Phenotypic Mutation 'Belated' (pdf version)
AlleleBelated
Mutation Type missense
Chromosome17
Coordinate57,608,214 bp (GRCm39)
Base Change A ⇒ T (forward strand)
Gene Vav1
Gene Name vav 1 oncogene
Chromosomal Location 57,586,100-57,635,031 bp (+) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011691, NM_001163815, NM_001163816; MGI:98923

MappedYes 
Amino Acid Change Threonine changed to Serine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000005889] [ENSMUSP00000108491] [ENSMUSP00000126694]
AlphaFold P27870
PDB Structure NMR STRUCTURE OF THE Y174 AUTOINHIBITED DBL HOMOLOGY DOMAIN [SOLUTION NMR]
CRYSTAL STRUCTURE OF VAV SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF VAV AND GRB2 SH3 DOMAINS [X-RAY DIFFRACTION]
Solution structure of N-terminal SH3 domain mutant(P33G) of murine Vav [SOLUTION NMR]
Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method [SOLUTION NMR]
CRITICAL STRUCTURAL ROLE FOR THE PH AND C1 DOMAINS OF THE VAV1 EXCHANGE FACTOR [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: T321S

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
(Using ENSMUST00000005889)
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: T321S

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
(Using ENSMUST00000112870)
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: T297S

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
(Using ENSMUST00000169220)
Meta Mutation Damage Score 0.2222 question?
Is this an essential gene? Possibly nonessential (E-score: 0.257) question?
Phenotypic Category Unknown
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(12) : Chemically induced (ENU)(3) Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57606176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57614067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57604090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57612351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57603582 missense probably benign 0.38
Delayed UTSW 17 57603552 missense probably damaging 1.00
Endlich UTSW 17 57604086 missense probably damaging 1.00
finally UTSW 17 57618860 nonsense probably null
Last UTSW 17 57603039 missense probably damaging 0.99
Late UTSW 17 57608870 missense possibly damaging 0.91
Plain_sight UTSW 17 57604122 missense probably damaging 1.00
tardive UTSW 17 57610079 nonsense probably null
R0116:Vav1 UTSW 17 57603039 missense probably damaging 0.99
R0125:Vav1 UTSW 17 57606847 missense probably damaging 1.00
R0268:Vav1 UTSW 17 57603090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57603090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57586271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57610862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57616498 splice site probably benign
R1345:Vav1 UTSW 17 57608214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57610849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57610849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57604252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57631750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57634697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57610140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57613187 missense probably benign 0.05
R4623:Vav1 UTSW 17 57606839 splice site probably null
R4753:Vav1 UTSW 17 57613140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57603552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57610846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57604122 missense probably damaging 1.00
R5503:Vav1 UTSW 17 57610079 nonsense probably null
R5592:Vav1 UTSW 17 57611835 missense probably benign 0.00
R5782:Vav1 UTSW 17 57603001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57608870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57608884 missense probably benign 0.00
R6514:Vav1 UTSW 17 57634660 missense probably damaging 1.00
R6575:Vav1 UTSW 17 57612280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57609330 missense possibly damaging 0.92
R7024:Vav1 UTSW 17 57586268 missense probably damaging 1.00
R7063:Vav1 UTSW 17 57618860 nonsense probably null
R7322:Vav1 UTSW 17 57609266 missense probably benign
R7335:Vav1 UTSW 17 57603720 missense probably benign
R7474:Vav1 UTSW 17 57606102 missense probably benign 0.07
R7665:Vav1 UTSW 17 57604086 missense probably damaging 1.00
R8964:Vav1 UTSW 17 57606122 missense probably benign
R8978:Vav1 UTSW 17 57631650 missense probably benign
R8978:Vav1 UTSW 17 57603710 missense probably benign 0.04
R9165:Vav1 UTSW 17 57618895 missense probably damaging 1.00
R9453:Vav1 UTSW 17 57613191 missense probably benign
R9728:Vav1 UTSW 17 57612459 missense probably benign 0.00
Z1176:Vav1 UTSW 17 57610853 missense probably damaging 1.00
Z1177:Vav1 UTSW 17 57610040 missense probably benign 0.18
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:30 PM by Anne Murray
Record Created 2019-01-23 10:59 AM by Bruce Beutler
Record Posted 2019-02-01
Phenotypic Description

Figure 1. Belated mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Belated phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1345, some of which a reduced T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1).
Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent antibody response using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R1345. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. The T-dependent antibody response phenotype was linked by continuous variable mapping to a mutation in Vav1:  an A to T transversion at base pair 57,301,214 (v38) on chromosome 17, or base pair 22,136 in the GenBank genomic region NC_000083. Linkage was found with an additive model of inheritance, wherein two variant homozygotes and nine heterozygous mice departed phenotypically from seven homozygous reference mice with a P value of 1.631 x 10-5 (Figure 2). 

The mutation corresponds to residue 1,059 in the mRNA sequence NM_011691 within exon 10 of 27 total exons.

 

1044 AACAATGGCCGATTCACCCTACGGGATCTGCTG

316  -N--N--G--R--F--T--L--R--D--L--L-

 
 

The mutated nucleotide is indicated in red. The mutation results in a threonine to serine substitution at amino acid 321 (R321S) in the VAV1 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.057).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain structure of VAV1. The Belated mutation results in a threonine to serine substitution at amino acid 321 (R321S). Other mutations in VAV1 are noted. Click on each mutation to view more information. Abbreviations: CH, calponin-homology; Ac, acidic motif; DH, DBL homology domain; PH, pleckstrin homology domain, C1/ZF, phorbol-ester/DAG-type zinc finger; Pro-rich, proline-rich region; SH2, Src homology 2 domain; SH3, Src homology 3 domain.

Vav1 has several domains, including a calponin-homology (CH) domain, an acidic (Ac) motif, a DBL homology (DH) domain, a pleckstrin homology (PH) domain, a phorbol-ester/DAG-type zinc finger (alternatively, C1 domain), a proline-rich region, a Src homology 2 (SH2) domain, and two Src homology 3 (SH3) domains [Figure 3; PDB: 3KY9; (1;2); reviewed in (3)]. Vav1 also has two nuclear localization sequences.

The Belated mutation results in a threonine to serine substitution at amino acid 321 (R321S). Amino acid 321 is within the DH domain.  The DH domain of Vav1 facilitates its GEF activity.

Please see the record tardive for more information about Vav1.

Putative Mechanism

Vav1 is a guanine nucleotide exchange factor (GEF) for Rho family GTPases. Vav1 is essential for hematopoiesis, including T- and B-cell development and activation (4-6). Vav1 also functions in the adhesion, migration, and phagocytosis of mature hematopoietic cells by regulating cytoskeletal rearrangement [reviewed in (7)]. In NK cells, the Vav1 GEF activity is required for activation of NK-associated killing (8). Vav1 has several functions in macrophages, including Rac-dependent complement-mediated phagocytosis (9), cell migration (10), and chemotaxis to CSF-1 (11).

Vav1 functions downstream of several immune receptors, including the T-cell receptor (TCR) (12), B-cell receptor (BCR) (13), natural killer (NK) receptors (14), FcRI (15), cytokine receptors (16), chemokine receptors (17), and integrins (18). 

Vav1 is a binding partner of Nef proteins from HIV-1 (19). Binding of VAV1 and Nef results in morphological changes, cytoskeletal rearrangements, and activation of the JNK/SAPK signaling cascade, subsequently leading to increased viral transcription and replication.

Vav1-deficient (Vav1-/-) mice exhibited embryonic lethality between embryonic day (E) 3.5 and E7.5 (20). A second Vav1-/- mouse model was viable, and exhibited impaired negative T cell selection (21). Single-positive (namely CD4+ T cells), double-positive, and double-negative T cell numbers as well as the number of mature B cells and B1 cells were reduced in the Vav1-/- mice (22-27). T cells from the Vav1-/- mice showed reduced proliferative responses to anti-CD3 stimulation as well as reduced T cell receptor-induced calcium fluxes (21;23;24). The T-dependent IgG response to VSV infection and to NIP-OVA was reduced (27). Homozygous mice expressing an ENU-induced Vav1 allele (F203S) exhibited increased numbers of T cells after immunization (MGI; accessed September 14, 2017).

The phenotype of the Belated mice indicates loss of Vav1-associated function.

Primers PCR Primer
Belated_pcr_F: gcacctcacaaactgagtcCTTGTACT
Belated_pcr_R: ACTTCCAACTGATGCTGACCCACTA

Sequencing Primer
Belated_seq_F: ctgagtcCTTGTACTTAGTCAAATCC
Belated_seq_R: gctgcttctttcctgccttg
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 753 nucleotides is amplified (chromosome 17, + strand):


1   gcacctcaca aactgagtcc ttgtacttag tcaaatccat ttgcccctcc tcccctgcct
61  cctgtcctcc tcctgccctg tgccatatgt gtttcccatg atgctcctat tttccaccct
121 gccaggaatg ttctcaaaga gctaacaatg gccgattcac cctacgggat ctgctgatgg
181 tacctatgca gcgggtgctg aagtaccacc tccttctcca ggtgccagca cacggctggg
241 tccccttggg tgtggctggg tgacacccta gtctccattt tgttgctgca gtaaaaacat
301 acaggcaaaa gcaactataa gggagaaagt gcgtgcctgg gaagtcaagg caggaaagaa
361 gcagctagtc acacccttaa agggcagagc caactgaaca cacgcttgct cagtcttgct
421 tggctaaatc tccacttaca caggtccagg atccaaacct ggggactgat gccactcaca
481 aggagtgggt cttcccacct ctacgaacgc aattaagaca gtcccccata aacacacgtg
541 cacacaggct aacttgatct ctagagtccc tcaccgagac tctctttcca gatgattttc
601 gactgtgtca acatgacaat taaaatgaat cattacagaa tctgggctgg gcccagaggg
661 tggggaaggc tggctttgag aggttgggta catcagctat tgggttatgc ccagtgtcta
721 ggaggaccta gtgggtcagc atcagttgga agt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi and Bruce Beutler