Phenotypic Mutation 'trident'

• Allele: trident
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 118,339,717 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Plcg2
• Gene Name: phospholipase C, gamma 2
• Synonym(s): Plcg-2, PLCgamma2
• Chromosomal Location: 118,225,030-118,361,881 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014] ; PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Methionine changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000079991]
• AlphaFold: Q8CIH5
• PDB Structure: Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION] ; Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
• SMART Domains: Protein: ENSMUSP00000079991; Gene: ENSMUSG00000034330; AA Change: M1043V

Domain	Start	End	E-Value	Type
PH	21	133	1.87e-4	SMART
PLCXc	312	456	2.29e-96	SMART
low complexity region	461	476	N/A	INTRINSIC
PDB:2K2J|A	478	516	6e-17	PDB
SH2	530	623	2.24e-30	SMART
SH2	644	726	1.16e-28	SMART
SH3	772	828	3.12e-18	SMART
PH	789	910	4.31e0	SMART
PLCYc	930	1044	1.18e-66	SMART
C2	1062	1167	1.41e-15	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
  (Using ENSMUST00000081232)
• Meta Mutation Damage Score: 0.3967
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:29 PM by Anne Murray
• Record Created: 2019-01-30 1:57 PM by Bruce Beutler
• Record Posted: 2019-02-27
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_172285; MGI:97616

Alleles Listed at MGI

All Mutations and Alleles(26) : Chemically induced (ENU)(5) Endonuclease-mediated(3) Gene trapped(10) Spontaneous(1) Targeted(7)

Phenotypic Description

Figure 1. Trident mice exhibit reduced frequencies of peripheral naïve CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Trident mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The trident phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R3500, some of which exhibited reduced frequencies of naïve CD8 T cells in CD8 T cells (Figure 1) with concomitant increased frequencies of effector memory CD8 T cells in CD8 T cells (Figure 2) in the peripheral blood.

Nature of Mutation

Figure 3. Linkage mapping of increased effector memory CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R3500. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Plcg2:  an A to G transition at base pair 117,612,978 (v38) on chromosome 8, or base pair 114,704 in the GenBank genomic region NC_000074 encoding Plcg2. The strongest association was found with a recessive model of inheritance to the normalized effector memory CD8 T cell phenotype, wherein one variant homozygote departed phenotypically from eight homozygous reference mice and five heterozygous mice with a P value of 2.051 x 10^-5 (Figure 3).

The mutation corresponds to residue 3,328 in the mRNA sequence NM_172285 within exon 28 of 33 total exons.

3313 CTGCAGCCTGAGAGCATGCGCTCTGAGAAGTAT 1038 -L--Q--P--E--S--M--R--S--E--K--Y-

The mutated nucleotide is indicated in red.  The mutation results in a methionine to valine substitution at position 1,043 (M1043V) in the phospholipase C gamma 2 (PLC-γ2) protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.004).

Protein Prediction

Figure 4. Domain structure of PLC-γ2. PLC isozymes contain a conserved domain structure consisting of the catalytic X and Y domains located between EF-hand motifs and a calcium-binding C2 domain. There is a pleckstrin homology (PH) domain at the N-terminus. PLC-γ2 contains an additional PH domain split by two tandem Src homology 2 (SH2) domains and an SH3 domain. The trident mutation results in a methionine to valine substitution at position 1,043. This image is interactive. Other mutations found in PLC-γ2 are noted in red. Click on each allele for more information.

The Plcg2 gene encodes the 1265 amino acid PLC-γ2 that is a member of the PLC family (Figure 4). PLC enzymes act as effector molecules in the signal transduction process by hydrolyzing phosphatidylinositol 4,5 bisphosphate (PIP₂) to generate two second messengers, diacylglycerol (DAG) and inositol 1,4,5-triphosphate (IP₃). PLC isozymes contain a conserved domain structure consisting of the catalytic X and Y domains located between EF-hand motifs and a calcium-binding C2 domain. Most PLC proteins also contain a pleckstrin homology (PH) domain at their N-terminus. Additional domains are present in some PLC isozymes including the γ subtypes (PLC-γ1 and -γ2), which contain an additional PH domain split by two tandem Src homology 2 (SH2) domains and an SH3 domain (1).

The trident mutation results in a methionine to valine substitution at position 1,043 (M1043V) within the catalytic Y domain.  

Please see the record for queen for more information about Plcg2.

Putative Mechanism

The hydrolysis of PIP₂ by PLC enzymes to produce DAG and IP₃ is a critical step in the signal transduction process of many pathways.  DAG is responsible for activating protein kinase C and possibly the TRP calcium influx channels, while IP₃ modulates calcium responses within the cell by binding to receptors on the intracellular membrane to allow the mobilization of intracellular calcium (2).  Plcg2 ^-/- mice display internal bleeding, osteopetrosis, impaired lymph node organogenesis and defects in the functioning of B cells, platelets, neutrophils, mast cells, dendritic cells (DCs), macrophages and natural killer (NK) cells (3-5).  A nonsense mutation in Plcg2, resulting in a truncation in the N-terminal PH domain, causes aberrant separation of blood and lymphatic vessels (6).  In addition, two ENU-generated Plcg2 point mutations located in the catalytic and split PH domains have been linked to inflammatory and autoimmune responses through PLC-γ2 hyperactivation in cells of both the innate and acquired immune system (7;8). Plcg2 ^-/- mice display decreased mature B cells, a block in pro-B cell differentiation, B-1 B cell deficiency, and an absence of T cell-independent (T-I) antibody production; the T cell-dependent responses are relatively normal (3;4).  These phenotypes can be attributed to a defect in BCR and pre-BCR signaling with a concomitant deficiency in B-1 cells; the persistence of some peripheral B-2 cells allows the development of a T-D response. Calcium mobilization via PLC activation can be activated by Toll-like receptor (TLR) signaling (9;10).  TLR signaling pathway culminates in MAPK and NF-κB activation resulting in the production of proinflammatory cytokines (11).  Macrophages and DCs from PLC-γ2 deficient animals display abnormal calcium mobilization and reduced production of proinflammatory cytokines in response to peptidoglycan (PGN), a Gram-positive bacterial cell wall component recognized by TLR2 (see the record for languid), and lipopoysaccharide (LPS), a Gram-negative bacterial component recognized by TLR4 (see the record for lps3) (5). The phenotypes observed in trident mice are consistent with those found in Plcg2 ^-/- mice as well as in mice with deficiencies in other BCR signaling molecules.

Primers

PCR Primer
trident_pcr_F: TGTTTCCCTGGAGTCAGATGTC
trident_pcr_R: ACAGGAAGGGTTTTCAGCCC

Sequencing Primer
trident_seq_F: CAGATGTCTTTTCTGAACCGC
trident_seq_R: GGGTTTTCAGCCCAGAATGAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 8, + strand):

1   tgtttccctg gagtcagatg tcttttctga accgcttccc cccccccccc ccagtcagtg
61  caggaaggtc acgtggcctg tgcccatgtg cgcccggagc tggtgttccc tggctgcccc
121 cacagcgccc ttcggctctc ttttcagaca aatacatgca gatgaaccac gcgctgtttt
181 cgctcaatgg gcgaacaggc tacgtcctgc agcctgagag catgcgctct gagaagtatg
241 atccgatgcc cctggagtcc cagaggaaga tcctgatgac actcactgtc aaggtagagg
301 gggctccctg gggggcgctc ttgtcctgtt aatccagcac catctcaact gcaacctcat
361 gtggttcacc tggggtcatt ctgggctgaa aacccttcct gt

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Suh, P. G., Park, J. I., Manzoli, L., Cocco, L., Peak, J. C., Katan, M., Fukami, K., Kataoka, T., Yun, S., and Ryu, S. H. (2008) Multiple Roles of Phosphoinositide-Specific Phospholipase C Isozymes. BMB Rep. 41, 415-434.

  2. Wilde, J. I., and Watson, S. P. (2001) Regulation of Phospholipase C Gamma Isoforms in Haematopoietic Cells: Why One, Not the Other? Cell Signal. 13, 691-701.

  3. Wang, D., Feng, J., Wen, R., Marine, J. C., Sangster, M. Y., Parganas, E., Hoffmeyer, A., Jackson, C. W., Cleveland, J. L., Murray, P. J., and Ihle, J. N. (2000) Phospholipase Cgamma2 is Essential in the Functions of B Cell and several Fc Receptors. Immunity. 13, 25-35.

  4. Hashimoto, A., Takeda, K., Inaba, M., Sekimata, M., Kaisho, T., Ikehara, S., Homma, Y., Akira, S., and Kurosaki, T. (2000) Cutting Edge: Essential Role of Phospholipase C-Gamma 2 in B Cell Development and Function. J Immunol. 165, 1738-1742.

  5. Aki, D., Minoda, Y., Yoshida, H., Watanabe, S., Yoshida, R., Takaesu, G., Chinen, T., Inaba, T., Hikida, M., Kurosaki, T., Saeki, K., and Yoshimura, A. (2008) Peptidoglycan and Lipopolysaccharide Activate PLCgamma2, Leading to Enhanced Cytokine Production in Macrophages and Dendritic Cells. Genes Cells. 13, 199-208.

  6. Ichise, H., Ichise, T., Ohtani, O., and Yoshida, N. (2009) Phospholipase Cgamma2 is Necessary for Separation of Blood and Lymphatic Vasculature in Mice. Development. 136, 191-195.

  7. Everett, K. L., Bunney, T. D., Yoon, Y., Rodrigues-Lima, F., Harris, R., Driscoll, P. C., Abe, K., Fuchs, H., de Angelis, M. H., Yu, P., Cho, W., and Katan, M. (2009) Characterization of Phospholipase C Gamma Enzymes with Gain-of-Function Mutations. J Biol Chem. 284, 23083-23093.

  8. Yu, P., Constien, R., Dear, N., Katan, M., Hanke, P., Bunney, T. D., Kunder, S., Quintanilla-Martinez, L., Huffstadt, U., Schroder, A., Jones, N. P., Peters, T., Fuchs, H., de Angelis, M. H., Nehls, M., Grosse, J., Wabnitz, P., Meyer, T. P., Yasuda, K., Schiemann, M., Schneider-Fresenius, C., Jagla, W., Russ, A., Popp, A., Josephs, M., Marquardt, A., Laufs, J., Schmittwolf, C., Wagner, H., Pfeffer, K., and Mudde, G. C. (2005) Autoimmunity and Inflammation due to a Gain-of-Function Mutation in Phospholipase C Gamma 2 that Specifically Increases External Ca2+ Entry. Immunity. 22, 451-465.

  9. Chun, J., and Prince, A. (2006) Activation of Ca2+-Dependent Signaling by TLR2. J Immunol. 177, 1330-1337.

  10. Zhou, X., Yang, W., and Li, J. (2006) Ca2+- and Protein Kinase C-Dependent Signaling Pathway for Nuclear Factor-kappaB Activation, Inducible Nitric-Oxide Synthase Expression, and Tumor Necrosis Factor-Alpha Production in Lipopolysaccharide-Stimulated Rat Peritoneal Macrophages. J Biol Chem. 281, 31337-31347.

  11. Beutler, B., Jiang, Z., Georgel, P., Crozat, K., Croker, B., Rutschmann, S., Du, X., and Hoebe, K. (2006) Genetic Analysis of Host Resistance: Toll-Like Receptor Signaling and Immunity at Large. Annu Rev Immunol. 24, 353-389.