruce Beutler
Edit History
06/01/2011 11:27 AM (current)
06/01/2011 11:24 AM
06/01/2011 11:19 AM
01/07/2011 9:19 AM
11/08/2010 11:38 AM
06/25/2010 11:43 AM
06/25/2010 11:39 AM
06/25/2010 11:39 AM
06/25/2010 11:20 AM
02/03/2010 5:19 PM