Phenotypic Mutation 'arachnoid' (pdf version)
Allelearachnoid
Mutation Type
Chromosome16
Coordinate17,285,281 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Pi4ka
Gene Name phosphatidylinositol 4-kinase alpha
Synonym(s) Pik4ca
Chromosomal Location 17,280,351-17,406,314 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001001983; MGI:2448506

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036162] [ENSMUSP00000122550] [ENSMUSP00000156049] [ENSMUSP00000156052]
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect
Predicted Effect probably benign
Meta Mutation Damage Score 0.0568 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD44+ CD4 T cells - increased
FACS CD44+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
MTT Value of PECs - decreased
Candidate Explorer Status CE: potential candidate; human score: 0; ML prob: 0.182
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(28) : Gene trapped(21) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
R6720_Pi4ka_560 UTSW 16 17326052 splice site probably null
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-02-14 3:30 PM by Anne Murray
Record Created 2019-01-30 1:56 PM by Bruce Beutler
Record Posted 2019-02-14
Phenotypic Description

Figure 1. Arachnoid mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Arachnoid mice exhibit increased frequencies of peripheral CD44+ CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Arachnoid mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The arachnoid phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3953, some of which showed increased frequencies of CD44+ T cells (Figure 1), CD44+ CD4+ T cells (Figure 2), and central memory CD4 T cells in CD4 T cells (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the increased CD44+ CD4+ T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R3953. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 16: Pi4ka and Arhgap31. The mutation in Pi4ka was presumed causative as the immune phenotypes observed in the arachnoid mice mimics that of mice expressing other mutant Pi4ka alleles (see MGI). The mutation in Pi4ka is a T to C transition at base pair 17,285,281 (v38) on chromosome 16, or base pair 121,034 in the GenBank genomic region NC_000082 within the splice acceptor site of intron 44 (4-base pairs from exon 45 [out of 55 total exons]). The strongest association was found with a recessive model of inheritance to the CD44+ CD4+ T cell phenotype, wherein one variant homozygote departed phenotypically from six homozygous reference mice and nine heterozygous mice with a P value of 1.226 x 10-5 (Figure 4).  

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to not affect splicing of the mRNA sequence NM_001001983. If the mutation does affect splicing, the most likely aberrant splicing result with cause skipping of the 71-base pair exon 45. The aberrant splicing would cause a frame-shifted protein product beginning after amino acid 1,691 of the protein, which is normally 2,044 amino acids in length, and termination after the inclusion of seven aberrant amino acids.


 
        <--exon 44      <--intron 44 exon 45-->      exon 46-->
5140 ……GCCATCATCAA ……tgtcttattcctcag GCCCTACCCTAAA…… GCTGCTACCTGCCCAGCAACCCTGA……
1688 ……-A--I--I--K                   --P--Y--P--K-…… --L--L--P--A--Q--Q--P--*-
         correct                        deleted               aberrant

 

The acceptor splice site of intron 44, which is destroyed by the arachnoid mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 5. Domain organization of PI4KIIIα. The arachnoid mutation destroys the acceptor splice site of intron 44. This image is interactive. Other mutations found in PI4KIIIα. Click on each allele for more information. Abbreviations: SH3, SRC Homology 3; NLS, Nuclear Localization Signal; LKU, Lipid Kinase Unique; PH, Pleckstrin Homology.

Pi4ka encodes phosphatidylinositol-4-kinase IIIα (PI4KIIIα; alternatively STT4), a member of the PI3/PI4-kinase family. PI4KIIIα has a Src homology domain-3 (SH3 domain, two nuclear localization signals, PI-3-kinase (PIK) accessory domain (alternatively, lipid kinase unique (LKU) domain), a pleckstrin homology (PH) domain, and a PI3K/PI4K catalytic domain (Figure 5). The role of the PIK/LKU domain is unknown, but it is predicted to promote substrate presentation [SMART; (1)]. The PI4KIIIα PH domain binds PI 4-phosphate [PI(4)P] (2) and may contribute to product inhibition (3). The PI4KIIIα catalytic domain shares sequence similarities to other PI3K/PI3K family members.

 

The arachnoid mutation is predicted to not affect splicing of the mRNA sequence NM_001001983 that encodes PI4KIIIα. The mutation putative affects the region surrounding the LKU domain.

 

Please see the record pia for more information about Pi4ka.

Putative Mechanism

PI4KIIIα is one of four enzymes that catalyzes the first step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate [PI(4,5)P₂] by phosphorylating PI at the 4-position of the inositol ring to form PI(4)P (4). In the metabolism of D4 phosphorylated PIs, PI(4)P is subsequently phosphorylated by PI(4)P 5-kinases to form PI(4,5)P₂. PI(4,5)P₂ can subsequently be phosphorylated by PI3Ks to form PI(3,4,5)P3. PI(3,4,5)P3 can then be converted to PI(3,4)P2.

 

PI4KIIIα is required for protein trafficking from the endoplasmic reticulum to the plasma membrane (5). PI4KIIIα also promotes the PI(4)P-mediated recruitment of the guanine nucleotide exchange factor GBF1 (Golgi-specific brefeldin A resistance guanine nucleotide exchange factor 1) to Golgi membranes whereby it activates Arf1 (ADP ribosylation factor-1) (6;7). ARF1 is required for the formation of trafficking vesicles for sorting and trafficking cargo from the Golgi apparatus to several cellular destinations (e.g., lysosome and plasma membrane) (8). PI4KIIIα was identified as a factor in hematopoiesis, namely in in erythroid and myeloid maturation (9). Pi4ka mutant spleens had less lymphocytic, more HSCs, and more common myeloid progenitor (CMP) features when compared with controls.

 

Pi4ka-deficient mice exhibited early embryonic lethality (4). Homozygous mice expressing a kinase defective PI4KIIIα were also lethal, exhibiting mucosal epithelial degeneration in the gastrointestinal tract (10). Mice with Schwann cell-specific deletion of Pi4ka showed myelination defects as well as reduced levels of the lipids phosphatidylserine, phosphatidylethanolamine, and sphingomyelin in the nerves (11).

 

The phenotypes of the arachnoid mice indicate loss of PI4KIIIα-associated function. However, lethality was not observed in homozygous arachnoid mice indicating that some function was retained.

Primers PCR Primer
arachnoid(F):5'- GTTGTATGCTGAAGGGCCTAAG -3'
arachnoid(R):5'- CAACTTAAGCCTGGTAGAGCC -3'

Sequencing Primer
arachnoid_seq(F):5'- GCCTAAGTGTGCAATGTAGC -3'
arachnoid_seq(R):5'- GTTATCAGTGAAGAGGACAATGTC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler