Phenotypic Mutation 'gott'

• Allele: gott
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 5,779,512 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Polm
• Gene Name: polymerase (DNA directed), mu
• Synonym(s): Tdt-N, B230309I03Rik
• Chromosomal Location: 5,777,860-5,788,016 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice homozygous for disruptions in this gene display an apparently normal phenotype. However, B cell maturation and proliferation is abnormal. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Phenylalanine changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020767] [ENSMUSP00000105463]
• AlphaFold: Q9JIW4
• PDB Structure: Polymerase mu in ternary complex with gapped 11mer DNA duplex and bound incoming nucleotide [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000020767; Gene: ENSMUSG00000020474; AA Change: F429L

Domain	Start	End	E-Value	Type
low complexity region	12	26	N/A	INTRINSIC
PDB:2HTF|A	27	124	2e-42	PDB
POLXc	150	495	1.78e-115	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
  (Using ENSMUST00000020767)
• SMART Domains: Protein: ENSMUSP00000105463; Gene: ENSMUSG00000020474; AA Change: F429L

Domain	Start	End	E-Value	Type
low complexity region	12	26	N/A	INTRINSIC
Blast:BRCT	27	112	1e-45	BLAST
PDB:2HTF|A	27	124	4e-42	PDB
POLXc	150	500	8.68e-78	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
  (Using ENSMUST00000109837)
• Meta Mutation Damage Score: 0.1965
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:29 PM by Anne Murray
• Record Created: 2019-01-26 1:50 PM by Bruce Beutler
• Record Posted: 2019-03-13
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_017401; MGI:1860191

Alleles Listed at MGI

All Mutations and Alleles(5) : Targeted(5)

Phenotypic Description

Figure 1. Gott mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gott phenotype was identified among G3 mice of the pedigree R3812, some of which showed reduced frequencies of B cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced B cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 27 mutations (X-axis) identified in the G1 male of pedigree R3812. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 27 mutations. The B cell phenotype was linked by continuous variable mapping to a mutation in Polm:  a T to C transition at base pair 5,829,512 (v38) on chromosome 11, or base pair 8,831 in the GenBank genomic region NC_000077. Linkage was found with a recessive model of inheritance, wherein seven variant homozygotes departed phenotypically from eight homozygous reference mice and 12 heterozygous mice with a P value of 0.001094 (Figure 2). 

The mutation corresponds to residue 1,550 in the mRNA sequence NM_017401 within exon 9 of 11 total exons.

1535 ACGCCCAGCAGCCAGTTCCCCTTTGCCCTTCTG 424  -T--P--S--S--Q--F--P--F--A--L--L-

The mutated nucleotide is indicated in red. The mutation results in a phenylalanine to leucine substitution at position 429 (F429L) in the Polm protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.458).

Protein Prediction

Figure 3. Domain organization of Polμ. The gott mutation results in a phenylalanine to leucine substitution at position 429. This image is interactive. Other mutations found in Polm are noted in red. Click on each allele for more information. Abbreviations: NLS, nuclear localization sequence; BRCT, BRCA-1 C-terminal; NTE, N-terminal extension; HHH, helix-hairpin-helix motif

Figure 4. Crystal structure of the murine Polμ polymerase domain. UCSF Chimera model is based on PDB 2IHM. Moon et al., Nat Structure Mol Biol. Jan;14(1):45-53 (2007). Click on the 3D structure to view it rotate. See the text for more details.

Polm encodes Polμ, a member of the polX family of DNA polymerases that also includes terminal deoxyribonucleotidyl transferase (TdT) and polb. Polμ has a nuclear localization sequence, a BRCA-1 C-terminal (BRCT) domain, and a conserved polβ core (amino acids 141 to 494) containing an 8-kDa N-terminal extension, two helix-hairpin-helix (HHH) DNA-binding motifs, and a polX domain (Figure 3) (1;2).

The BRCT domain is proposed to mediate protein-protein interactions with proteins involved in DNA repair and cell cycle checkpoint regulation after DNA damage (3). The BRCT domain can also bind DNA, promoting Polμ DNA polymerization activity (4;5). The N-terminal extension is required for DNA end-bridging; the extension allows the polX family members to bind gapped and non-homologous end-joining substrates (6). A loop (designated loop1) within the polymerase domain allows switching between creative and DNA-instructed synthesis (7). During template-independent polymerization, the Polμ loop1 acts as a pseudotemplate, while in template-dependent polymerization loop1 allows binding of the template strand.

The crystal structure of the 360-amino acid polymerase domain of mouse Polμ in complex with a gapped template-primer and a correctly paired nucleoside triphosphate has been solved [Figure 4; PDB:2IHM; (8)]. The crystal of the complex contained two Polμ molecules that each bound substrate. The Polμ folds into a structure similar to other polX family members. Polμ contains fingers (amino acid 228 to 288), a palm (amino acid 289-424), and a thumb (amino acids 425 to 496) along with the 8-kDa N-terminal extension (amino acids 149 to 227). In the ternary complex, Polμ is in a closed confirmation. The template strand in the Polμ. Residues in all subdomains of the Polμ catalytic cord interact with the DNA. There are only two putative hydrogen-bonding interactions from the fingers subdomain to the template strand. There are several nonbonded and hydrogen-bonding interactions from the palm subdomain to the upstream region of the template strand. The template strand lies in a slightly positively charged groove along the protein surface. A helix-hairpin-helix motif mediates interactions with the downstream primer. A second helix-hairpin-helix motif (amino acids 233 to 256) mediates interacts with the phosphate backbone of primer nucleotides P3-P4. Interactions with the fingers subdomain promotes alignment of the primer within the DNA-binding cleft, while interactions between the palm subdomain and the primer terminus correctly position the nucleotide for catalysis. Polμ minor groove interactions are mostly mediated by bridging water molecules. The incoming nucleotide is coordinated with a magnesium ion, which promotes the correct positioning of the nucleotide within the active site. Gly435 facilitates the ability of Polμ to accommodate ribonucleotides. The His329 side chain can hydrogen bond to the phosphate of the primer terminal reside and the γ-phosphate of the incoming dNTP, putatively stabilizing the primer terminus and the incoming nucleotide.

Ser12/Thr21 (within the BRCT domain) and Ser371 (within loop1) are putatively phosphorylated by the Cdk2/cyclin A complex (9). Cdk2/cyclin A-mediated Polμ phosphorylation putatively regulates Polμ function during specific cell cycle phases (i.e., S and G2).

POLM undergoes alternative splicing to generate several variants; however, none of the splice variants encode a functional protein (1). The use of alternative splice junctions at the exon 5/6 and exon 7/8 junctions results in deletions of 16- and 13-base pairs, respectively. One variant has unspliced introns 7 and 8 (118-base pairs). Another has loss of whole exons (e.g., exon 6 or exons 6 through 8), while another showed insertion of new exons (e.g., a 116-base pair insertion in intron 5-6 at the exon 5/6 junction. A variant that has partial splicing of intron 10-11 results in insertion of the last 53-base pairs of the intron; the insertion results in the addition of 18-amino acids, translation of exon 11 in the +1 reading frame, and translation of the 3’ untranslated region up to the first stop codon encountered.

The gott mutation results in a phenylalanine to leucine substitution at position 429 (F429L). Amino acid 429 is within the thumb structure of the polymerase domain.

Expression/Localization

POLM is ubiquitously expressed, with highest levels in lymphoid tissues (e.g., thymus, spleen, pancreas, tonsillar B cells, and peripheral blood lymphocytes) (1;2;10).

Background

Figure 5. Schematic overview of HR and NHEJ DNA DSB repair. Column A shows key steps in HR of DSBs: ( 1 ) PARP senses DSBs, competes with Ku binding to DNA to promote HR, and mediates the recruitment of the MRE11-RAD50-NBS1 (MRN) complex. MRN-dependent activation of protein kinases results in the recruitment of processing factors that generate 3’ ssDNA overhangs (not shown). ( 2 ) The formation of 3’-ssDNA ends leads to the accumulation of the RPA complex, which stabilizes the ssDNA regions, protects the DNA against degradation, and prevents the formation of secondary structures. ( 3 ) The RPA is displaced from the 3’-ssDNA ends; BRCA2-mediated assembly of RAD51 filaments leads to strand invasion into the homologous DNA sequence. ( 4 ) Mediators such as RAD51C and XRCC3 allow for the formation of RAD51 filaments, while strand invasion is stabilized by RAD54. RAD51 and RAD54 catalyze the formation of a displacement loop (D-loop), in which the invading strand primes DNA synthesis. D-loop formation is a branch point to different HR subpathways including break-induced replication (not shown), double Holliday junction formation (not shown), and synthesis-dependent strand annealing (SDSA); all of the subpathways result in the repair of DSB breaks. (5) Fill-in synthesis at the site of the DSB. (6) The results of SDSA is shown. Column B demonstrates selected steps in nonhomologous end joining (NEHJ) repair (see the text for details): ( 1 ) Ku associates to DSBs to promote NHEJ and ( 2 ) the recruitment of DNA-PKcs to ( 3 ) form the catalytically active DNA-PK complex that protects the DNA ends needed for ligation. ( 4 ) Autophosphorylation of DNA-PKcs allows for ARTEMIS and DNA pol x family members to access the DNA termini. ARTEMIS and DNA-PKcs form a complex that cleaves 5’ and 3’ overhangs during NHEJ. Polμ fill in the gaps with several nucleotides, if necessary, prior to relegation. Nucleases can remove base nucleotides, if necessary (not shown). (5) XRCC4/LIG4 is recruited to the site and the broken ends are religated with the help of XLF. (6) Repair resolution of the DSB following NHEJ. Abbreviations: HR, homologous recombination; NHEJ, nonhomologous end joining; DSB, double strand break; PARP; poly(ADP)ribose polymerase; MRN, MRE11-RAD50-NBS1; MRE11, meiotic recombination 11, NBS1, Nibrin or Nijmega breakage syndrome protein 1; ssDNA, single-stranded DNA; BRCA1, breast cancer 1, early onset; RPA, replication protein A; XRCC3, X-ray repair complementing defective repair in Chinese hamster cells 3; SDSA, synthesis-dependent strand annealing; XRCC4, X-ray repair cross-complementing 4; LIG4, DNA ligase IV; XLF, XRCC4-like factor. Figure modified from images found in Ciccia and Elledge. Mol Cell . ( 2010 ) 40:179-204, Heyer et al. Annu. Rev. Genet. (2010) 44:113-139 , and Neal and Meek. Mutat. Res. ( 2011 ) 711:73-86.

V(D)J recombination affects the variable domain of immunoglobulin and T cell receptor (TCR) genes during lymphoid cell development (Figure 5). V(D)J recombination generates a variable region exon to which is subsequently joined a constant region gene, together encoding either an immunoglobulin or T cell receptor chain.  In V(D)J recombination, a trans-esterification reaction mediated by RAG1 (see the record for maladaptive)/RAG2 (see the record for snowcock) produces an excised DNA fragment with blunt signal ends and two covalently closed hairpins at each end of the coding regions that must be joined (11;12). Artemis is essential to opening hairpins for V(D)J recombination following phosphorylation by DNA-PK_CS (see the record for clover).  To process the DNA ends and ligate coding regions, the cell uses the non-homologous end-joining (NHEJ) pathway (Figure 5). In NHEJ, a DNA double-strand break (DSB) is recognized by the Ku heterodimer composed of Ku70 and Ku80 (see the record for durio), which encircles the DNA and cups the DNA termini into an accessible binding pocket (13). The Ku heterodimer recruits and activates DNA-PK_CS, forming the Ku/DNA-PK_CS complex known as DNA-PK. Following recruitment of DNA-PK_CS to the Ku-DNA complex, Ku translocates inward ~10 bp from the DNA ends, allowing DNA-PK_CS to bind to the DNA termini (14). Two adjacent DNA-PK_CS molecules interact across the DSB, holding the DNA ends in close proximity within a synaptic complex. Nucleases (e.g.,  FEN1, EXO1, Sep1, and MRE11) and polymerases (e.g., polβ, polε, and polδ) are often required to remove several nucleotides or to fill in gaps of several nucleotides, respectively, to facilitate the proper conformation for ligation (15-19). The colocalization of DNA polymerase X family members (e.g. terminal deoxynucleotidyl transferase (TdT), polμ, polλ, and polβ) with DNA-PK_CS as well as the interactions of DNA pol X with both Ku and the DNA ligase IV-XRCC4 complex suggest that the DNA polymerase X family participates in the filling in of short gaps prior to re-ligation (11;20). To protect the DNA termini of a DSB from degradation or premature and incorrect ligation, DNA-PK_CS is positioned as a “cap” on the DNA ends (21;22). Autophosphorylation of DNA-PK_CS results in release of the cap and accessibility of the termini to enzymes and ligases (e.g., Artemis, DNA polymerase X family members, and the DNA ligase IV-XRCC4 dimer) needed to complete the repair (11;23;24). Artemis and DNA-PK_CS form a complex with endonuclease activity that cleaves 5’ and 3’ overhangs during NHEJ, and opens hairpins generated by the RAG complex during V(D)J recombination [(25); reviewed in (24)]. The DNA ligase IV-XRCC4 dimer rejoins the DNA ends, with XRCC4 both interacting with and catalytically stimulating DNA ligase IV (24).   

Polμ is a DNA polymerase that processes DNA ends during immunoglobulin kappa light chain rearrangements in V(D)J recombination in lymphocytes (10;26;27). In non-lymphocyte cells, Polμ functions in template-dependent DSB repair via NHEJ (27-30). Polμ can fill short gaps in a template-dependent manner (28) and is also able to catalyze template-independent synthesis (2). Polμ is able to incorporate ribonucleotide triphosphates almost as efficiently as deoxyribonucleotides (27). There is a partial substrate overlap by polµ and polλ, but there is a preference for polλ over polµ in repairing the majority of complementary double-strand breaks (31). However, polµ is the only known polymerase that can use noncomplementary substrates (31).

Polm-deficient (Polm^-/-) mice showed abnormal immunoglobulin light chain V-J recombination (10;26), slowed maturation of B cells (from IgM^- to IgM⁺) (10), reduced B cell number in the spleen and Peyer’s patches (10;32), underdeveloped B cell compartments in Peyer’s patches (10), absent separation of T and B cells in Peyer’s patches (10), lymphoid hypoplasia (10), and increased numbers of centroblasts compared to wild-type mice after immunization with a chicken gammaglobulin conjugate (33).

Putative Mechanism

The gott mice showed reduced frequencies of peripheral blood B cells similar to the Polm^-/- mice, indicating loss of Polμ-associated function in the gott mice.

Primers

PCR Primer
gott_pcr_F: AGGATCAAACAGCCCATGG
gott_pcr_R: TCCTGTATCACCAGTACCACCG

Sequencing Primer
gott_seq_F: GCTTCCTTTAGCAGGGTT
gott_seq_R: GTACCACCGCAGCCATTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 11, - strand):

1   tcctgtatca ccagtaccac cgcagccatt tggcagactc agcccacaac ctgcggcagc
61  ggagctccac catggatgct tttgagagga gtttctgcat cttgggtttg ccacaacccc
121 aacaggcagc tttagcgggg gccctgcctc cctgcccaac ttggaaagct gtgagggtag
181 atcttgtggt cacgcccagc agccagttcc cctttgccct tctgggctgg actggctccc
241 aggtaagtca tgtgttcctt tccgggccgg gactgtggtg ggccaaccct gctaaaggaa
301 gctgtccctt ccctctctcc tcagttcttt gagcgggagc tacggcggtt cagccgtcaa
361 gagaaggggc tgtggcttaa cagccatggg ctgtttgatc ct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Aoufouchi, S., Flatter, E., Dahan, A., Faili, A., Bertocci, B., Storck, S., Delbos, F., Cocea, L., Gupta, N., Weill, J. C., and Reynaud, C. A. (2000) Two Novel Human and Mouse DNA Polymerases of the polX Family. Nucleic Acids Res. 28, 3684-3693.

  2. Dominguez, O., Ruiz, J. F., Lain de Lera, T., Garcia-Diaz, M., Gonzalez, M. A., Kirchhoff, T., Martinez-A, C., Bernad, A., and Blanco, L. (2000) DNA Polymerase Mu (Pol Mu), Homologous to TdT, could Act as a DNA Mutator in Eukaryotic Cells. EMBO J. 19, 1731-1742.

  3. Bork, P., Hofmann, K., Bucher, P., Neuwald, A. F., Altschul, S. F., and Koonin, E. V. (1997) A Superfamily of Conserved Domains in DNA Damage-Responsive Cell Cycle Checkpoint Proteins. FASEB J. 11, 68-76.

  4. Matsumoto, T., Go, K., Hyodo, M., Koiwai, K., Maezawa, S., Hayano, T., Suzuki, M., and Koiwai, O. (2012) BRCT Domain of DNA Polymerase Mu has DNA-Binding Activity and Promotes the DNA Polymerization Activity. Genes Cells. 17, 790-806.

  5. Martin, M. J., Juarez, R., and Blanco, L. (2012) DNA-Binding Determinants Promoting NHEJ by Human Polmu. Nucleic Acids Res. 40, 11389-11403.

  6. Martin, M. J., Garcia-Ortiz, M. V., Gomez-Bedoya, A., Esteban, V., Guerra, S., and Blanco, L. (2013) A Specific N-Terminal Extension of the 8 kDa Domain is Required for DNA End-Bridging by Human Polmu and Pollambda. Nucleic Acids Res. 41, 9105-9116.

  7. Juarez, R., Ruiz, J. F., Nick McElhinny, S. A., Ramsden, D., and Blanco, L. (2006) A Specific Loop in Human DNA Polymerase Mu Allows Switching between Creative and DNA-Instructed Synthesis. Nucleic Acids Res. 34, 4572-4582.

  8. Moon, A. F., Garcia-Diaz, M., Bebenek, K., Davis, B. J., Zhong, X., Ramsden, D. A., Kunkel, T. A., and Pedersen, L. C. (2007) Structural Insight into the Substrate Specificity of DNA Polymerase Mu. Nat Struct Mol Biol. 14, 45-53.

  9. Esteban, V., Martin, M. J., and Blanco, L. (2013) The BRCT Domain and the Specific Loop 1 of Human Polmu are Targets of Cdk2/cyclin A Phosphorylation. DNA Repair (Amst). 12, 824-834.

  10. Bertocci, B., De Smet, A., Berek, C., Weill, J. C., and Reynaud, C. A. (2003) Immunoglobulin Kappa Light Chain Gene Rearrangement is Impaired in Mice Deficient for DNA Polymerase Mu. Immunity. 19, 203-211.

  11. Dip, R., and Naegeli, H. (2005) More than just Strand Breaks: The Recognition of Structural DNA Discontinuities by DNA-Dependent Protein Kinase Catalytic Subunit. FASEB J. 19, 704-715.

  12. Collis, S. J., DeWeese, T. L., Jeggo, P. A., and Parker, A. R. (2005) The Life and Death of DNA-PK. Oncogene. 24, 949-961.

  13. Walker, J. R., Corpina, R. A., and Goldberg, J. (2001) Structure of the Ku Heterodimer Bound to DNA and its Implications for Double-Strand Break Repair. Nature. 412, 607-614.

  14. Cahill, D., Connor, B., and Carney, J. P. (2006) Mechanisms of Eukaryotic DNA Double Strand Break Repair. Front Biosci. 11, 1958-1976.

  15. Johnson, A. W., and Kolodner, R. D. (1991) Strand Exchange Protein 1 from Saccharomyces Cerevisiae. A Novel Multifunctional Protein that Contains DNA Strand Exchange and Exonuclease Activities. J Biol Chem. 266, 14046-14054.

  16. Fiorentini, P., Huang, K. N., Tishkoff, D. X., Kolodner, R. D., and Symington, L. S. (1997) Exonuclease I of Saccharomyces Cerevisiae Functions in Mitotic Recombination in Vivo and in Vitro. Mol Cell Biol. 17, 2764-2773.

  17. Lieber, M. R. (1997) The FEN-1 Family of Structure-Specific Nucleases in Eukaryotic DNA Replication, Recombination and Repair. Bioessays. 19, 233-240.

  18. Paull, T. T., and Gellert, M. (1998) The 3' to 5' Exonuclease Activity of Mre 11 Facilitates Repair of DNA Double-Strand Breaks. Mol Cell. 1, 969-979.

  19. Lieber, M. R. (1999) The Biochemistry and Biological Significance of Nonhomologous DNA End Joining: An Essential Repair Process in Multicellular Eukaryotes. Genes Cells. 4, 77-85.

  20. Meek, K., Dang, V., and Lees-Miller, S. P. (2008) DNA-PK: The Means to Justify the Ends? Adv Immunol. 99, 33-58.

  21. Block, W. D., Yu, Y., Merkle, D., Gifford, J. L., Ding, Q., Meek, K., and Lees-Miller, S. P. (2004) Autophosphorylation-Dependent Remodeling of the DNA-Dependent Protein Kinase Catalytic Subunit Regulates Ligation of DNA Ends. Nucleic Acids Res. 32, 4351-4357.

  22. Weterings, E., Verkaik, N. S., Bruggenwirth, H. T., Hoeijmakers, J. H., and van Gent, D. C. (2003) The Role of DNA Dependent Protein Kinase in Synapsis of DNA Ends. Nucleic Acids Res. 31, 7238-7246.

  23. Weterings, E., and Chen, D. J. (2007) DNA-Dependent Protein Kinase in Nonhomologous End Joining: A Lock with Multiple Keys? J Cell Biol. 179, 183-186.

  24. Meek, K., Gupta, S., Ramsden, D. A., and Lees-Miller, S. P. (2004) The DNA-Dependent Protein Kinase: The Director at the End. Immunol Rev. 200, 132-141.

  25. Ma, Y., Pannicke, U., Schwarz, K., and Lieber, M. R. (2002) Hairpin Opening and Overhang Processing by an Artemis/DNA-Dependent Protein Kinase Complex in Nonhomologous End Joining and V(D)J Recombination. Cell. 108, 781-794.

  26. Bertocci, B., De Smet, A., Weill, J. C., and Reynaud, C. A. (2006) Nonoverlapping Functions of DNA Polymerases Mu, Lambda, and Terminal Deoxynucleotidyltransferase during Immunoglobulin V(D)J Recombination in Vivo. Immunity. 25, 31-41.

  27. Nick McElhinny, S. A., and Ramsden, D. A. (2003) Polymerase Mu is a DNA-Directed DNA/RNA Polymerase. Mol Cell Biol. 23, 2309-2315.

  28. Mahajan, K. N., Nick McElhinny, S. A., Mitchell, B. S., and Ramsden, D. A. (2002) Association of DNA Polymerase Mu (Pol Mu) with Ku and Ligase IV: Role for Pol Mu in End-Joining Double-Strand Break Repair. Mol Cell Biol. 22, 5194-5202.

  29. Capp, J. P., Boudsocq, F., Besnard, A. G., Lopez, B. S., Cazaux, C., Hoffmann, J. S., and Canitrot, Y. (2007) Involvement of DNA Polymerase Mu in the Repair of a Specific Subset of DNA Double-Strand Breaks in Mammalian Cells. Nucleic Acids Res. 35, 3551-3560.

  30. Chayot, R., Danckaert, A., Montagne, B., and Ricchetti, M. (2010) Lack of DNA Polymerase Mu Affects the Kinetics of DNA Double-Strand Break Repair and Impacts on Cellular Senescence. DNA Repair (Amst). 9, 1187-1199.

  31. Pryor, J. M., Waters, C. A., Aza, A., Asagoshi, K., Strom, C., Mieczkowski, P. A., Blanco, L., and Ramsden, D. A. (2015) Essential Role for Polymerase Specialization in Cellular Nonhomologous End Joining. Proc Natl Acad Sci U S A. 112, E4537-45.

  32. Bertocci, B., De Smet, A., Flatter, E., Dahan, A., Bories, J. C., Landreau, C., Weill, J. C., and Reynaud, C. A. (2002) Cutting Edge: DNA Polymerases Mu and Lambda are Dispensable for Ig Gene Hypermutation. J Immunol. 168, 3702-3706.

  33. Lucas, D., Lain de Lera, T., Gonzalez, M. A., Ruiz, J. F., Dominguez, O., Casanova, J. C., Martinez-A, C., Blanco, L., and Bernad, A. (2005) Polymerase Mu is Up-Regulated during the T Cell-Dependent Immune Response and its Deficiency Alters Developmental Dynamics of Spleen Centroblasts. Eur J Immunol. 35, 1601-1611.