Phenotypic Mutation 'Unnatural'

• Allele: Unnatural
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 128,761,174 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Klrb1c
• Gene Name: killer cell lectin-like receptor subfamily B member 1C
• Synonym(s): Ly55c, Nk1.1, Ly59, Nk-1, Nkrp1-c, Nk1, CD161, Nk-1.2, Ly-59, NKR-P1, NK-RP1, NK-1.1, NKR-P1C
• Chromosomal Location: 128,755,448-128,765,514 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: This locus controls an antigen on natural killer cells. The a allele determines the Nk1.1 antigen in strains CE, C57BL/6, C57BR/cd, C57L, C58, DBA/1, MA/My, NZB, SJL, SM and B10.D2. The b allele determines the Nk1.2 antigen in strains CBA/J, BALB/c, C3H/He, A/J, DBA/2, LP and 129. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000127297; Gene: ENSMUSG00000030325; AA Change: D148G

Domain	Start	End	E-Value	Type
transmembrane domain	87	109	N/A	INTRINSIC
CLECT	139	256	1.65e-25	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
  (Using ENSMUST00000167691)
• SMART Domains: Protein: ENSMUSP00000134184; Gene: ENSMUSG00000030325; AA Change: D98G

Domain	Start	End	E-Value	Type
transmembrane domain	41	63	N/A	INTRINSIC
CLECT	90	207	1.65e-25	SMART

• SMART Domains: Protein: ENSMUSP00000134504; Gene: ENSMUSG00000030325; AA Change: D151G

Domain	Start	End	E-Value	Type
transmembrane domain	87	109	N/A	INTRINSIC
CLECT	142	259	1.65e-25	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
  (Using ENSMUST00000174404)
• SMART Domains: Protein: ENSMUSP00000134055; Gene: ENSMUSG00000030325

Domain	Start	End	E-Value	Type
transmembrane domain	76	98	N/A	INTRINSIC

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.052)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Sperm, gDNA
• MMRRC Submission: 032644-UCD
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2009-08-03
• Science Writers: Eva Marie Y. Moresco, Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Owen M. Siggs, Bruce Beutler

Accession Number

NCBI RefSeq:  NM_008527; MGI: 107538

Alleles Listed at MGI

All alleles(3) : Targeted, knock-out(1) Other(2)

Phenotypic Description

Figure 1. G3 mice screened for the percentage of cells in the blood expressing the indicated markers. A9401, the index Unnatural mutant, failed to express NK1.1 (red circle).

Figure 2. Pedigree of A9401, the index of Unnatural mutant.

The Unnatural phenotype was discovered in a screen of ENU-mutagenized G3 mice (C57BL/6J) for alterations in hematopoietic cell surface markers. The index mouse was found to lack expression of the cell surface protein NK1.1 (also known as NKR-P1C), which is expressed on natural killer (NK) cells, and a subset of T cells (NKT cells) (Figures 1 and 2).  A 50% reduction in the NK1.1 mean fluorescence is observed in Unnatural heterozygotes, indicating that the mutation is semidominant.

Nature of Mutation

Due to the lack of expression of NK1.1, the NK1.1 gene Klrb1c on Chromosome 6 was directly sequenced, and an A to G transition at position 398 of the Klrb1c transcript in exon 4 of 6 total exons was identified.

 

382 TGGCTTTTACACCGAGATAAGTGCTTTCACGTT

95  -W--L--L--H--R--D--K--C--F--H--V-

 

The mutated nucleotide is indicated in red lettering, and causes an aspartic acid to glycine change at residue 100 of the NKR-P1C protein.

Protein Prediction

Figure 3. The NKC gene complex on mouse Chromosome 6. The Nkrp1 ( Klrb1 ) and Clr genes are color coded to indicate the function of their gene products. Chromosomal gene orientation is not shown. Proteins encoded by Nkrp1b and Clr-b , as well as Nkrp1f and Clr-g , have been demonstrated to interact (see Background). Figure not to scale. Adapted from Carlyle et al. Semin Immunol . 20, 321-330 (2008).

The 39 kDa, 220-amino acid NKR-P1C (natural killer receptor protein 1C) belongs to a family of receptors that are mainly expressed on natural killer (NK) cells (1-3). The genes encoding these receptors are genetically linked on Chromosome 6 in a complex known as the NK gene complex (NKC) (Figure 3) (4). In addition to the Nkrp1 family, this complex includes the Ly49 genes and the C-type lectin-related (Clr) genes (4-7). Members of the latter group have now been shown to encode transmembrane proteins that bind to NKR-P1 receptors (6;7), although the ligand for NKR-P1C has not been identified. Many of the murine NK cell receptors are divergent from NK cell receptors present in humans, but the NKR-P1 family is conserved in rodents and humans (8). Humans possess only a single family member, designated NKR-P1A (also known as KLRB1, killer cell lectin-like receptor subfamily B, member 1; and CD161), which is 48% identical to mouse NKR-P1C. However, while mouse NKR-P1C is an activating receptor, human NKR-P1A is an inhibitory receptor (9).

 

Figure 4. Domain structure of NKR-P1C. The location of the Unnatural mutation is indicated with a red asterisk. LBM, Lck-binding motif; TM, transmembrane domain; CTLD, C-type lectin domain.

Like other NKR-P1/Ly49 receptors, NKR-P1C is classified as a type II membrane C-type lectin [reviewed in (10)]. C-type lectins are calcium-dependent lectins that are carbohydrate-binding proteins of animal origin.  Carbohydrate-binding activity of C-type lectins is based on the function of the carbohydrate recognition domain (CRD) whose structure is highly conserved among this family (11). Members of the C-type lectin-like family of NK receptors (Ly49A-W, NKR-P1A-E, CD94/NKG2A, and CD69) are transmembrane proteins with a single transmembrane domain (amino acids 39-66 for NKR-P1C), extracellular carboxyl termini and cytoplasmic amino termini (Figure 4). The CRD or C-type lectin-like domain (CTLD; amino acids 98-208 for NKR-P1C) is located at the extracellular carboxyl terminus (10). Unlike other C-type lectins, the NK receptors are not carbohydrate-binding proteins and do not appear to be calcium-dependent (12). They bind to other proteins and are involved in signal transduction based on cell-cell recognition (5;10). 

 

Figure 5. Crystal structure of human CD69 in noncovalent dimeric form. The crystallized protein (beginning with Gly70) does not include the interchain dimerization cysteine (Cys68), but the overall fold and dimer arrangement are identical to those described previously (see Reference 15). The structure has a classical C-type lectin-like fold composed of two α-helices and three β-sheets. 31% identity exists between mouse NKR-P1C and human CD69 (within aa 91-209 for NKR-P1C and aa 85-196 for CD69). The residue corresponding to Asp100 mutated in Unnatural (Arg94 in CD69), located adjacent to strand β0, is indicated in red. The residue corresponding to Ser191 (Phe175 in CD69), located within strand β3, shown in yellow. UCSF Chimera model is based on PDB 3CCK, Vanek et al., FEBS J. 275, 5589-5606 (2008). Click on the 3D structure to view it rotate.

The three-dimensional structure of the CTLDs for several of the C-type lectin transmembrane NK cell receptor proteins have been elucidated, with or without binding to ligand, including Ly49 family members and CD69 (11-17). However, the structure of the NKR-P1 family has not been studied, and the exact three-dimensional characteristics of these proteins remain unknown. Despite the diversity in ligands that bind to NK cell receptors, the characterized extracellular domains do display a highly conserved core structure, consisting of two antiparallel β-sheets formed by β-strands β0, β1 and β5, and β2, β2’, β3 and β4, and, in most cases, two α-helices (α1 and α2) arranged in a conserved folding pattern (Figure 5, PDB ID 3CCK) [reviewed in (10)]. β-strands 1-5 and α1, in particular, are conserved in structure, while the orientation of α2 is variable.   Considerable variation is observed in the sequence and conformation of the loops connecting the β-strands, with loops 1 and 2 being more similar in structure amongst different proteins, and large differences observed in loops 3 and 5. Loop 3 comprises the ligand-binding region of these proteins (12;17), and the variation in conformation allows ligand-binding specificity amongst the NK cell receptors (10). The CTLDs from these proteins also contain three conserved disulfide bonds between α1 and β5, β3 and the loop following β4, and β0 and β1. NK cell receptors, including NKR-P1 receptors, exist at the cell-surface in homo- or heterodimeric form, which is stabilized by an interchain disulfide bond (18). In characterized NK cell receptors, the subunits associate through the β0 strand and the C-terminal ends of α2 (when present) to form a hydrophobic interface. The β0 strands are linked by two hydrogen bonds and contain a conserved W-X-X-Y/H motif (10).

 

The NK1.1 antibody recognizes distinct NKR-P1 receptors in various mouse strains. For instance, the NK1.1 antibody binds specifically to NKR-P1C in C57BL/6 mice, and to NKR-P1B in SW/J mice, while not binding to any NKR-P1 receptors in BALB/c animals (1;3;19). This specificity appears to be partially due to the presence of a serine instead of a threonine at residue 191 in β3 of the CTLD. Residue 191 is not sufficient to generate the NK1.1 epitope, as rat NKR-P1A and NKR-P1B sequences contain a serine at the correct position, but are not recognized by NK1.1. This suggests that the NK1.1 epitope relies on additional context-dependent amino acid residues, and that denaturation of the three-dimensional structure of the epitope destroys its reactivity (20).

 

NK1.1 (NKR-P1C)-mediated activation occurs through association with the FcRγ adapter molecule (originally called FcεRIγ) (21), an integral membrane protein that associates with and transduces signals from the ligand-binding α chains of FcγRI, FcγRIII and FcεRI (22-25). The FcRs, receptors for the Fc domain of immunoglobulins (Ig), function in antibody transport across epithelial tissues, antibody-dependent cellular cytotoxicity (see Background), phagocytosis, and other processes (26). The FcRγ chain is homolgous to the CD3ζ chain that is part of the TCR complex. The association between NKR-P1C and FcRγ involves charged transmembrane residues present in both NKR-P1C and FcRγ (R63 for NKR-P1C) (19).   NKR-P1 receptors also contain a conserved motif C-X-C-P-R/H in their cytoplasmic domains that binds to the lymphocyte protein tyrosine kinase (Lck) and is necessary for signaling (27;28) (see the record for iconoclast).   

 

The Unnatural mutation substitutes an aspartic acid to glycine at residue 100 of NKR-P1C. This residue is located near N-terminal end of the extracellular CTLD domain in the loop between β0 and β1. The effect of the mutation on expression and localization of the NKR-P1C protein is not known.

Expression/Localization

NKR-P1 family members are mainly expressed on the surface of NK cells, although a subset of mature T cells also express the NK1.1 epitope (NKT cells) (29). In C57BL/6J, the NK1.1 antigen (therefore NKR-P1C) is expressed on virtually all developing and mature NK cells (2;3;30). During development, a transient population of NK1.1⁺ cells in fetal thymus is observed on day 14, but not on day 16 of gestation.  On day 16 of gestation, NK1.1⁺ cells are detected only in liver and spleen (30). Later studies determined that NKR-P1C is first expressed in the fetal thymus in progenitors committed to T and NK cell fates (31). Interestingly, the Nkrp1b gene (and protein) is expressed in these progenitors prior to entry into the thymus (19).

 

Transcription of the mouse Nkrp1c gene is controlled by three functional promoters that regulate expression of Nkrp1c transcripts at various stages. Promoter 1 is located immediately upstream of the first coding exon and is active at all stage of NK cell development (32). Promoter 2 is located immediately upstream of promoter 1 and is active only in mature NK cells, while promoter 3 is located 9 kb upstream of promoter 1 and is active only in fetal NK cells. Promoter 3 contains a site that exhibits enhancer-like activity. Neither of the Nkrp1c transcripts initiated by promoters 2 and 3 represents coding exons. The promoter/enhancer regions of Nkrp1c and Nkrp1b/d are conserved (33).

Background

NK cells are large granular lymphocytes capable of recognizing and killing certain tumor and virally infected cells, but not normal cells. NK cells belong to the innate arm of the immune system, functioning as one of the first lines of defense against microbial infection and tumor cells. Mature NK cells exist in a ready state, able to launch an immediate response. Once activated, NK cells perform several effector functions: (1) Spontaneous killing. NK cells kill via exocytosis of perforin- and granzyme-containing cytoplasmic granules to lyse target cells, similar to CD8⁺ cytotoxic T lymphocytes (CTL) (34). NK cells also kill through activation of FasL- and TRAIL-mediated pathways (35;36). (2) Cytokine production. Activated NK cells produce cytokines including TNF-α and IFN-γ, which mediate antiviral and cytotoxic effects, and prime the activity of other immune cells (37). The production of cytokines upon activation occurs rapidly, enabled in part by NK cell maintenance of stored cytokine transcripts that are immediately available for initiation of cytokine synthesis (38). (3) Chemokine production. NK cells help to attract other hematopoietic cells by secreting chemokines such as macrophage inflammatory protein (MIP)-1α, MIP-1β, and the factor regulated on activation-normal T cell expressed and secreted (RANTES) (37;39). 

 

Figure 6. (A) NK cell inhibitory receptors include the Ly49 receptor family, the human killer cell immunoglobulin-like receptor (KIR) L family, and the CD94/NKG2A complex, and signaling is mediated through an immunoreceptor tyrosine-based inhibitory motif (ITIM) in their cytoplasmic domains. The ITIM is phosphorylated by Src family kinases and recruits phophatases such as SHP1, SHP2, and SHIP-1, leading to the inhibition of NK cell activation. Activating receptors include a subset of mouse Ly49 receptors, human KIR S family proteins, the CD94/NKG2C complex, and the NKG2D receptor, which interact with immunoreceptor tyrosine-based activation motif (ITAM)-containing molecules. Syk and ZAP70 are recruited to phosphorylated ITAMs via their SH2 domains, leading to NK cell activation and cytolytic function. (B) Potential NK cell-target cell interactions that induce NK activation or produce no response.

NK cells recognize abnormal cells as their targets, and distinguish them from normal healthy cells using several classes of constitutively expressed cell surface receptors, which regulate NK activation, proliferation and effector functions [reviewed in (40)] (Figure 6). NK cell receptor genes do not require somatic recombination, and NK cells develop and function normally in mice and humans that are unable to rearrange their antigen receptor genes (41;42). The observation that NK cells could lyse MHC-negative targets, and that NK cells appeared to be actively inhibited from responding to tumor cells expressing MHC class I, led to the formation of the “missing-self hypothesis” (43;44). It proposed that NK cells survey for targets with downregulated MHC class I, which frequently occurs on tumor or virally infected cells, and predicted the existence of negative regulatory receptors which interact with MHC molecules and prevent destruction of normal host cells. Both inhibitory and activating NK cell receptors have since been identified. The inhibitory MHC class I-specific receptors include members of the mouse Ly49 receptor family, the human killer cell immunoglobulin-like receptor (KIR) L family, and the CD94/NKG2A complex found in mice and humans. NK cell activating receptors include a subset of mouse Ly49 receptors, human KIR S family proteins, the CD94/NKG2C complex, and the NKG2D receptor, and recognize MHC class I-related and non-MHC ligands.

 

NK cell function is controlled by the integration of signals from numerous activating and inhibitory receptors (40). Stimulation of activating receptors will lead to killing only if that signaling outbalances signals from inhibitory receptors (which generally predominate). Thus, when multiple receptors or a sufficiently potent activating NK receptor is stimulated, NK cells are capable of eliminating targets even if their inhibitory receptors for MHC class I are ligated (45;46). Signaling from inhibitory receptors is mediated through an immunoreceptor tyrosine-based inhibitory motif (ITIM) in their cytoplasmic domains, which is phosphorylated by Src-family kinases and recruits phosphatases such as SHP1 (mutated in spin), SHP2, and SHIP-1 (mutated in styx), that presumably oppose phosphorylation pathways that activate NK cells. In contrast, NK cell activating receptors lack the intracellular ITIM, typically containing instead positively charged transmembrane residues that mediate interactions with immunoreceptor tyrosine-based activation motif (ITAM)-containing molecules such as DNAX-activating protein (DAP)10, DAP12, CD3ζ, and FcRγ adapter proteins. Upon tyrosine phosphorylation of the ITAM, the tyrosine kinases Syk and ZAP70 are recruited via their SH2 domains and initiate downstream signaling, ultimately leading to calcium influx, degranulation, and synthesis of cytokines and chemokines.

 

NKR-P1C lacks an ITIM and contains a charged transmembrane residue, consistent with its function as an activating receptor. In mice, antibodies to NKR-P1C (or against NKR-P1A in rats) mediate redirected lysis by NK cells against Fc receptor-bearing target cells (47;48).  Redirected lysis by NK cells is the phenomenon where an antibody against an activating NK receptor can induce lysis of an irrelevant target cell; redirected lysis requires the presence of FcR on the target cell which bind to the Fc region of the antibody, linking the NK and target cells. Thus, NKR-P1C can activate the cytolytic process. Antibody-dependent crosslinking of the rat NKR-P1A receptor has been shown to result in phosphatidylinositol (PI) turnover and calcium influx (49), while crosslinking NKR-P1C with the NK1.1 antibody in mice results in IFN-γ production by NK cells (50).

 

As mentioned above, the ability of NKR-P1C to activate NK cells upon receptor engagement depends on its association with FcRγ, a component of the NK cell-specific FcγRIII receptor (51). FcRγ protects the α chain of the receptor complex from degradation in the endoplasmic reticulum (26). NK cells from mice lacking FcRγ fail to produce IFN-γ or kill target cells in redirected lysis or antibody-dependent cellular cytotoxicity (ADCC, essentially the reverse of redirected lysis) assays (21;52). NKR-P1C ligation is thought to result in phosphorylation of the tyrosines in the ITAM of FcRγ, leading to recruitment tyrosine kinases that mediate downstream signal transduction (53;54). In particular, the Syk tyrosine kinase is activated downstream of the FcγRIII in NK cells activated by sensitive target cells, and dominant-negative kinase-inactive forms of Syk inhibit FcR-initiated killing (55-57). Lck tyrosine kinase has been shown to associate directly with NKR-P1C through a CxCP motif in the NKR-P1C cytoplasmic domain, and to be required for calcium mobilization and killing downstream of NKP-P1C engagement (27;28). Interestingly, NKR-P1B, an inhibitory NK receptor found in the SJL/J and SWR mouse strains which signals through a cytoplasmic ITIM to SHP1 (1;3;19;58), also binds in the same manner as NKR-P1C to Lck (28). The association of NKR-P1B with SHP1 requires an intact Lck binding site. It has been proposed that Lck phosphorylation of the ITIM in NKR-P1B creates a docking site for the SH2 domain of SHP1, leading to dephosphorylation and inhibition of proximal kinases. In contrast, Lck association with NKR-P1C may lead to phosphorylation of tyrosines in the ITAM of the FcRγ protein, resulting in recruitment of Syk kinase and further NK activating signaling. However, it has been shown in conflicting reports that NK cells from Lck-deficient mice possess either normal or impaired killing activity in redirected lysis or ADCC assays (28;59). The reason for the discrepancy is unknown.

 

Initial studies suggested that NKR-P1 receptors bind to lectin ligands, but further studies proved this not to be the case. So far, only ligands for the inhibitory NKR-P1B or D receptors, and the activating NKR-P1F receptor have been identified. These ligands, members of the osteoclast inhibitory lectin (Ocil) or C-type lectin-related (Clr) family, also have a C-type lectin-like structure, and their genes are interspersed among the genes encoding NKR-P1 receptors within the NKC (60;61). Ocil/Clr-b is considered a “self” ligand and is recognized by NKR-P1B/D, and Ocilrp2/Clr-g is recognized by NKR-P1F (6;7). Ocil/Clr-b is reportedly broadly expressed on hematopoietic cell types, but is lost from some tumor cell lines which are sensitive to NK cell killing (6;7). Thus, Ocil/Clr-b may function in an MHC-independent “missing self” NK recognition system. The interaction between Ocilrp2/Clr-g and NKR-P1F has not been fully characterized, but has been reported to costimulate T cell proliferation in response to antigenic stimulation (62;63).

 

Allelic polymorphisms, resulting from the presence or absence of a gene, point mutations that alter receptor specificity or signaling, deletions, or insertions, exist for many of the genes within the NKC. Several such polymorphisms result in dramatic differences in NK cell recognition and function. For example, resistance to mouse cytomegalovirus (MCMV) is conferred to C57BL/6 mice by the presence of the Ly49h gene, which is lacking in the susceptible BALB/c strain (64;65). NKR-P1C also shows polymorphism between the C57BL/6 and BALB/c strains, as revealed by positivity for the α-NK1.1 epitope in the C57BL/6, but not BALB/c strain. The presence of a serine instead of a threonine at residue 191 in C57BL/6 mice largely accounts for this difference (see Protein Prediction), but the functional consequences are unknown (20). It has been postulated that the Nkrp1b/c region may have undergone recent directed evolution under pressure from rat cytomegalovirus (RCMV) immune evasion of the NKR-P1B-Ocil/Clr-b interaction (66;67).

Putative Mechanism

Lack of expression of NK1.1 in mice, suggests that the Unnatural mutation results in lack of NKR-P1C protein. However, the loss of the NK1.1 epitope does not necessarily mean that NKR-P1C is not present. As described above, binding of the NK1.1 antibody depends on residue 191 and also on the conformation of the CTLD in NKR-P1 receptors. Due to their small size, glycines are often present at positions that require tight folding and packing of the protein, and the substitution of a glycine for an aspartic residue at amino acid 100 may allow the NKR-P1C CTLD domain to fold differently and disrupt NK1.1 binding to NKR-P1C without altering expression levels or localization of the protein. The S191 amino acid that appears to be so important in conferring NK1.1 recognition is located in β3 of the CTLD. Loop 3, which in other NK receptors confers ligand-binding specificity (12;17), connects β2’ to β3. Thus, altering the conformation of the CTLD so it does not recognize the NK1.1 epitope may also change the ligand-binding properties of the NKR-P1C receptor. 

 

Although altering residue 100 may disrupt binding to the NK1.1 epitope, this residue is located some distance away from loop 3 and β3 (Figure 4) and is one of the flanking, charged residues of the conserved β0 motif important in forming the receptor dimer interface (10). In CD69, these residues form salt bridges across the dimer interface that probably aid in dimer stabilization (15). It is likely that altering the D100 residue in NKR-P1C will disrupt the formation of the homodimeric receptor at the cell surface.

Primers

Primers cannot be located by automatic search.

Genotyping

Unnatural genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.  This protocol has not been tested.

 

Primers

Unnatural (F): 5’- TACCAGGGATTACGGTCAGCCAAG -3’

Unnatural (R): 5’-GATAACAAGCTTCCATCGGGAGGTC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C              ∞

 

Primers for sequencing

Unnatural_seq(F): 5’- TGAGATCGCAATCACTTGGC -3’

 

The following sequence of 1465 nucleotides (from Genbank genomic region NC_000072 for linear genomic sequence of Klrb1c) is amplified:

 

3897                                                              tacc

3901 agggattacg gtcagccaag gcttacaaca accatctctg aagatgctat atcaccatat

3961 cttatgttag aggaaattgc tgcatagaaa cttgttgagg gtctcatggt tggtagttaa

4021 taaggctggt aacttctttg aaactatgtg acctggaagc ctgagatcgc aatcacttgg

4081 ccatactgcc tagggatgct agtacacttg atcattaact taagaaaacg ctgtgtcagt

4141 taactttgtc tacagtagaa aaaagtattc cttgttattt atatttcttt gatgtgtcat

4201 aacagtaatc ttgctcctgc acatgttaat aaaagtgtgg gttagtaaaa actactgtgt

4261 gtaaccagct gtggtgaagc aagaacaggg tagaatacac catgtcttcc tctcacttca

4321 gattgttcag ttaatttaga gtgcccacaa gactggcttt tacaccgaga taagtgcttt

4381 cacgtttctc aagtttccaa cacttgggag gaaggtcaag ctgactgtgg tagaaaagga

4441 gccactttgc tgctcattca agaccaagaa gaactggtaa gctgttcaat aaaacagaac

4501 acattagtat gttctttaag ctacaccaac atctctagac ttaacagatc ttccacacaa

4561 aggaaatgga gactttacat tatagaagct catagtgtga aagactaatt ggacatgtga

4621 gccaataact gcatgtaagg agagtgtcct ttagaacatt aatagaggtc acagatttca

4681 caaaggagga agaattaact gttggggatt caggatgggt acaggtttca gtaggctggt

4741 agaatgtgag tcactaatac acagactcag ggttaagtcc tctgctctgt ttggattgca

4801 gagattccta ctggactcaa taaaggaaaa atataattca ttttggattg gactaaggtt

4861 cacattgcca gacatgaact ggaagtggat aaatggcaca actttcaatt ctgatgtgtg

4921 agtactagaa gagctagttt gaatattcat ttctgttgca ggggcttttg gggattcccc

4981 ttggggctaa ttgtaaagac atggagaatc tgtgtagtat aagcctgtta gcctttctgc

5041 tggggacagt ccctgagcag ccagctattc cacctgcctc ccctgccccc tgggtcttca

5101 ttgcagggct ctctgctctg cttcctgctg ctcccctttc ttcctctggc tcaggtctcc

5161 agctctgttt catccaaagc cttctccttt ctgattaaaa aaaaaaaaaa aaaaaaaaaa

5221 gttaattagt atagtgggag gggcttctga gctcactcag gaaccaatca gcaagcagaa

5281 ggactacctc ccatttataa tctagtgttg acctttggcc aaattgaggg ctatgagacc

5341 tcccgatgga agcttgttat c

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.

References

   1. Glimcher, L., Shen, F. W., and Cantor, H. (1977) Identification of a Cell-Surface Antigen Selectively Expressed on the Natural Killer Cell. J. Exp. Med. 145, 1-9.

   2. Koo, G. C., Jacobson, J. B., Hammerling, G. J., and Hammerling, U. (1980) Antigenic Profile of Murine Natural Killer Cells. J. Immunol. 125, 1003-1006.

   3. Koo, G. C., and Peppard, J. R. (1984) Establishment of Monoclonal Anti-Nk-1.1 Antibody. Hybridoma. 3, 301-303.

   4. Yokoyama, W. M., Ryan, J. C., Hunter, J. J., Smith, H. R., Stark, M., and Seaman, W. E. (1991) CDNA Cloning of Mouse NKR-P1 and Genetic Linkage with LY-49. Identification of a Natural Killer Cell Gene Complex on Mouse Chromosome 6. J. Immunol. 147, 3229-3236.

   5. Mesci, A., Ljutic, B., Makrigiannis, A. P., and Carlyle, J. R. (2006) NKR-P1 Biology: From Prototype to Missing Self. Immunol. Res. 35, 13-26.

   6. Carlyle, J. R., Jamieson, A. M., Gasser, S., Clingan, C. S., Arase, H., and Raulet, D. H. (2004) Missing Self-Recognition of Ocil/Clr-b by Inhibitory NKR-P1 Natural Killer Cell Receptors. Proc. Natl. Acad. Sci. U. S. A. 101, 3527-3532.

   7. Iizuka, K., Naidenko, O. V., Plougastel, B. F., Fremont, D. H., and Yokoyama, W. M. (2003) Genetically Linked C-Type Lectin-Related Ligands for the NKRP1 Family of Natural Killer Cell Receptors. Nat. Immunol. 4, 801-807.

   8. Ryan, J. C., and Seaman, W. E. (1997) Divergent Functions of Lectin-Like Receptors on NK Cells. Immunol. Rev. 155, 79-89.

   9. Rosen, D. B., Bettadapura, J., Alsharifi, M., Mathew, P. A., Warren, H. S., and Lanier, L. L. (2005) Cutting Edge: Lectin-Like Transcript-1 is a Ligand for the Inhibitory Human NKR-P1A Receptor. J. Immunol. 175, 7796-7799.

 10. Sawicki, M. W., Dimasi, N., Natarajan, K., Wang, J., Margulies, D. H., and Mariuzza, R. A. (2001) Structural Basis of MHC Class I Recognition by Natural Killer Cell Receptors. Immunol. Rev. 181, 52-65.

 11. Drickamer, K. (1999) C-Type Lectin-Like Domains. Curr. Opin. Struct. Biol. 9, 585-590.

 12. Tormo, J., Natarajan, K., Margulies, D. H., and Mariuzza, R. A. (1999) Crystal Structure of a Lectin-Like Natural Killer Cell Receptor Bound to its MHC Class I Ligand. Nature. 402, 623-631.

 13. Boyington, J. C., Riaz, A. N., Patamawenu, A., Coligan, J. E., Brooks, A. G., and Sun, P. D. (1999) Structure of CD94 Reveals a Novel C-Type Lectin Fold: Implications for the NK Cell-Associated CD94/NKG2 Receptors. Immunity. 10, 75-82.

 14. Boyington, J. C., Motyka, S. A., Schuck, P., Brooks, A. G., and Sun, P. D. (2000) Crystal Structure of an NK Cell Immunoglobulin-Like Receptor in Complex with its Class I MHC Ligand. Nature. 405, 537-543.

 15. Natarajan, K., Sawicki, M. W., Margulies, D. H., and Mariuzza, R. A. (2000) Crystal Structure of Human CD69: A C-Type Lectin-Like Activation Marker of Hematopoietic Cells. Biochemistry. 39, 14779-14786.

 16. Wolan, D. W., Teyton, L., Rudolph, M. G., Villmow, B., Bauer, S., Busch, D. H., and Wilson, I. A. (2001) Crystal Structure of the Murine NK Cell-Activating Receptor NKG2D at 1.95 A. Nat. Immunol. 2, 248-254.

 17. Deng, L., Cho, S., Malchiodi, E. L., Kerzic, M. C., Dam, J., and Mariuzza, R. A. (2008) Molecular Architecture of the Major Histocompatibility Complex Class I-Binding Site of Ly49 Natural Killer Cell Receptors. J. Biol. Chem. 283, 16840-16849.

 18. Giorda, R., Rudert, W. A., Vavassori, C., Chambers, W. H., Hiserodt, J. C., and Trucco, M. (1990) NKR-P1, a Signal Transduction Molecule on Natural Killer Cells. Science. 249, 1298-1300.

 19. Carlyle, J. R., Martin, A., Mehra, A., Attisano, L., Tsui, F. W., and Zuniga-Pflucker, J. C. (1999) Mouse NKR-P1B, a Novel NK1.1 Antigen with Inhibitory Function. J. Immunol. 162, 5917-5923.

 20. Carlyle, J. R., Mesci, A., Ljutic, B., Belanger, S., Tai, L. H., Rousselle, E., Troke, A. D., Proteau, M. F., and Makrigiannis, A. P. (2006) Molecular and Genetic Basis for Strain-Dependent NK1.1 Alloreactivity of Mouse NK Cells. J. Immunol. 176, 7511-7524.

 21. Arase, N., Arase, H., Park, S. Y., Ohno, H., Ra, C., and Saito, T. (1997) Association with FcRgamma is Essential for Activation Signal through NKR-P1 (CD161) in Natural Killer (NK) Cells and NK1.1+ T Cells. J. Exp. Med. 186, 1957-1963.

 22. Ra, C., Jouvin, M. H., Blank, U., and Kinet, J. P. (1989) A Macrophage Fc Gamma Receptor and the Mast Cell Receptor for IgE Share an Identical Subunit. Nature. 341, 752-754.

 23. Perez-Montfort, R., Kinet, J. P., and Metzger, H. (1983) A Previously Unrecognized Subunit of the Receptor for Immunoglobulin E. Biochemistry. 22, 5722-5728.

 24. Scholl, P. R., and Geha, R. S. (1993) Physical Association between the High-Affinity IgG Receptor (Fc Gamma RI) and the Gamma Subunit of the High-Affinity IgE Receptor (Fc Epsilon RI Gamma). Proc. Natl. Acad. Sci. U. S. A. 90, 8847-8850.

 25. Kurosaki, T., and Ravetch, J. V. (1989) A Single Amino Acid in the Glycosyl Phosphatidylinositol Attachment Domain Determines the Membrane Topology of Fc Gamma RIII. Nature. 342, 805-807.

 26. Raghavan, M., and Bjorkman, P. J. (1996) Fc Receptors and their Interactions with Immunoglobulins. Annu. Rev. Cell Dev. Biol. 12, 181-220.

 27. Campbell, K. S., and Giorda, R. (1997) Thy Cytoplamic Domain of Rat NKR-P1 Receptor Interacts with the N-Terminal Domain of p56(Lck) Via Cysteine Residues. Eur. J. Immunol. 27, 802.

 28. Ljutic, B., Carlyle, J. R., Filipp, D., Nakagawa, R., Julius, M., and Zuniga-Pflucker, J. C. (2005) Functional Requirements for Signaling through the Stimulatory and Inhibitory Mouse NKR-P1 (CD161) NK Cell Receptors. J. Immunol. 174, 4789-4796.

 29. Bendelac, A. (1995) Positive Selection of Mouse NK1+ T Cells by CD1-Expressing Cortical Thymocytes. J. Exp. Med. 182, 2091-2096.

 30. Koo, G. C., Peppard, J. R., and Hatzfeld, A. (1982) Ontogeny of Nk-1+ Natural Killer Cells. I. Promotion of Nk-1+ Cells in Fetal, Baby, and Old Mice. J. Immunol. 129, 867-871.

 31. Carlyle, J. R., Michie, A. M., Furlonger, C., Nakano, T., Lenardo, M. J., Paige, C. J., and Zuniga-Pflucker, J. C. (1997) Identification of a Novel Developmental Stage Marking Lineage Commitment of Progenitor Thymocytes. J. Exp. Med. 186, 173-182.

 32. Ljutic, B., Carlyle, J. R., and Zuniga-Pflucker, J. C. (2003) Identification of Upstream Cis-Acting Regulatory Elements Controlling Lineage-Specific Expression of the Mouse NK Cell Activation Receptor, NKR-P1C. J. Biol. Chem. 278, 31909-31917.

 33. Anderson, S. K. (2006) Transcriptional Regulation of NK Cell Receptors. Curr. Top. Microbiol. Immunol. 298, 59-75.

 34. Smyth, M. J., Cretney, E., Kelly, J. M., Westwood, J. A., Street, S. E., Yagita, H., Takeda, K., van Dommelen, S. L., Degli-Esposti, M. A., and Hayakawa, Y. (2005) Activation of NK Cell Cytotoxicity. Mol. Immunol. 42, 501-510.

 35. Takeda, K., Cretney, E., Hayakawa, Y., Ota, T., Akiba, H., Ogasawara, K., Yagita, H., Kinoshita, K., Okumura, K., and Smyth, M. J. (2005) TRAIL Identifies Immature Natural Killer Cells in Newborn Mice and Adult Mouse Liver. Blood. 105, 2082-2089.

 36. Screpanti, V., Wallin, R. P., Grandien, A., and Ljunggren, H. G. (2005) Impact of FASL-Induced Apoptosis in the Elimination of Tumor Cells by NK Cells. Mol. Immunol. 42, 495-499.

 37. Biron, C. A., Nguyen, K. B., Pien, G. C., Cousens, L. P., and Salazar-Mather, T. P. (1999) Natural Killer Cells in Antiviral Defense: Function and Regulation by Innate Cytokines. Annu. Rev. Immunol. 17, 189-220.

 38. Stetson, D. B., Mohrs, M., Reinhardt, R. L., Baron, J. L., Wang, Z. E., Gapin, L., Kronenberg, M., and Locksley, R. M. (2003) Constitutive Cytokine mRNAs Mark Natural Killer (NK) and NK T Cells Poised for Rapid Effector Function. J. Exp. Med. 198, 1069-1076.

 39. Robertson, M. J. (2002) Role of Chemokines in the Biology of Natural Killer Cells. J. Leukoc. Biol. 71, 173-183.

 40. Lanier, L. L. (2005) NK Cell Recognition. Annu. Rev. Immunol. 23, 225-274.

 41. Shinkai, Y., Rathbun, G., Lam, K. P., Oltz, E. M., Stewart, V., Mendelsohn, M., Charron, J., Datta, M., Young, F., Stall, A. M., and . (1992) RAG-2-Deficient Mice Lack Mature Lymphocytes Owing to Inability to Initiate V(D)J Rearrangement. Cell. 68, 855-867.

 42.Lanier, L. L., Phillips, J. H., Hackett, J.,Jr, Tutt, M., and Kumar, V. (1986) Natural Killer Cells: Definition of a Cell Type rather than a Function. J. Immunol. 137, 2735-2739.

 43. Ljunggren, H. G., and Karre, K. (1990) In Search of the 'Missing Self': MHC Molecules and NK Cell Recognition. Immunol. Today. 11, 237-244.

 44. Karre, K., Ljunggren, H. G., Piontek, G., and Kiessling, R. (1986) Selective Rejection of H-2-Deficient Lymphoma Variants Suggests Alternative Immune Defence Strategy. Nature. 319, 675-678.

 45. Lanier, L. L., Corliss, B., and Phillips, J. H. (1997) Arousal and Inhibition of Human NK Cells. Immunol. Rev. 155, 145-154.

 46. Cerwenka, A., Baron, J. L., and Lanier, L. L. (2001) Ectopic Expression of Retinoic Acid Early Inducible-1 Gene (RAE-1) Permits Natural Killer Cell-Mediated Rejection of a MHC Class I-Bearing Tumor in Vivo. Proc. Natl. Acad. Sci. U. S. A. 98, 11521-11526.

 47. Karlhofer, F. M., and Yokoyama, W. M. (1991) Stimulation of Murine Natural Killer (NK) Cells by a Monoclonal Antibody Specific for the NK1.1 Antigen. IL-2-Activated NK Cells Possess Additional Specific Stimulation Pathways. J. Immunol. 146, 3662-3673.

 48. Chambers, W. H., Vujanovic, N. L., DeLeo, A. B., Olszowy, M. W., Herberman, R. B., and Hiserodt, J. C. (1989) Monoclonal Antibody to a Triggering Structure Expressed on Rat Natural Killer Cells and Adherent Lymphokine-Activated Killer Cells. J. Exp. Med. 169, 1373-1389.

 49. Ryan, J. C., Niemi, E. C., Goldfien, R. D., Hiserodt, J. C., and Seaman, W. E. (1991) NKR-P1, an Activating Molecule on Rat Natural Killer Cells, Stimulates Phosphoinositide Turnover and a Rise in Intracellular Calcium. J. Immunol. 147, 3244-3250.

 50. Arase, H., Arase, N., and Saito, T. (1996) Interferon Gamma Production by Natural Killer (NK) Cells and NK1.1+ T Cells upon NKR-P1 Cross-Linking. J. Exp. Med. 183, 2391-2396.

 51. Trinchieri, G., and Valiante, N. (1993) Receptors for the Fc Fragment of IgG on Natural Killer Cells. Nat. Immun. 12, 218-234.

 52. Takai, T., Li, M., Sylvestre, D., Clynes, R., and Ravetch, J. V. (1994) FcR Gamma Chain Deletion Results in Pleiotrophic Effector Cell Defects. Cell. 76, 519-529.

 53. O'Shea, J. J., McVicar, D. W., Kuhns, D. B., and Ortaldo, J. R. (1992) A Role for Protein Tyrosine Kinase Activity in Natural Cytotoxicity as Well as Antibody-Dependent Cellular Cytotoxicity. Effects of Herbimycin A. J. Immunol. 148, 2497-2502.

 54. Einspahr, K. J., Abraham, R. T., Binstadt, B. A., Uehara, Y., and Leibson, P. J. (1991) Tyrosine Phosphorylation Provides an Early and Requisite Signal for the Activation of Natural Killer Cell Cytotoxic Function. Proc. Natl. Acad. Sci. U. S. A. 88, 6279-6283.

 55. Stahls, A., Liwszyc, G. E., Couture, C., Mustelin, T., and Andersson, L. C. (1994) Triggering of Human Natural Killer Cells through CD16 Induces Tyrosine Phosphorylation of the p72syk Kinase. Eur. J. Immunol. 24, 2491-2496.

 56. Brumbaugh, K. M., Binstadt, B. A., Billadeau, D. D., Schoon, R. A., Dick, C. J., Ten, R. M., and Leibson, P. J. (1997) Functional Role for Syk Tyrosine Kinase in Natural Killer Cell-Mediated Natural Cytotoxicity. J. Exp. Med. 186, 1965-1974.

 57. Shiue, L., Zoller, M. J., and Brugge, J. S. (1995) Syk is Activated by Phosphotyrosine-Containing Peptides Representing the Tyrosine-Based Activation Motifs of the High Affinity Receptor for IgE. J. Biol. Chem. 270, 10498-10502.

 58. Kung, S. K., Su, R. C., Shannon, J., and Miller, R. G. (1999) The NKR-P1B Gene Product is an Inhibitory Receptor on SJL/J NK Cells. J. Immunol. 162, 5876-5887.

 59. Wen, T., Zhang, L., Kung, S. K., Molina, T. J., Miller, R. G., and Mak, T. W. (1995) Allo-Skin Graft Rejection, Tumor Rejection and Natural Killer Activity in Mice Lacking p56lck. Eur. J. Immunol. 25, 3155-3159.

 60. Zhou, H., Kartsogiannis, V., Hu, Y. S., Elliott, J., Quinn, J. M., McKinstry, W. J., Gillespie, M. T., and Ng, K. W. (2001) A Novel Osteoblast-Derived C-Type Lectin that Inhibits Osteoclast Formation. J. Biol. Chem. 276, 14916-14923.

 61. Plougastel, B., Dubbelde, C., and Yokoyama, W. M. (2001) Cloning of Clr, a New Family of Lectin-Like Genes Localized between Mouse Nkrp1a and Cd69. Immunogenetics. 53, 209-214.

 62. Tian, W., Feng, B., and Liou, H. C. (2005) Silencing OCILRP2 Leads to Intrinsic Defects in T Cells in Response to Antigenic Stimulation. Cell. Immunol. 235, 72-84.

 63. Tian, W., Nunez, R., Cheng, S., Ding, Y., Tumang, J., Lyddane, C., Roman, C., and Liou, H. C. (2005) C-Type Lectin OCILRP2/Clr-g and its Ligand NKRP1f Costimulate T Cell Proliferation and IL-2 Production. Cell. Immunol. 234, 39-53.

 64. Scalzo, A. A., Fitzgerald, N. A., Simmons, A., La Vista, A. B., and Shellam, G. R. (1990) Cmv-1, a Genetic Locus that Controls Murine Cytomegalovirus Replication in the Spleen. J. Exp. Med. 171, 1469-1483.

 65. Brown, M. G., Dokun, A. O., Heusel, J. W., Smith, H. R., Beckman, D. L., Blattenberger, E. A., Dubbelde, C. E., Stone, L. R., Scalzo, A. A., and Yokoyama, W. M. (2001) Vital Involvement of a Natural Killer Cell Activation Receptor in Resistance to Viral Infection. Science. 292, 934-937.

 66. Voigt, S., Sandford, G. R., Ding, L., and Burns, W. H. (2001) Identification and Characterization of a Spliced C-Type Lectin-Like Gene Encoded by Rat Cytomegalovirus. J. Virol. 75, 603-611.

 67. Voigt, S., Mesci, A., Ettinger, J., Fine, J. H., Chen, P., Chou, W., and Carlyle, J. R. (2007) Cytomegalovirus Evasion of Innate Immunity by Subversion of the NKR-P1B:Clr-b Missing-Self Axis. Immunity. 26, 617-627.