Phenotypic Mutation 'Substandard'

• Allele: Substandard
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 71,766,122 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Tcf12
• Gene Name: transcription factor 12
• Synonym(s): REB, HTF-4, HTF4, HEB, ALF1, HEBAlt, bHLHb20, ME1
• Chromosomal Location: 71,751,534-72,019,611 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glycine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000034755 ^†] [ENSMUSP00000139365 ^†] [ENSMUSP00000138978 ^†] [ENSMUSP00000139084 ^†] [ENSMUSP00000139334 ^†] [ENSMUSP00000138832 ^†] [ENSMUSP00000138925 ^†] [ENSMUSP00000139364 ^†] [ENSMUSP00000139233 ^†] † probably from a misspliced transcript
• AlphaFold: Q61286
• SMART Domains: Protein: ENSMUSP00000034755; Gene: ENSMUSG00000032228; AA Change: G504S

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	7e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	558	572	N/A	INTRINSIC
HLH	607	660	7.54e-10	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
  (Using ENSMUST00000034755)
• SMART Domains: Protein: ENSMUSP00000139365; Gene: ENSMUSG00000032228; AA Change: G528S

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	7e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	558	572	N/A	INTRINSIC
HLH	607	660	7.54e-10	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
  (Using ENSMUST00000183404)
• SMART Domains: Protein: ENSMUSP00000138978; Gene: ENSMUSG00000032228; AA Change: G358S

Domain	Start	End	E-Value	Type
low complexity region	38	49	N/A	INTRINSIC
low complexity region	86	102	N/A	INTRINSIC
low complexity region	182	193	N/A	INTRINSIC
low complexity region	388	402	N/A	INTRINSIC
HLH	437	490	7.54e-10	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
  (Using ENSMUST00000183918)
• SMART Domains: Protein: ENSMUSP00000139084; Gene: ENSMUSG00000032228; AA Change: G504S

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	5e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC

• Predicted Effect: probably null ; PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
  (Using ENSMUST00000183992)
• SMART Domains: Protein: ENSMUSP00000139334; Gene: ENSMUSG00000032228; AA Change: G334S

Domain	Start	End	E-Value	Type
low complexity region	38	49	N/A	INTRINSIC
low complexity region	86	102	N/A	INTRINSIC
low complexity region	182	193	N/A	INTRINSIC
low complexity region	364	378	N/A	INTRINSIC
HLH	413	466	7.54e-10	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
  (Using ENSMUST00000184448)
• SMART Domains: Protein: ENSMUSP00000138832; Gene: ENSMUSG00000032228; AA Change: G524S

Domain	Start	End	E-Value	Type
PDB:4JOL|H	173	196	6e-8	PDB
low complexity region	204	215	N/A	INTRINSIC
low complexity region	252	268	N/A	INTRINSIC
low complexity region	348	359	N/A	INTRINSIC
low complexity region	554	568	N/A	INTRINSIC
HLH	603	656	7.54e-10	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
  (Using ENSMUST00000184523)
• SMART Domains: Protein: ENSMUSP00000138925; Gene: ENSMUSG00000032228; AA Change: G504S

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	7e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	534	548	N/A	INTRINSIC
HLH	583	636	7.54e-10	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
  (Using ENSMUST00000185117)
• SMART Domains: Protein: ENSMUSP00000139364; Gene: ENSMUSG00000032228; AA Change: G528S

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	7e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	558	572	N/A	INTRINSIC
HLH	607	660	7.54e-10	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
  (Using ENSMUST00000184783)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.1629
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:30 PM by Anne Murray
• Record Created: 2019-01-23 10:15 AM by Bruce Beutler
• Record Posted: 2019-02-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011544 (variant 1), NM_001253862 (variant 2), NM_001253863 (variant 3), NM_001253864 (variant 4), NM_001253865 (variant 5); MGI:101877

Alleles Listed at MGI

All Mutations and Alleles(42) : Chemically induced (ENU)(2) Chemically induced (other)(1) Endonuclease-mediated(1) Gene trapped(35) Targeted(3)

Phenotypic Description

Figure 1. Substandard mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Substandard mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Substandard mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Substandard mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Substandard phenotype was identified among G3 mice of the pedigree R4885, some of which showed reduced B to T cell ratios (Figure 1) and reduced CD4 to CD8 T cell ratios (Figure 2) due to reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 3) with concomitant increased frequencies of CD8+ T cells in CD3+ T cells (Figure 4), all in the peripheral blood.

Nature of Mutation

Figure 5. Linkage mapping of the CD4+ T cells in CD3+ T cells frequency using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R4855. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tcf12: a G to A transition at base pair 71,858,840 (v38) on chromosome 9, or base pair 252,980 in the GenBank genomic region NC_000075. The strongest association was found with an unknown (additive/dominant) model of inheritance to the CD4+ T cells in CD3+ T cells phenotype, wherein 19 heterozygous mice departed phenotypically from 15 homozygous reference mice with a P value of 3.354 x 10^-5 (Figure 5); no homozygous variant mice were available/alive at time of screening.  

The mutation corresponds to residue 1,848 in the mRNA sequence NM_011544 within exon 17 of 21 total exons.

1833 CCAGAAAATTTCAGAGGTGGTGTACAAAATCAG 523  -P--E--N--F--R--G--G--V--Q--N--Q-

The mutated nucleotide is indicated in red. The mutation results in a glycine to serine substitution at residue 528 (G528S) in the HEB protein, and is strongly predicted by Polyphen-2 to be null (score = 0.026).

Protein Prediction

Figure 6. Domain organization of HEB. The Substandard mutation results in a glycine to serine substitution at residue 528 (G528S). Click on other mutations to view additional information. Abbreviations: AD1, activation domain 1; AD2, activation domain 2; bHLH, basic helix-loop-helix.

Tcf12 encodes HeLa E-box binding protein (HEB; alternatively, helix-loop-helix transcription factor-4 [HTF4] or ME1), a member of the class I basic helix-loop-helix (bHLH) transcription factor family. Class I bHLH transcription factors recognize the E box (sequence: CANNTG) in target DNA and are designated as E proteins. E proteins have several similar domains, including a C-terminal bHLH domain and two transcriptional activation domains (AD1 and AD2) [Figure 6; (1); reviewed in (2)]. HEB also has a leucine zipper. The bHLH domains facilitate the dimerization of bHLH proteins, which is required for their transcriptional activity [reviewed in (2)]. The bHLH domain also facilitates interaction with p300, a component of the transcriptional machinery (3). P300 subsequently recruits histone acetyltransferases and RNA polymerase II to the promoter or enhancers of target genes. The AD1 domain recruits the SAGA chromatin remodeling complex as well as the CBP and p300 histone acetyltransferases (4). The AD1 domain also represses transcription by recruiting a family of corepressors called ETO (5). The AD2 domain can drive the expression of reporter constructs containing bHLH target genes (4).

TCF12 has two transcription start sites and undergoes alternatively splicing to produce a shorter HEB variant, HEBalt (6). HEBalt lacks the AD1 domain, but shares the AD2 and bHLH domain with canonical HEB. HEBAlt has a unique domain, the Alt domain, upstream of AD2 compared to canonical HEB. HEBalt is expressed in pro-T cells and enhances the generation of T cell precursors. TCF12 also has two alternative acceptor sites preceding the second exon, which produces two distinct transcripts, HTF4a and HTF4b (7). HTF4a and HTF4b differ in their 5’-UTR, but share identical coding sequences. A cell-type specific protein, HTF4c, is produced by differential utilization of exon 15.

The Substandard mutation results in a glycine to serine substitution at residue 528 (G528S); Gly528 is within an undefined region between the AD2 and bHLH domains.

Please see the record Poorly for more information about Tcf12.

Putative Mechanism

HEB and another E protein, E2A, regulate lymphocyte development and differentiation. E2A and HEB form homo- or heterodimers to activate the transcription of target genes. E2A homodimers are essential for B cell development, while E2A-HEB heterodimers are essential for T cell development (8). E2A and HEB cooperate to maintain DP T cell fate and to control the DP to SP transition until a functional alphabetaTCR is produced (9;10). HEB functions in TCRα and TCRβ gene rearrangement (11;12) as well as in the regulation of pTα (10;13;14) and CD4 (8) gene expression. HEB also putatively assists in the downregulation of IL7R signaling after β-selection. HEB is required for the development of CD73⁺ and CD73⁻ γδT17 cells in the fetal thymus (15). In addition HEB is required for the expression of Sox4, Sox13, and Rorc in immature CD24⁺CD73⁻ γδ T cells (15). HEB interacts with Notch1 and GATA3 to regulate T cell fate choice in developing thymocytes (16). HEB-deficient T cell precursors show compromised Notch1 function and lose T cell potential. After reconstitution of the HEB-deficient T cell precursors with Notch1, the cells adopted a DN1-like phenotype and could be induced to differentiate into thymic NK cells.

Tcf12-deficient (Tcf12^-/-) mice on the 129/Sv * C57BL/6 genetic background exhibited postnatal lethality within two weeks of birth (17). Tcf12^-/- mice showed a 50 percent reduction in the number of pro-B cells (17). Tcf12^-/- mice on the 129S7/SvEvBrd genetic background showed reduced thymocyte numbers due to a block in T cell development at the immature single positive stage (18). Tcf12^-/- mice on the 129S7/SvEvBrd * C57BL/6J genetic background showed thymus hypoplasia, increased numbers of double-negative T cells and CD8+ T cells with a concomitant reduction in the number of double-positive T cells (19). A Tcf12 mutant (HEB^bm/bm) mouse with point mutations within the basic DNA-binding region (R611G, L612H, R613G) showed postnatal lethality within two weeks of birth and postnatal growth retardation (18). Some fetuses showed exencephaly. The HEB^bm/bm mice also showed thymus hypoplasia; reduced thymocyte numbers; impaired B cell differentiation with reduced immature B cell, pro-B cell, and pre-B cell numbers; and aberrant T cell differentiation (i.e., severe block at the DN3 stage of T-cell development) with increased double-negative T cell number, reduced double-positive T cell number, and loss of single-positive T cells in the thymus (18). Approximately 10 to 20 percent of HEB^bm/+ mice showed seizure episodes upon handling by the tail (18).

The phenotypes observed in the Substandard mice indicate loss of HEB-associated function in T cell development.

Primers

PCR Primer
Substandard_pcr_F: TTGTACACCACCTACCGAAGAG
Substandard_pcr_R: ATTCGGAAAGAGTGACACCC

Sequencing Primer
Substandard_seq_F: CCGAAGAGGTAAAGGAAACATAAAAC
Substandard_seq_R: CCTGTAATCCTGGCTATTCAGAAGAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 617 nucleotides is amplified (chromosome 9, - strand):

1   attcggaaag agtgacaccc caaaaaaaga gttgttaaat tcagatgaat agtactatat
61  tctctataaa ttcctgtata agacttaaac aaaaccaaat gaagtagtgt atgcctgtaa
121 tcctggctat tcagaagact gaggcaggag agtcatttga attaaggatt tcaagaccag
181 cctgccagct ggcctatcac aataaaataa aataaaataa aataaaataa aataaaataa
241 aataaaataa aataaaaatt ggccactgtt gatttctttc tgattatttt caccttaggt
301 cggaacacat cgggaagatt cagtcagtct caatggcaat cattcggtcc tgtctagtac
361 tgttgctgcc tcaaacacag aactgaacca taaaacacca gaaaatttca gaggtgactg
421 tttttttcat tttgaccact aatttctaag ttctttctgg gtctacataa cagactttcc
481 cttgcctcca gaaggtttct aacagcataa ccctaagggg tatttaccct ctagaaagct
541 tagaaccatc ttggttgaaa cgtgaatcta gacttatgtt ttatgtttcc tttacctctt
601 cggtaggtgg tgtacaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Aronheim, A., Shiran, R., Rosen, A., and Walker, M. D. (1993) The E2A Gene Product Contains Two Separable and Functionally Distinct Transcription Activation Domains. Proc Natl Acad Sci U S A. 90, 8063-8067.

  2. Belle, I., and Zhuang, Y. (2014) E Proteins in Lymphocyte Development and Lymphoid Diseases. Curr Top Dev Biol. 110, 153-187.

  3. Eckner, R., Yao, T. P., Oldread, E., and Livingston, D. M. (1996) Interaction and Functional Collaboration of p300/CBP and bHLH Proteins in Muscle and B-Cell Differentiation. Genes Dev. 10, 2478-2490.

  4. Massari, M. E., Grant, P. A., Pray-Grant, M. G., Berger, S. L., Workman, J. L., and Murre, C. (1999) A Conserved Motif Present in a Class of Helix-Loop-Helix Proteins Activates Transcription by Direct Recruitment of the SAGA Complex. Mol Cell. 4, 63-73.

  5. Zhang, J., Kalkum, M., Yamamura, S., Chait, B. T., and Roeder, R. G. (2004) E Protein Silencing by the Leukemogenic AML1-ETO Fusion Protein. Science. 305, 1286-1289.

  6. Wang, D., Claus, C. L., Vaccarelli, G., Braunstein, M., Schmitt, T. M., Zuniga-Pflucker, J. C., Rothenberg, E. V., and Anderson, M. K. (2006) The Basic Helix-Loop-Helix Transcription Factor HEBAlt is Expressed in Pro-T Cells and Enhances the Generation of T Cell Precursors. J Immunol. 177, 109-119.

  7. Gan, T. I., Rowen, L., Nesbitt, R., Roe, B. A., Wu, H., Hu, P., Yao, Z., Kim, U. J., O'Sickey, T., and Bina, M. (2002) Genomic Organization of Human TCF12 Gene and Spliced mRNA Variants Producing Isoforms of Transcription Factor HTF4. Cytogenet Genome Res. 98, 245-248.

  8. Sawada, S., and Littman, D. R. (1993) A Heterodimer of HEB and an E12-Related Protein Interacts with the CD4 Enhancer and Regulates its Activity in T-Cell Lines. Mol Cell Biol. 13, 5620-5628.

  9. Jones, M. E., and Zhuang, Y. (2007) Acquisition of a Functional T Cell Receptor during T Lymphocyte Development is Enforced by HEB and E2A Transcription Factors. Immunity. 27, 860-870.

  10. Wojciechowski, J., Lai, A., Kondo, M., and Zhuang, Y. (2007) E2A and HEB are Required to Block Thymocyte Proliferation Prior to Pre-TCR Expression. J Immunol. 178, 5717-5726.

  11. D'Cruz, L. M., Knell, J., Fujimoto, J. K., and Goldrath, A. W. (2010) An Essential Role for the Transcription Factor HEB in Thymocyte Survival, Tcra Rearrangement and the Development of Natural Killer T Cells. Nat Immunol. 11, 240-249.

  12. Langerak, A. W., Wolvers-Tettero, I. L., van Gastel-Mol, E. J., Oud, M. E., and van Dongen, J. J. (2001) Basic Helix-Loop-Helix Proteins E2A and HEB Induce Immature T-Cell Receptor Rearrangements in Nonlymphoid Cells. Blood. 98, 2456-2465.

  13. Takeuchi, A., Yamasaki, S., Takase, K., Nakatsu, F., Arase, H., Onodera, M., and Saito, T. (2001) E2A and HEB Activate the Pre-TCR Alpha Promoter during Immature T Cell Development. J Immunol. 167, 2157-2163.

  14. Tremblay, M., Herblot, S., Lecuyer, E., and Hoang, T. (2003) Regulation of pT Alpha Gene Expression by a Dosage of E2A, HEB, and SCL. J Biol Chem. 278, 12680-12687.

  15. In, T. S. H., Trotman-Grant, A., Fahl, S., Chen, E. L. Y., Zarin, P., Moore, A. J., Wiest, D. L., Zuniga-Pflucker, J. C., and Anderson, M. K. (2017) HEB is Required for the Specification of Fetal IL-17-Producing Gammadelta T Cells. Nat Commun. 8, 2004-017-02225-5.

  16. Braunstein, M., and Anderson, M. K. (2011) HEB-Deficient T-Cell Precursors Lose T-Cell Potential and Adopt an Alternative Pathway of Differentiation. Mol Cell Biol. 31, 971-982.

  17. Zhuang, Y., Cheng, P., and Weintraub, H. (1996) B-Lymphocyte Development is Regulated by the Combined Dosage of Three Basic Helix-Loop-Helix Genes, E2A, E2-2, and HEB. Mol Cell Biol. 16, 2898-2905.

  18. Barndt, R. J., Dai, M., and Zhuang, Y. (2000) Functions of E2A-HEB Heterodimers in T-Cell Development Revealed by a Dominant Negative Mutation of HEB. Mol Cell Biol. 20, 6677-6685.

  19. Wikstrom, I., Forssell, J., Penha-Goncalves, M. N., Bergqvist, I., and Holmberg, D. (2008) A Role for E2-2 at the DN3 Stage of Early Thymopoiesis. Mol Immunol. 45, 3302-3311.