Phenotypic Mutation 'm2sd1'

• Allele: m2sd1
• Mutation Type: nonsense
• Chromosome: 5
• Coordinate: 65,111,537 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Tlr6
• Gene Name: toll-like receptor 6
• Chromosomal Location: 65,109,374-65,117,440 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011] ; PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Stop codon
• Institutional Source: Beutler Lab
• Ref Sequences:
  R457* in Ensembl: ENSMUSP00000062096
• Gene Model: not available
• AlphaFold: Q9EPW9
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.144)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• MMRRC Submission: 030959-UCD
• Last Updated: 2019-01-31 4:53 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2009-02-03
• Science Writers: Eva Marie Y. Moresco, Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Owen M. Siggs, Bruce Beutler

Accession Number

NCBI RefSeq: NM_011604; MGI: 1341296

Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(1) Chemically induced(4) 

Phenotypic Description

Figure 1. A, Peritoneal macrophages from two siblings (A7363 and A7367) produced reduced amounts of TNF-α in response to the TLR 2/6 ligand, MALP-2 (red arrows). Macrophages responses of the IRAK4 mutant otiose , which has altered responses to most TLR ligands, are shown as controls. B, M2sd1 macrophages fail to produce normal levels of TNF-α in response to a range of MALP-2 concentrations. Tirap mutant macrophages from torpid mice, which show altered responses to MALP-2, are used as controls. Also shown are macrophage responses from wild type siblings (A7364 and A7366).

The m2sd1 (MALP-2-specific defect 1) mutant was discovered in a screen of ENU-mutagenized G3 mice for altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from two siblings, one male and one female, displayed reduced tumor necrosis factor (TNF)-α production in response to the TLR2/6 ligand MALP-2 (macrophage-activating lipopeptide-2; Figure 1), but normal TNF-α responses to the TLR2/1 ligand Pam₃CSK₄ (triacyl lipopeptide), the TLR4 ligand lipopolysaccharide (LPS), the TLR9 ligand CpG-DNA (single-stranded DNA), the TLR 7 ligand resiquimod/R-848 (single-stranded RNA mimetic), and the TLR3 ligand poly I:C (double-stranded RNA).  M2sd1 macrophages also responded normally to the TLR2/6 ligand peptidoglycan (PGN); contamination from a TLR1/2 ligand is likely as TLR6-deficient mice responded normally to this ligand, but TLR2-deficient animals did not. 

Nature of Mutation

Because the m2sd1 phenotype is almost identical to that of Tlr6^-/- mice, Tlr6 (Chromosome 5) from m2sd1 mice was sequenced.  A mutation corresponding to an A to T transversion at position 1501 of the Tlr6 transcript, in exon 2 of 2 total exons, was identified.

 

1486 ACAGGCTCTGTCTTCAGATGCTTACCTCCCAAG 

452  -T--G--S--V--F--R--C--L--P--P--K-...

                         deleted

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of an arginine to a stop codon at residue 457 and truncation of 349 amino acids from the C-terminus of the protein.

Protein Prediction

Figure 2. Protein and domain structure of TLR6. A) Schematic representation of TLR6 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the m2sd1 mutation is highlighted. 3D image was created using UCSF Chimera. B) TLR6 is an 806 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The m2sd1 mutation (red asterisk) results in a conversion of an arginine to a stop codon at residue 457 and truncation of 349 amino acids from the C-terminus of the protein.This image is interactive. Click on the image to view other mutations found in TLR6 (red). Click on the mutations for more specific information.

The m2sd1 mutation results in protein truncation at arginine 457 of the TLR6 protein (Figure 2).  This residue lies at the end of the sixteenth leucine rich repeat (LRR).  It is unknown if normal levels of the altered protein are expressed, but truncation would result in a protein missing four LRR repeats, the transmembrane domain and the Toll/IL-1R (TIR) domain, which binds to adaptor proteins and is necessary for signaling. 

 

Please see the record for insouciant for information about Tlr6.

Primers

Primers cannot be located by automatic search.

Genotyping

M2sd1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

M2sd1(F): 5’- GGAGACAGCACTGAAGTCACTGATG -3’

M2sd1(R): 5’- TGGCACCACTCACTCTGGATGAAG -3’

 

PCR program (use SIGMA JumpStart REDTaq)

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

M2sd1_seq (F): 5’- TTTCAAAGGAGGCGCTATACTCG -3’

 

The following sequence of 1239 nucleotides (from Genbank genomic region NC_000071 for linear genomic sequence of Tlr6) is amplified:

 

5405     ggagac agcactgaag tcactgatga tagagcacgt caaaaaccaa gtgttcctct
5461 tttcaaagga ggcgctatac tcggtgtttg ctgagatgaa catcaagatg ctctctatct
5521 cagacacccc tttcatccac atggtgtgcc cgccatcccc aagctcattt acatttctga
5581 actttaccca gaatgttttt actgacagtg tttttcaagg ctgttccacc ttaaagagat
5641 tgcagacact tatcttacaa aggaatggtt tgaagaactt ttttaaagta gctctcatga
5701 ctaagaatat gtcctctctg gaaactttgg atgttagttt gaattctttg aactctcatg
5761 catatgacag gacatgcgcc tgggctgaga gcatattggt gttgaatttg tcttcgaata
5821 tgcttacagg ctctgtcttc agatgcttac ctcccaaggt caaggtcctt gaccttcaca
5881 acaacaggat aatgagcatc cctaaagatg tcacccacct gcaggctttg caggaactca
5941 atgtagcatc caactcctta actgaccttc ctgggtgtgg ggccttcagc agcctttctg
6001 tgctggtcat cgaccataac tcagtttccc atccctctga ggatttcttc cagagctgtc
6061 agaatattag atccctaaca gcgggaaaca acccattcca atgcacatgt gagctgaggg
6121 actttgtcaa gaacataggc tgggtagcaa gagaagtggt ggagggctgg cctgactctt
6181 acaggtgtga ctacccagaa agctctaagg gaactgcact gagggacttc cacatgtctc
6241 cactgtcctg tgatactgtt ctgctgactg tcaccatcgg ggccactatg ctggtgctgg
6301 ctgtcactgg ggctttcctc tgtctctact ttgacctgcc ctggtatgtg aggatgctgt
6361 gtcagtggac acagaccagg cacagggcca ggcacatccc cttagaggaa ctccagagaa
6421 acctccagtt ccatgctttt gtctcataca gtgagcatga ttctgcctgg gtgaagaacg
6481 aattactacc caacctagag aaagatgaca tccgggtttg cctccatgag aggaactttg
6541 tccctggcaa gagcattgtg gagaacatca tcaatttcat tgagaagagt tacaaggcca
6601 tctttgtgct gtctccccac ttcatccaga gtgagtggtg cca

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.