Phenotypic Mutation 'Enlarged' (pdf version)
AlleleEnlarged
Mutation Type critical splice acceptor site
Chromosome9
Coordinate95,721,471 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Trpc1
Gene Name transient receptor potential cation channel, subfamily C, member 1
Synonym(s) Trrp1, Mtrp1, Trp1
Chromosomal Location 95,705,082-95,750,375 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011643, NM_001311123; MGI:109528

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000057640 ] [ENSMUSP00000057640 ] [ENSMUSP00000057640 ] [ENSMUSP00000057640 ] [ENSMUSP00000140994 ] [ENSMUSP00000140994 ] [ENSMUSP00000140994 ] [ENSMUSP00000140994 ] [ENSMUSP00000140994 ] [ENSMUSP00000140994 ] [ENSMUSP00000140994 ] [ENSMUSP00000140994 ] [ENSMUSP00000139672 ] [ENSMUSP00000139672 ] [ENSMUSP00000139672 ] [ENSMUSP00000139672 ] [ENSMUSP00000140550 ] [ENSMUSP00000140550 ] [ENSMUSP00000140550 ] [ENSMUSP00000140550 ] [ENSMUSP00000139577 ] [ENSMUSP00000139577 ] [ENSMUSP00000139577 ] [ENSMUSP00000139577 ]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 2.6e-27 PFAM
transmembrane domain 367 386 N/A INTRINSIC
Pfam:Ion_trans 407 673 5.9e-17 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 2.6e-27 PFAM
transmembrane domain 367 386 N/A INTRINSIC
Pfam:Ion_trans 407 673 5.9e-17 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 2.6e-27 PFAM
transmembrane domain 367 386 N/A INTRINSIC
Pfam:Ion_trans 407 673 5.9e-17 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 2.6e-27 PFAM
transmembrane domain 367 386 N/A INTRINSIC
Pfam:Ion_trans 407 673 5.9e-17 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 1.8e-29 PFAM
transmembrane domain 367 386 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
Pfam:Ion_trans 441 661 1.2e-21 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 1.8e-29 PFAM
transmembrane domain 367 386 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
Pfam:Ion_trans 441 661 1.2e-21 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 1.8e-29 PFAM
transmembrane domain 367 386 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
Pfam:Ion_trans 441 661 1.2e-21 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 1.8e-29 PFAM
transmembrane domain 367 386 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
Pfam:Ion_trans 441 661 1.2e-21 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Meta Mutation Damage Score 0.468 question?
Is this an essential gene? Probably nonessential (E-score: 0.169) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (Female) - increased
Candidate Explorer Status CE: excellent candidate; human score: 2; ML prob: 0.716
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (other)(1) Endonuclease-mediated(2) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Trpc1 APN 9 95726494 missense probably damaging 1.00
IGL02094:Trpc1 APN 9 95743281 missense probably damaging 1.00
IGL02412:Trpc1 APN 9 95736861 missense probably damaging 1.00
IGL02494:Trpc1 APN 9 95708307 missense probably damaging 1.00
IGL02943:Trpc1 APN 9 95708853 splice site probably benign
IGL03025:Trpc1 APN 9 95710260 missense probably damaging 1.00
IGL03221:Trpc1 APN 9 95706900 missense probably damaging 1.00
luxus UTSW 9 95721132 critical splice donor site probably null
magnified UTSW 9 95726437 missense probably damaging 1.00
PIT4581001:Trpc1 UTSW 9 95736921 missense probably benign 0.21
R0034:Trpc1 UTSW 9 95749761 missense probably damaging 0.98
R1973:Trpc1 UTSW 9 95723255 missense probably benign
R2033:Trpc1 UTSW 9 95706843 missense probably damaging 0.99
R2117:Trpc1 UTSW 9 95717584 missense probably damaging 1.00
R2262:Trpc1 UTSW 9 95706933 missense probably damaging 1.00
R2910:Trpc1 UTSW 9 95749842 missense probably benign 0.00
R2918:Trpc1 UTSW 9 95723129 missense probably damaging 1.00
R3156:Trpc1 UTSW 9 95721132 critical splice donor site probably null
R3427:Trpc1 UTSW 9 95732196 missense probably benign 0.12
R4093:Trpc1 UTSW 9 95706865 missense probably benign 0.12
R4384:Trpc1 UTSW 9 95732108 missense probably benign 0.13
R4787:Trpc1 UTSW 9 95721415 missense probably benign 0.02
R5327:Trpc1 UTSW 9 95721471 critical splice acceptor site probably null
R5576:Trpc1 UTSW 9 95721324 missense probably damaging 0.97
R6320:Trpc1 UTSW 9 95721250 missense probably damaging 1.00
R6499:Trpc1 UTSW 9 95726437 missense probably damaging 1.00
R6714:Trpc1 UTSW 9 95723273 missense probably damaging 1.00
R7179:Trpc1 UTSW 9 95721144 missense possibly damaging 0.82
R7265:Trpc1 UTSW 9 95708275 missense probably benign
X0026:Trpc1 UTSW 9 95732044 missense probably benign 0.36
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:30 PM by Anne Murray
Record Created 2019-01-23 10:43 AM by Bruce Beutler
Record Posted 2019-02-14
Phenotypic Description

Figure 1. Enlarged mice exhibited increased body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Enlarged phenotype was identified among G3 mice of the pedigree R5327, some of which showed increased body weights compared wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the body weight phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 95 mutations (X-axis) identified in the G1 female of pedigree R5327. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 95 mutations. The increased body weight phenotype was linked to a mutation in Trpc1:  an A to G transition at base pair 95,721,471 (v38) on chromosome 9, or base pair 28,917 in the GenBank genomic region NC_000075 within the splice acceptor site of intron 6 (2-base pairs from exon 7 [out of 13 total exons]). Linkage was found with an additive model of inheritance, wherein one variant female homozygote and seven heterozygous female mice departed phenotypically from four homozygous reference female mice with a P value of 2.793 x 10-5 (Figure 2). 

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic site in exon 7. The resulting transcript would have a 14-base pair deletion of exon 7, causing an in-frame deletion of four amino acids beginning after amino acid 336 of the protein, which is normally 809 amino acids long. An alternative cryptic site in exon 7 may also be used (not shown), causing a 56-base pair deletion of exon 7. The use of this cryptic site would cause an in-frame deletion of 18 amino acids beginning after amino acid 336 of the protein.

 

          <--exon 6          <--intron 6 exon 7-->                    exon 8-->
1468 ……AACCAGAAGGAG ……tctgtgtgtccttttcag TTTGTCTCCCAG……AATTGCCAGCAG…… GGATGATTTGG……
333  ……-N--Q--K--E-                      -F--V--S--Q-……-N--C--Q--Q-…… G--M--I--W-……

         correct                           deleted              correct

 

The splice acceptor site of intron 6, which is destroyed by the Enlarged mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction
Figure 3. Domain organization and topography of TRPC1. A, Domain. B, Topography. The Enlarged mutation destroys the acceptor splice site of intron 6. This image is interactive. Other mutations found in TRPC1 are noted in red. Click on each mutation for more information. Abbreviations: ANK, ankyrin repeats; TM, transmembrane domains; CC, coiled-coil

TRPC1 is one of seven members (TRPC1 through TRPC7) of the transient receptor potential canonical (TRPC) family of cation channels. The 809-amino acid TRPC1 has large intracellular N- and C-terminal tails as well as six transmembrane (TM)-spanning domains, with a putative hydrophobic, pore-forming region between the fifth and sixth domains. TRPC1 has four (NOTE: SMART shows only three) ankyrin repeats within its N-terminal tail. Ankyrin repeats span over 33 residues and are highly divergent, but contain a basic core motif of an initial β-hairpin followed by two anti-parallel α helices connected by a tight-hairpin loop. TRPC1 also has a TPR box (EWKFAR) of unknown function as well as a C-terminal coiled-coil that putatively mediates protein-protein interactions. TRPC1 has a calmodulin-binding domain that partially overlaps with an inositol 1,4,5-trisphosphate (IP3) receptor (IP3R)-binding domain (1); the calmodulin domain encompasses the C-terminal coiled-coil.

 

The Enlarged mutation putatively results in a 14-base pair deletion of exon 7, causing an in-frame deletion of four amino acids beginning after amino acid 336 of the protein.

 

Please see the record magnified for more information about Trpc1.

Putative Mechanism

TRPC1 functions in store-operated calcium entry in several tissues/cell types, including salivary gland, keratinocytes, smooth muscle, neuronal and endothelial cells, and platelets (2). Store-operated calcium entry is activated in response to an increase in the level of IP3 caused by stimulation of cell surface receptors that are associated with the activation of PLC and hydrolysis of the plasma membrane lipid phosphatidylinositol bisphosphate, PIP2. Store-operated calcium entry occurs upon internal calcium store depletion in the ER and stimulation of calcium mobilizing receptors. Store-operated calcium entry regulates several cell functions, including cell proliferation and survival, differentiation, secretion, and cell migration (2). TRPC1-associated store-operated calcium entry promotes several processes, including salivary fluid secretion, smooth and skeletal muscle function, endothelial cell migration and permeability, wound healing, smooth muscle cell and embryonic stem cell proliferation, neuronal differentiation, vasocontraction, liver cell volume regulation, regulation of platelet aggregation, and protection against cell death [reviewed in (2;3)].

 

Trpc1-deficient (Trpc1-/-) mice are overtly healthy and have normal lifespans, but exhibited reduced neurotransmitter-regulated salivary gland fluid secretion (4). Trpc1-/- mice also showed increased body weights (5). Loss of Trpc1 expression resulted in elimination of sustained Ca2+-dependent potassium channel activity in salivary gland acinar cells (4).

 

The body weight phenotype observed in the Enlarged mice mimics that of Trpc1-/- mice (5), indicating loss of TRPC1-associated function. The mechanism by which loss of TRPC1 function leads to increased body weight/length is unknown, but indicates that TRPC1 functions in growth and development.

Primers PCR Primer
Enlarged(F):5'- GTGTGTGAATGATTCTGCCAAATTGAG -3'
Enlarged(R):5'- GGCCGTATCCTAAGAACACG -3'

Sequencing Primer
Enlarged_seq(F):5'- ATTGAGATTTGGGAGCTATCAAATAG -3'
Enlarged_seq(R):5'- CTTTGAATACCAGTCAGTTAC -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 530 nucleotides is amplified (chromosome 9, - strand):


1   ggccgtatcc taagaacacg acactgaatc ttcacaagtt catgaggagc tactgttgct
61  atcgagacgt tagaaatgag ggctgggaag cttggagagg ctgaaaactt actcatggtc
121 atttcgtctg tgtcagagcc tagatgtgaa tctgtgtgat cagactccat agtctattct
181 ctgaacctct tcactcttag ttgtaagagg gaaaaaaact gtaaactttg taggcttttt
241 tcctaatgtt aatactttga ataccagtca gttactgttt taagagtttg tttttttttt
301 taaccctgct tttgtttttt atgtttctgt gtgtcctttt cagtttgtct cccagtcaaa
361 ttgccagcag ttcctgaaca cggtttggtt tggacagatg tcaggttacc gccgtaagcc
421 cacctgtaag aagataatga ctgttttgac agttggcatc ttctggccag ttttgtcact
481 atgctatttg atagctccca aatctcaatt tggcagaatc attcacacac 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsZhao Zhang and Bruce Beutler