Phenotypic Mutation 'Enlarged'

• Allele: Enlarged
• Mutation Type: critical splice acceptor site
• Chromosome: 9
• Coordinate: 95,603,524 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Trpc1
• Gene Name: transient receptor potential cation channel, subfamily C, member 1
• Synonym(s): Mtrp1, Trp1, Trrp1
• Chromosomal Location: 95,587,135-95,632,428 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000057640 ^†] [ENSMUSP00000140994] [ENSMUSP00000139672 ^†] [ENSMUSP00000140550 ^†] [ENSMUSP00000139577 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000057640; Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	2.6e-27	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
Pfam:Ion_trans	407	673	5.9e-17	PFAM
coiled coil region	770	794	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000140994; Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
Blast:ANK	15	44	7e-12	BLAST
Pfam:TRP_2	50	105	1e-18	PFAM
transmembrane domain	201	222	N/A	INTRINSIC
transmembrane domain	237	254	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139672; Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	1.8e-29	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
transmembrane domain	407	424	N/A	INTRINSIC
Pfam:Ion_trans	441	661	1.2e-21	PFAM
coiled coil region	770	794	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000140550; Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000139577; Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9497
• Is this an essential gene?: Probably nonessential (E-score: 0.096)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:30 PM by Anne Murray
• Record Created: 2019-01-23 10:43 AM by Bruce Beutler
• Record Posted: 2019-02-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Zhao Zhang and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011643, NM_001311123; MGI:109528

Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (other)(1) Endonuclease-mediated(2) Targeted(5)

Phenotypic Description

Figure 1. Enlarged mice exhibited increased body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Enlarged phenotype was identified among G3 mice of the pedigree R5327, some of which showed increased body weights compared wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the body weight phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 95 mutations (X-axis) identified in the G1 female of pedigree R5327. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 95 mutations. The increased body weight phenotype was linked to a mutation in Trpc1:  an A to G transition at base pair 95,721,471 (v38) on chromosome 9, or base pair 28,917 in the GenBank genomic region NC_000075 within the splice acceptor site of intron 6 (2-base pairs from exon 7 [out of 13 total exons]). Linkage was found with an additive model of inheritance, wherein one variant female homozygote and seven heterozygous female mice departed phenotypically from four homozygous reference female mice with a P value of 2.793 x 10^-5 (Figure 2). 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic site in exon 7. The resulting transcript would have a 14-base pair deletion of exon 7, causing an in-frame deletion of four amino acids beginning after amino acid 336 of the protein, which is normally 809 amino acids long. An alternative cryptic site in exon 7 may also be used (not shown), causing a 56-base pair deletion of exon 7. The use of this cryptic site would cause an in-frame deletion of 18 amino acids beginning after amino acid 336 of the protein.

<--exon 6          <--intron 6 exon 7-->                    exon 8--> 1468 ……AACCAGAAGGAG ……tctgtgtgtccttttcag TTTGTCTCCCAG……AATTGCCAGCAG…… GGATGATTTGG…… 333  ……-N--Q--K--E-                      -F--V--S--Q-……-N--C--Q--Q-…… G--M--I--W-……          correct                           deleted              correct

The splice acceptor site of intron 6, which is destroyed by the Enlarged mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 3. Domain organization and topography of TRPC1. A, Domain. B, Topography. The Enlarged mutation destroys the acceptor splice site of intron 6. This image is interactive. Other mutations found in TRPC1 are noted in red. Click on each mutation for more information. Abbreviations: ANK, ankyrin repeats; TM, transmembrane domains; CC, coiled-coil

TRPC1 is one of seven members (TRPC1 through TRPC7) of the transient receptor potential canonical (TRPC) family of cation channels. The 809-amino acid TRPC1 has large intracellular N- and C-terminal tails as well as six transmembrane (TM)-spanning domains, with a putative hydrophobic, pore-forming region between the fifth and sixth domains. TRPC1 has four (NOTE: SMART shows only three) ankyrin repeats within its N-terminal tail. Ankyrin repeats span over 33 residues and are highly divergent, but contain a basic core motif of an initial β-hairpin followed by two anti-parallel α helices connected by a tight-hairpin loop. TRPC1 also has a TPR box (EWKFAR) of unknown function as well as a C-terminal coiled-coil that putatively mediates protein-protein interactions. TRPC1 has a calmodulin-binding domain that partially overlaps with an inositol 1,4,5-trisphosphate (IP₃) receptor (IP₃R)-binding domain (1); the calmodulin domain encompasses the C-terminal coiled-coil.

The Enlarged mutation putatively results in a 14-base pair deletion of exon 7, causing an in-frame deletion of four amino acids beginning after amino acid 336 of the protein.

Please see the record magnified for more information about Trpc1.

Putative Mechanism

TRPC1 functions in store-operated calcium entry in several tissues/cell types, including salivary gland, keratinocytes, smooth muscle, neuronal and endothelial cells, and platelets (2). Store-operated calcium entry is activated in response to an increase in the level of IP₃ caused by stimulation of cell surface receptors that are associated with the activation of PLC and hydrolysis of the plasma membrane lipid phosphatidylinositol bisphosphate, PIP₂. Store-operated calcium entry occurs upon internal calcium store depletion in the ER and stimulation of calcium mobilizing receptors. Store-operated calcium entry regulates several cell functions, including cell proliferation and survival, differentiation, secretion, and cell migration (2). TRPC1-associated store-operated calcium entry promotes several processes, including salivary fluid secretion, smooth and skeletal muscle function, endothelial cell migration and permeability, wound healing, smooth muscle cell and embryonic stem cell proliferation, neuronal differentiation, vasocontraction, liver cell volume regulation, regulation of platelet aggregation, and protection against cell death [reviewed in (2;3)].

Trpc1-deficient (Trpc1^-/-) mice are overtly healthy and have normal lifespans, but exhibited reduced neurotransmitter-regulated salivary gland fluid secretion (4). Trpc1^-/- mice also showed increased body weights (5). Loss of Trpc1 expression resulted in elimination of sustained Ca²⁺-dependent potassium channel activity in salivary gland acinar cells (4).

The body weight phenotype observed in the Enlarged mice mimics that of Trpc1^-/- mice (5), indicating loss of TRPC1-associated function. The mechanism by which loss of TRPC1 function leads to increased body weight/length is unknown, but indicates that TRPC1 functions in growth and development.

Primers

PCR Primer
Enlarged_pcr_F: GTGTGTGAATGATTCTGCCAAATTGAG
Enlarged_pcr_R: GGCCGTATCCTAAGAACACG

Sequencing Primer
Enlarged_seq_F: ATTGAGATTTGGGAGCTATCAAATAG
Enlarged_seq_R: CTTTGAATACCAGTCAGTTAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 530 nucleotides is amplified (chromosome 9, - strand):

1   ggccgtatcc taagaacacg acactgaatc ttcacaagtt catgaggagc tactgttgct
61  atcgagacgt tagaaatgag ggctgggaag cttggagagg ctgaaaactt actcatggtc
121 atttcgtctg tgtcagagcc tagatgtgaa tctgtgtgat cagactccat agtctattct
181 ctgaacctct tcactcttag ttgtaagagg gaaaaaaact gtaaactttg taggcttttt
241 tcctaatgtt aatactttga ataccagtca gttactgttt taagagtttg tttttttttt
301 taaccctgct tttgtttttt atgtttctgt gtgtcctttt cagtttgtct cccagtcaaa
361 ttgccagcag ttcctgaaca cggtttggtt tggacagatg tcaggttacc gccgtaagcc
421 cacctgtaag aagataatga ctgttttgac agttggcatc ttctggccag ttttgtcact
481 atgctatttg atagctccca aatctcaatt tggcagaatc attcacacac 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Boulay, G., Brown, D. M., Qin, N., Jiang, M., Dietrich, A., Zhu, M. X., Chen, Z., Birnbaumer, M., Mikoshiba, K., and Birnbaumer, L. (1999) Modulation of Ca(2+) Entry by Polypeptides of the Inositol 1,4, 5-Trisphosphate Receptor (IP3R) that Bind Transient Receptor Potential (TRP): Evidence for Roles of TRP and IP3R in Store Depletion-Activated Ca(2+) Entry. Proc Natl Acad Sci U S A. 96, 14955-14960.

  2. Ong, H. L., and Ambudkar, I. S. (2011) The Dynamic Complexity of the TRPC1 Channelosome. Channels (Austin). 5, 424-431.

  3. Beech, D. J. (2005) TRPC1: Store-Operated Channel and More. Pflugers Arch. 451, 53-60.

  4. Liu, X., Cheng, K. T., Bandyopadhyay, B. C., Pani, B., Dietrich, A., Paria, B. C., Swaim, W. D., Beech, D., Yildrim, E., Singh, B. B., Birnbaumer, L., and Ambudkar, I. S. (2007) Attenuation of Store-Operated Ca2+ Current Impairs Salivary Gland Fluid Secretion in TRPC1(-/-) Mice. Proc Natl Acad Sci U S A. 104, 17542-17547.

  5. Dietrich, A., Kalwa, H., Storch, U., Mederos y Schnitzler, M., Salanova, B., Pinkenburg, O., Dubrovska, G., Essin, K., Gollasch, M., Birnbaumer, L., and Gudermann, T. (2007) Pressure-Induced and Store-Operated Cation Influx in Vascular Smooth Muscle Cells is Independent of TRPC1. Pflugers Arch. 455, 465-477.