Phenotypic Mutation 'Palm'

• Allele: Palm
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 34,434,914 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Tap2
• Gene Name: transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
• Synonym(s): HAM2, MTP2, PSF2, Abcb3, Ham2, Ham-2, Tap-2
• Chromosomal Location: 34,423,453-34,435,295 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with Tap1 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutant mice have no CD8+ T cells, although their numbers of CD4+ T cells and B cells are normal. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glutamic Acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000025197]
• AlphaFold: P36371
• SMART Domains: Protein: ENSMUSP00000025197; Gene: ENSMUSG00000024339; AA Change: D652E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC
transmembrane domain	97	119	N/A	INTRINSIC
Pfam:ABC_membrane	151	419	1.8e-62	PFAM
AAA	494	678	2.58e-19	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
  (Using ENSMUST00000025197)
• Meta Mutation Damage Score: 0.1795
• Is this an essential gene?: Probably nonessential (E-score: 0.193)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2020-07-29 6:45 PM by External Program
• Record Created: 2019-01-23 10:11 AM by Bruce Beutler
• Record Posted: 2019-02-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011530; MGI: 98484

Alleles Listed at MGI

All mutations/alleles(4) : Chemically induced (ENU)(4)

Phenotypic Description

Figure 1. Palm mice exhibit increased frequencies of peripheral CD4 + T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Palm phenotype was identified among G3 mice of the pedigree R0841, some of which showed increased frequencies of CD4⁺ T cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased CD4+ T cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 43 mutations (X-axis) identified in the G1 male of pedigree R0841. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 43 mutations. The CD4+ T cell phenotype was linked by continuous variable mapping to mutations in two genes on chromosome 17: Glp1r and Tap2. The mutation in Tap2 was presumed causative as the immune phenotype observed in the Palm mice mimics that of other mice expressing mutant Tap2 alleles (see MGI). The Tap2 mutation is a C to A transversion at base pair 34,215,940 (v38) on chromosome 17, or base pair 11,462 in the GenBank genomic region NC_000083 encoding Tap2. Linkage was found with an additive model of inheritance, wherein four variant homozygotes and 10 heterozygous mic departed phenotypically from six homozygous reference mice with a P value of 5.919 x 10^-5 (Figure 2).  

The mutation corresponds to residue 2,109 in the mRNA sequence NM_011530 within exon 12 of 12 total exons.

2092 TGGAGATCGCAGGGGGACAGGACGATGCTGGTG 647  -W--R--S--Q--G--D--R--T--M--L--V-

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glutamic acid substitution at position 652 (D652E) in the TAP2 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.638).

Protein Prediction

Figure 3. Domain organization and predicted membrane topology of TAP. Top, domain structure of TAP2. Below, Topography of TAP1/TAP2. Both TAP1 and TAP2 contain a 6-helix core transmembrane domain (TMD; purple) and a cytosolic nucleotide binding domain (NBD). Tapasin binding N-terminal accessory domains (pink) consist of 4 and 3 transmembrane helices for TAP1 and TAP2, respectively. The Walker A (A), Walker B (B), and signature/C-loop motif (C) sequences, involved in ATP biding and/or hydrolysis, and color coded to indicate to which ATPase site they belong (green = consensus site,; orange = degenerate site). The Palm mutation results in an aspartic acid to glutamic acid substitution at position 652. The image is interactive. Other mutations found in TAP2 are noted in red. Click on each allele for more information.

The transporter associated with antigen processing (TAP) pumps cytosolic peptides into the endoplasmic reticulum (ER) lumen for loading onto class I major histocompatibility (MHC) molecules and presentation to T lymphocytes. TAP is a member of the ATP-binding cassette (ABC) transporter family, ubiquitous proteins that shuttle a variety of substrates, including ions, sugars, amino acids, peptides, vitamins, lipids, antibiotics, and drugs, across cellular membranes (1;2). TAP is a heterodimer of the homologous TAP1 (724 amino acids in mice) and TAP2 proteins (702 amino acids in mice), each of which contains a six-helix TMD, a C-terminal NBD, and three transmembrane N-terminal accessory domains (Figure 3).

The Palm mutation results in an aspartic acid to glutamic acid substitution at position 652 (D652E). Asp652 is located within the cytoplasmic C-terminal tail.

Please see the record for ganymede for information about Tap2.

Putative Mechanism

TAP is essential for the transport of peptides into the ER for loading onto MHC class I molecules and display at the cell surface. Peptide binding is required to stabilize MHC class I molecules, so mice with disrupted TAP1 or TAP2 genes assemble drastically reduced amounts of MHC class I molecules, and have nearly absent surface expression of MHC class I.  The cells of Tap1^-/- mice (3) and mice with an ENU-induced point mutation in TAP2 (Tap2^jasmine) (4) are deficient in cytosolic antigen presentation, and consequently CD8⁺ T cells fail to develop in these animals. Similarly, human mutations in TAP1 (5;6), TAP2 (7;8), or tapasin (9) cause the rarely occurring bare lymphocyte syndrome type I (type I BLS, OMIM #604571), characterized a reduction in MHC class I surface expression to 1-3% of normal levels.

The phenotype of the Palm mice indicates loss of TAP2-associated function. 

Primers

PCR Primer
Palm_pcr_F: AGATTGTGCCTTGCCTGTGTCC
Palm_pcr_R: TCCAAAACGGTCCCAATCTTTATCCTG

Sequencing Primer
Palm_seq_F: CTCTCTCCAGGATGAAGAATGGTG
Palm_seq_R: CCACAGTCCTGAGAGGGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 557 nucleotides is amplified (chromosome 17, + strand):

1   agattgtgcc ttgcctgtgt cctgggcttt ctcaggttgt tggcagtgga gttaactctc
61  tccaggatga agaatggtga tggtggggtg tctggtcctc catagctgcc tttcccaatg
121 acagctgtac agccatggtg aagggcggac ccctattgcc tgccctttga ggccccctgc
181 acatcccaga ctttctttag cctgagtcac agggacagcc cagctgctgt gttccattca
241 ttgcctttga gtctgtgatc tgtcctctgc agctacagaa ctggagatcg cagggggaca
301 ggacgatgct ggtgattgcc cacaggctgc acacggttca gaatgctgac caagttctgg
361 tgctcaagca gggacgtctg gtggagcatg accagctcag ggacggccag gatgtctacg
421 cccacctggt acagcagcgg ctggaggcat gaggcctcca gaccctgagc ccctctcagg
481 actgtggcca ggatcagacc cacagggacc gtgccggagg aggctagggt caggataaag
541 attgggaccg ttttgga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Borst, P., and Elferink, R. O. (2002) Mammalian ABC Transporters in Health and Disease. Annu Rev Biochem. 71, 537-592.

  2. Higgins, C. F. (1992) ABC Transporters: From Microorganisms to Man. Annu Rev Cell Biol. 8, 67-113.

  3. Van Kaer, L., Ashton-Rickardt, P. G., Ploegh, H. L., and Tonegawa, S. (1992) TAP1 Mutant Mice are Deficient in Antigen Presentation, Surface Class I Molecules, and CD4-8+ T Cells. Cell. 71, 1205-1214.

  4. Theodoratos, A., Whittle, B., Enders, A., Tscharke, D. C., Roots, C. M., Goodnow, C. C., and Fahrer, A. M. (2010) Mouse Strains with Point Mutations in TAP1 and TAP2. Immunol Cell Biol. 88, 72-78.

  5. de la Salle, H., Zimmer, J., Fricker, D., Angenieux, C., Cazenave, J. P., Okubo, M., Maeda, H., Plebani, A., Tongio, M. M., Dormoy, A., and Hanau, D. (1999) HLA Class I Deficiencies due to Mutations in Subunit 1 of the Peptide Transporter TAP1. J Clin Invest. 103, R9-R13.

  6. Furukawa, H., Murata, S., Yabe, T., Shimbara, N., Keicho, N., Kashiwase, K., Watanabe, K., Ishikawa, Y., Akaza, T., Tadokoro, K., Tohma, S., Inoue, T., Tokunaga, K., Yamamoto, K., Tanaka, K., and Juji, T. (1999) Splice Acceptor Site Mutation of the Transporter Associated with Antigen Processing-1 Gene in Human Bare Lymphocyte Syndrome. J Clin Invest. 103, 755-758.

  7. de la Salle, H., Hanau, D., Fricker, D., Urlacher, A., Kelly, A., Salamero, J., Powis, S. H., Donato, L., Bausinger, H., and Laforet, M. (1994) Homozygous Human TAP Peptide Transporter Mutation in HLA Class I Deficiency. Science. 265, 237-241.

  8. Moins-Teisserenc, H. T., Gadola, S. D., Cella, M., Dunbar, P. R., Exley, A., Blake, N., Baykal, C., Lambert, J., Bigliardi, P., Willemsen, M., Jones, M., Buechner, S., Colonna, M., Gross, W. L., and Cerundolo, V. (1999) Association of a Syndrome Resembling Wegener's Granulomatosis with Low Surface Expression of HLA Class-I Molecules. Lancet. 354, 1598-1603.

  9. Yabe, T., Kawamura, S., Sato, M., Kashiwase, K., Tanaka, H., Ishikawa, Y., Asao, Y., Oyama, J., Tsuruta, K., Tokunaga, K., Tadokoro, K., and Juji, T. (2002) A Subject with a Novel Type I Bare Lymphocyte Syndrome has Tapasin Deficiency due to Deletion of 4 Exons by Alu-Mediated Recombination. Blood. 100, 1496-1498.