Phenotypic Mutation 'sos' (pdf version)
Allelesos
Mutation Type missense
Chromosome6
Coordinate142,565,927 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Kcnj8
Gene Name potassium inwardly-rectifying channel, subfamily J, member 8
Synonym(s) Kir6.1, sltr, gnite, slmbr
Chromosomal Location 142,564,939-142,571,356 bp (-)
MGI Phenotype Mice homozygous for a targeted null mutation exhibit sudden cardiac death due to dysregulation of the vascular tonus in the coronary arteries, and exhibit a phenotype resembling Prinzmetal (or variant) angina in humans.
Accession Number

NCBI RefSeq: NM_008428; MGI: 1100508

Mapped Yes 
Amino Acid Change Isoleucine changed to Threonine
Institutional SourceBeutler Lab
Ref Sequences
I318T in Ensembl: ENSMUSP00000032374 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:IRK 37 380 3.5e-155 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using Ensembl: ENSMUSP00000032374)
Phenotypic Category cardiovascular system, homeostasis/metabolism, immune system, lethality-postnatal, TLR signaling defect: hypersensitivity to LPS
Penetrance 100% 
Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(2) Spontaneous(1) Chemically induced(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnj8 APN 6 142570235 missense probably damaging 1.00
IGL02303:Kcnj8 APN 6 142570111 missense probably benign 0.01
IGL03026:Kcnj8 APN 6 142566473 missense probably damaging 0.99
goodnight UTSW 6 large deletion
mayday UTSW 6 large deletion
slumber UTSW 6 large deletion
solitaire UTSW 6 large deletion
R0278:Kcnj8 UTSW 6 142570348 missense probably benign 0.12
R0927:Kcnj8 UTSW 6 142565901 missense possibly damaging 0.82
R1680:Kcnj8 UTSW 6 142570189 nonsense probably null
R1864:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R1865:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R2087:Kcnj8 UTSW 6 142565696 missense probably benign 0.02
R4900:Kcnj8 UTSW 6 142566495 missense probably damaging 1.00
R5863:Kcnj8 UTSW 6 142565688 missense not run
X0018:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0020:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0026:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0027:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0061:Kcnj8 UTSW 6 142570120 missense probably damaging 1.00
X0065:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 031704-UCD
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 04/24/2009
Phenotypic Description

The sos phenotype was identified in a screen of ENU-mutagenized G3 mice for susceptibility to low dose (5-10 μg) intraperitoneal injection of lipopolysaccharide (LPS). Two female siblings among a litter of 7 G3 mice died in response to LPS injection.

Nature of Mutation
Figure 2. Membrane topology and domain structure of a Kir6.1 monomer. Kir proteins contain two transmembrane helices designated M1 (outer helix) and M2 (inner helix), a pore loop, and N- and C-terminal cytoplasmic domains. The pore loop contains the selectivity filter (SF), the narrowest part of the conduction pathway. The sos mutation results in an isoleucine to threonine substitution at position 318 of the Kir6.1 protein. This image is interactive. Click on the image to view other mutations found in Kcnj8 (red). Click on the mutations for more specific information.   
The two candidate genes Kcnj8 and Abcc9 were sequenced. A mutation corresponding to a T to C transition at position 1200 of the Kcnj8 transcript was identified. The mutation exists in exon 3 of 3 total exons.
 
1184 TACATTGCCGAGGAGATCCAGTGGGGACACCGC
313  -Y--I--A--E--E--I--Q--W--G--H--R-
 
The mutated nucleotide is indicated in red lettering, and results in an isoleucine to threonine substitution at position 318 of the Kir6.1 protein (Figure 2).
 
Please see the record for mayday for more information about Kcnj8.
Putative Mechanism
Figure 3. A, Crystal structure of the N- and C-terminal cytoplasmic domains of mouse Kir2.1. The domains (N-terminus, residues 41-64; C-terminus, residues 189-248) are fused to stabilize the protein for crystalization. B, View from outside toward the inside of the cell of the homotetramer formed by four Kir2.1 N- and C-terminal domains. The central space forms the pore of the channel. UCSF Chimera model based on PDB 1U4F, Kuo et al. Science 300, 1922-1926 (2003). This image is interactive. Click on each 3D structure to view it rotate.
Kir6.1 and Kir6.2 are the two channel-forming proteins of ATP-sensitive K+ (KATP) channels. Four Kir6 proteins form the central pore of the KATP channel, while four regulatory sulfonylurea receptor (SUR) proteins (either SUR1 or SUR2) are located peripherally (1). Although crystal structures of Kir6.1 and Kir6.2 have not been reported, analysis of the related Kir3.1, Kir2.1 and KirBac1.1 crystal structures reveals that the residue mutated in sos mice, isoleucine 318, is located within strand βJ of the C-terminal cytoplasmic domain of Kir6.1 (Figure 3; PDB ID 1U4F) (2-4). The N- and C-terminal domains of the Kir proteins control the passage of ions through the channel by a variety of interactions with cytoplasmic small molecules and proteins. Strand βJ has not been directly implicated in the gating of the Kir6.1 channel. However, based on the structures of Kir2.1 and Kir3.1, it is located adjacent to a pore-facing loop region designated the “G-loop”, between the βH and βI strands, which may act as a diffusion barrier between the cytoplasmic and transmembrane pores of the channel (3). Another nearby region (amino acids 334-337) has been shown to bind ATP in Kir6.2, resulting in channel inhibition (5). Each of Kir1.1, Kir2.1, Kir3.1, and KirBac1.1 contains a hydrophobic residue (Ile or Val) at the same position in strand βJ as the isoleucine mutated in sos mice, suggesting its importance for channel structure and function. The sos mutation may impair gating by the G-loop or ATP binding, but further studies are required to determine its precise effect.
Primers Primers cannot be located by automatic search.
Genotyping
Sos genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
Primers
sos (F): 5’- GCACTCGCTGACCTGACATCATTTC -3’
sos (R): 5’-TGACCTGACTACAGAGACTGCTGG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
Primers for sequencing
sos_seq(F): 5’- CCTGTTGATAATCCCATCGAGAG -3’
sos_seq(R): 5’- TACAGAGACTGCTGGGAAGAAAAC -3’
 
The following sequence of 1250 nucleotides (minus strand, from Genbank genomic region NC_000072 for linear genomic sequence of Kcnj8) is amplified:
 
4801         gc actcgctgac ctgacatcat ttctgatatt ggtccttaca ggtcattcac
4861 gtctgcgttt ctcttctcca ttgaggttca agtgaccatt gggtttggag ggagaatgat
4921 gactgaggaa tgccctctgg ccatcacggt tttgattctg cagaacatcg tgggtctgat
4981 catcaacgca gtcatgttgg gctgcatctt catgaagacg gcgcaggccc acagaagggc
5041 agagacgctg attttcagcc gccatgctgt gattgccgtc cgcaatggca agctgtgctt
5101 catgttccgg gtgggtgacc tgaggaagag catgatcatt agcgcctcgg tgcgcatcca
5161 ggtggtcaag aaaaccacga cgccagaagg ggaggtggtg cctattcatc agcaggacat
5221 tcctgttgat aatcccatcg agagcaataa tatcttccta gtggccccat tgatcatctg
5281 ccacgtgatt gacaagcgta gccccctgta tgatatctca gcaactgacc ttgccaatca
5341 agacctggag gtcatagtga ttctcgaggg cgtggtagaa accacaggca tcaccacaca
5401 agcacggacc tcctacattg ccgaggagat ccagtgggga caccgcttcg tgtcaattgt
5461 gactgaggag gagggcgtgt actctgtgga ctattccaaa tttggtaaca cggtgagagt
5521 ggctgcgcca agatgcagtg cccgggagct ggatgagaag ccttccatcc tgattcagac
5581 cctccaaaag agcgaactgt cgcaccagaa ttctctgcgg aagcgcaact ccatgaggag
5641 aaacaactcc atgaggagaa acaactccat caggaggaat aactcttccc tcatggtgcc
5701 caaggtgcag ttcatgactc cagaaggaaa ccagtgtcca tcagaatcat gagggcagga
5761 tgaccggaga cagttacttg ttgagtcctg atgactgata gccctgaaca gtcactgtgt
5821 cctgatgact gagagacaat ccggagacag ttcattgagt tccgatgatc aaaatattgc
5881 actcatcacc agttcagggc tggagcacag tattcctatc ctaatgcact gagaaatatt
5941 aatatttgag acattaaact tcctgtatta ataaacaata acacacaaac ctgagctctt
6001 tattctcctc tcatcttaaa attctgtttt cttcccagca gtctctgtag tcaggtca
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
  2. Kuo, A., Gulbis, J. M., Antcliff, J. F., Rahman, T., Lowe, E. D., Zimmer, J., Cuthbertson, J., Ashcroft, F. M., Ezaki, T., and Doyle, D. A. (2003) Crystal Structure of the Potassium Channel KirBac1.1 in the Closed State. Science. 300, 1922-1926.
  3. Pegan, S., Arrabit, C., Zhou, W., Kwiatkowski, W., Collins, A., Slesinger, P. A., and Choe, S. (2005) Cytoplasmic Domain Structures of Kir2.1 and Kir3.1 show Sites for Modulating Gating and Rectification. Nat. Neurosci. 8, 279-287.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsAmanda L. Blasius, Bruce Beutler
Edit History
01/07/2011 9:43 AM (current)
12/29/2010 3:45 PM
08/17/2010 4:18 PM
08/17/2010 4:08 PM
08/17/2010 4:05 PM
08/16/2010 1:10 PM
08/16/2010 1:08 PM
02/03/2010 10:35 AM