Phenotypic Mutation 'Schlendrian' (pdf version)
AlleleSchlendrian
Mutation Type missense
Chromosome7
Coordinate141,695,682 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Muc2
Gene Name mucin 2
Synonym(s) 2010015E03Rik
Chromosomal Location 141,690,340-141,754,693 bp (+)
MGI Phenotype Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year.
Accession Number

NCBI RefSeq: NM_023566, MGI: 1339364

Mapped Yes 
Amino Acid Change Cysteine changed to Phenylalanine
Institutional SourceBeutler Lab
Ref Sequences
C561F in NCBI: NP_076055.2 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.2e-40 SMART
C8 216 290 3.1e-15 SMART
Pfam:TIL 293 349 1.7e-9 PFAM
VWC 351 411 5.6e-4 SMART
VWD 378 542 7e-44 SMART
C8 579 653 9.7e-37 SMART
SCOP:d1coua_ 654 728 6e-6 SMART
VWC_def 820 865 1e-2 SMART
VWD 848 1006 2.6e-53 SMART
C8 1042 1116 7.8e-35 SMART
low complexity region 1235 1356 N/A INTRINSIC
low complexity region 1359 1453 N/A INTRINSIC
low complexity region 1503 1553 N/A INTRINSIC
VWD 1614 1782 2e-50 SMART
C8 1826 1899 7.2e-19 SMART
VWC 1956 2024 2.2e-4 SMART
VWC 2065 2129 9.2e-14 SMART
CT 2216 2299 1.4e-37 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using NCBI: NP_076055.2)
Phenotypic Category DSS: sensitive, immune system
Penetrance 100% 
Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(2) Chemically induced(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141693356 missense unknown
kenny APN 7 nonsense
Winnie APN 7 141699460 missense probably damaging 1.00
IGL01303:Muc2 APN 7 141752395 missense unknown
IGL01482:Muc2 APN 7 141754060 missense unknown
IGL01875:Muc2 APN 7 141752740 missense probably damaging 0.99
IGL02088:Muc2 APN 7 141751504 missense unknown 0.00
IGL02415:Muc2 APN 7 141751872 nonsense probably null 0.00
IGL02548:Muc2 APN 7 141751857 missense unknown 0.00
IGL02836:Muc2 APN 7 141746713 missense unknown 0.00
IGL03196:Muc2 APN 7 141747630 missense unknown 0.00
Muskatenwein UTSW 7 141753439 missense unknown
nomoco UTSW 7 141753719 missense
R0127:Muc2 UTSW 7 141748954 missense probably benign 0.00
R0179:Muc2 UTSW 7 141748971 missense unknown
R0299:Muc2 UTSW 7 141752729 missense unknown
R0699:Muc2 UTSW 7 141752300 missense unknown
R1307:Muc2 UTSW 7 141754192 splice donor site probably benign
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R3008:Muc2 UTSW 7 141695104 missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141745488 missense not run
R3112:Muc2 UTSW 7 141745488 missense not run
R3424:Muc2 UTSW 7 141693352 missense probably damaging 0.99
R3786:Muc2 UTSW 7 141697347 missense probably benign 0.01
R3854:Muc2 UTSW 7 141754344 missense unknown
R3964:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3965:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3966:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3973:Muc2 UTSW 7 141746804 missense not run
R3974:Muc2 UTSW 7 141746804 missense not run
R3976:Muc2 UTSW 7 141746804 missense not run
R4327:Muc2 UTSW 7 141695334 unclassified probably damaging 0.96
R4694:Muc2 UTSW 7 141752345 missense unknown
R4764:Muc2 UTSW 7 141745608 missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141699691 critical splice donor site probably null
R4798:Muc2 UTSW 7 141754140 missense probably benign 0.01
R4900:Muc2 UTSW 7 141749543 missense unknown
R5383:Muc2 UTSW 7 141753719 missense probably damaging 1.00
R5489:Muc2 UTSW 7 141751432 missense unknown
R5615:Muc2 UTSW 7 141691203 missense probably damaging 1.00
R5856:Muc2 UTSW 7 141745644 missense not run
R5919:Muc2 UTSW 7 141694928 missense probably damaging 0.97
R5953:Muc2 UTSW 7 141701382 missense probably damaging 0.96
R5979:Muc2 UTSW 7 141697250 missense probably null
R5979:Muc2 UTSW 7 141751406 missense not run
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 031706-UCD
Last Updated 09/13/2017 3:34 PM by Diantha La Vine
Record Created unknown
Record Posted 07/01/2009
Phenotypic Description
Figure 1. Increased susceptibility to DSS-induced colitis in Schlendrian mice. Percent initial weight was examined on the indicated days after administration of 1% DSS. Schlendrian mice exhibited increased weight loss relative to wild type mice beginning 5 days after initiation of DSS treatment.
The semidominant Schlendrian phenotype was identified among ENU-mutagenized G3 mice in a screen for mutants with susceptibility to dextran sulfate sodium (DSS)-induced colitis (DSS-induced Colitis Screen).  When challenged with a low dose of DSS in their drinking water (1%), Schlendrian homozygotes exhibit increased weight loss relative to wild type mice five days after initiation of treatment.  Both Schlendrian homozygous and heterozygous mice were treated with 1% DSS, and weight loss was compared to wild type mice (Figure 1). Two of these mice died on day 7 of treatment.  

 

Nature of Mutation

The Schlendrian mutation was mapped to Chromosome 7 by outcrossing to C3H/HeN mice, and crossing the F1 hybrids to the C3H/HeN strain (as a dominant phenotype), and corresponds to a G to T transversion at position 1689 of the Muc2 transcript in exon 13 of 47 total exons (1)

 
 
1673 AAGGCCCAATCAAGCTGCCACGACAAGCTGGAC
556  -K--A--Q--S--S--C--H--D--K--L--D-
 
The mutated nucleotide is indicated in red lettering, and causes a cysteine to phenylalanine change at amino acid 561 of the MUC2 protein.
Protein Prediction
Figure 2.  Domain structure of Mucin2. The Schlendrian mutation (red) causes a cysteine to phenylalanine change in the D2 domain of the MUC2 protein. S=Signal sequence; D=D domains (homology to VWF mediates trimerization); CR=Cystein-rich domain; TR= Tandem repeat domain (heavily O glycosylated); GDPH=GDPH autocatalytic proteolytic site; B=B domain (homology to VWF); C= C domain (homology to VWF); CK= Cysteine-knot domain (homology to VWF mediates dimerization). This image is interactive. Click on the image to view other mutations found in Mucin2 (red). Click on the mutations for more specific information.
The Muc2 gene encodes a secreted member of the mucin family of proteins, which are characterized by their large mass, complex biochemical composition (they are highly glycosylated), an extensive number of variable tandem repeats, and tendency to form higher-order structures through polymerization. Some mucins are integral membrane proteins (2;3)
 
The structural feature that is common to all mucins is the tandem-repeat domain, which contains tandem repeats of identical or highly similar sequences that are rich in serine, threonine and proline residues. The specific sequence and number of tandem repeats is highly variable among different mucins and among orthologous mucins from different species (2;3). These domains are O-glycosylated on the serine and threonine residues by the addition of N-acetylgalactosamine (GalNAc). Each O-glycan is then elongated by adding various hexoses such as galactose, N-acetylglucosamine (GlcNAc), fucose, sialic acid, and N-acetylneuraminic acid (3). The composition of mucin oligosaccharides is highly variable, tissue-dependent, and can confer negative charges or hydrophobicity depending on the moiety used or on post-translational modification such as sulfation (2-4)
 
MUC2 contains two tandem repeat domains that are located in the middle of the protein (Figure 2), and shows extensive polymorphism due to the variable number of tandem repeats that can be present (5-9). For human MUC2, the first tandem repeat domain is invariant and consists of 21 repeats of a 23 amino acid sequence, while the second domain contains between 51-115 repeats of a 16 amino acid sequence (5;10). Thus, the size of the MUC2 protein varies widely between individuals and ethnicities with the most common allelic form containing over 5100 amino acids (6). In mouse, the central repetitive region of MUC2 contains two distinct repetitive regions consisting of 8 and 10 amino acid tandem repeats, respectively (1). The characteristics of the tandem-repeat domains of mucins determine the extent of mucin glycosylation, size, and biochemical characteristics. MUC2, for instance, has a rigid structure and is considered to be insoluble (11).  
 
Unlike the tandem repeat domains, the other domains typically present in mucins tend to be highly conserved (1;7;12). The majority of these motifs in MUC2 are cysteine-rich (Figure 2), and many have high homology with von Willebrand platelet aggregating factor (VWF) (13). These include the five D domains known as D1, D2, D’, D3 and D4, as well as the B, C and cysteine-knot (CK) domains. The D1-D3 domains are located in the N-terminus of the protein, and the D4, B, C and CK domains are located in the C-terminus. The D’ domain is not always considered to be a separate domain, and the B domain is sometimes labeled as C1 (2;3;9). The CK domain is also conserved with a motif found in TGF-β and mediates the dimerization of mucin molecules through disulfide bond formation (14;15). Similarly, the N-terminal D-domains mediate mucin trimerization through disulfide bond formation between cysteines present in the D3 domains (16). The B and C domains of mucins have been shown to associate with trefoil factors (TFF), which play important roles in mucus formation and integrity (17-19). MUC2 also contains two cysteine-rich regions located before and after the first tandem repeat.     
 
In addition to disulfide bonds, MUC2 polymers are held together by other intermolecular bonds, although the nature of these remains unclear (11). Located near the N-terminus of the D4 domain is a GDPH autocatalytic cleavage site with cleavage occurring between the D and P residues.  The reaction is not enzyme-mediated and occurs at the low pH of the late secretory pathway (20). It has been suggested that this cleavage leads to the formation of a unique covalent bond between the carboxy-terminal D residue of one MUC2 subunit and an oligosaccharide side chain present on another subunit. 
 
Collagen and heparin binding sites are also present in the MUC2 sequence. The heparin site is near the C-terminal end and consists of clusters of basic residues. In addition, MUC2 contains multiple potential N-glycosylation sites (6). At the very N-terminus is a signal sequence motif.
 
The Schlendrian mutation alters a conserved cysteine residue located in the second VWFD domain (Figure 2). Expression and localization of the altered protein is being examined. 
Expression/Localization
Using real-time RT-PCR, human MUC2 was found to be highly expressed in adult small intestine and colon. Expression was lower in fetal lung and adult trachea and stomach, with weak expression in skeletal muscle, testis, and prostate. No expression was detected in other tissues examined (21). These results were similar to studies localizing MUC2 mRNA expression primarily to the intestine, with some expression in the airways and the gallbladder (22;23). MUC2 gene expression in the intestine is initiated early during embryonic development (24). MUC2 protein is highly expressed in the intestinal mucus layers, and localizes to the secretory vesicles of intestinal goblet cells (25;26). Very low levels of MUC2 are present in bronchial mucus (27;28). The expression of Muc2 mRNA and protein in rodents and other mammals is similar to humans (7;12;26).
 

Many epithelial-based tumors from multiple tissues express increased levels of MUC2 (29;30).

Background
Mucins are expressed by many epithelial tissues that exist in relatively harsh environments including the stomach, intestinal tract, respiratory tract, cervix and specialized organs such as the liver, pancreas, gall bladder, kidney, mammary gland, salivary gland, lacrimal gland and eye. The layer of mucus produced by these epithelial tissues provides a protective barrier against fluctuations in molecular composition, pH, ionic concentration, pathogens, and toxins. Mucins, with their high molecular weight and complex glycosylation, are major components of epithelial mucus and have a central role in maintaining homeostasis and promoting cell survival under variable conditions. Furthermore, the specific molecular composition and higher-order structures of various mucins contribute to the specialized functions of the different epithelial tissues (2;3). For instance, colonic mucins are reported to be strongly negatively charged due to sialic acid moieties and sulfation and their carbohydrate chains display a characteristic structure, while mucins from colon cancer cell lines display short carbohydrate side chains (31). Mucus gels have been shown to contribute to the immune defense by sequestering multiple cytokines including TNF-α that mediate critical inflammatory responses (2). The immunoglobin (Ig)A antibody is secreted into mucus layers of many epithelial tissues where it provides important antimicrobial activity against pathogens (32). The IgG Fc-binding protein, FcgammaBP, is also localized to the mucus layers of many epithelial tissues, and likely plays a role in immune defense (33). Other bioactive molecules found in mucus layers include trefoil factors (18), epithelial growth factor (EGF), and TGF-α (2).
 
Figure 3. A, Goblet cells are located in the glandular epithelium of the intestinal mucosa and release mucin from its apical surface in response to cholinergic stimulation. MUC2 is the major molecular component of the inner and outer mucosal layers of the intestinal tract. The inner layer is denser and devoid of bacteria, while the outer layer is looser and is colonized by commensal bacteria. B, Before being secreted, MUC2 is assembled in the endoplasmic reticulum (ER) with dimerization and N-glycosylation. MUC2 is then transferred to the Golgi where it is O-glycosylated. Oligomerization occurs late in the secretory pathway and may occur concomitantly with secretion. MUC2 is stored in secretory granules of intestinal goblet cells until released.
MUC2 is the major molecular component of the inner and outer mucosal layers of the intestinal tract (34). The mammalian intestinal mucosa undergoes constant and rapid renewal throughout life. Intestinal epithelial cells begintheir existence as the daughter cells of a minority stem cell population located approximately four cell positions from the base of the intestinal crypts. These cells differentiate into enterocytes,Paneth cells, enteroendocrine cells, and the mucus-producing goblet cells. The mucosal and epithelial layers of the intestinal tract aid in absorption of food and water, protect against intestinal pathogens (35), and prevent an inappropriate immune response against commensal bacteria (36). In intestinal goblet cells, MUC2 assembly begins in the endoplasmic reticulum (ER) with dimerization of MUC2 subunits and N-glycosylation (14). Subsequently, MUC2 is transferred to the Golgi where it is O-glycosylated (see Protein Prediction)(FIgure 3). Further oligomerization appears to occur late in the secretory pathway and may occur concomitantly with secretion (16). MUC2 is stored in secretory granules in intestinal goblet cells and rapidly released at the apical surface in response to mucin secretagogues such as cholinergic stimulation (37). Unregulated MUC2 secretion also occurs and depends upon continuous transport of mucin granules from Golgi vesicles to the cell surface (38). Although both intestinal mucus layers contain mucin as the primary component, the inner layer is denser and devoid of bacteria. The outer layer is looser, has an expanded volume due to MUC2 proteolytic cleavages, and is colonized by commensal bacteria (34).
 
Because the intestinal mucosal layer plays a critical role in immune defense and protection against commensal bacteria, the disruption of the intestinal mucus layer and epithelium can result in intestinal bowel disease (IBD; OMIM #266600). IBD is a chronically recurring inflammatory disorder of the intestine, and results from excessive and sustained inflammatory host immune responses against antigens of commensal intestinal microbes. The clinical appearance of IBD is heterogeneous, and can include diarrhea, abdominal pain, rectal bleeding, fever, weight loss, and signs of malnutrition. Crohn’s disease (CD) and ulcerative colitis (UC) are the two major forms of IBD. Crohn’s disease can affect any part of the gastrointestinal tract, most frequently the terminal ileum and colon. In contrast, UC exclusively affects the mucosal lining of the colon and rectum (36). MUC2 polymorphisms are associated with the development of CD (21). Moreover, IBD patients often show alterations in mucin composition, including decreases in MUC2 expression, abnormal expression of other mucins, as well as differences in the glycosylation and sulfation of MUC2 (18;21;39;40). The excessive inflammation that occurs in IBD may lead to upregulation of MUC2 as MUC2 is regulated in vitro by a variety of inflammatory mediators including NF-κB, an important effector of the immune system (3;21)
 
Although not a major component of bronchial mucus (27;28), MUC2 may also play a role in the development of chest diseases such as cystic fibrosis (CF; OMIM #219700), and asthma (OMIM #600807) as upregulation of MUC2 gene transcription occurs in these diseases (41;42).  However, the presence of MUC2 protein remains very low in the bronchial secretions of patients with disease (27;28), although this could be due to the insolubility of the MUC2 glycosylated protein.   
 
Targeted inactivation of the murine Muc2 gene resulted in the spontaneous development of intestinal tumors (43), and on certain genetic backgrounds, the development of chronic inflammation and colitis (44). In humans, inflammation due to chronic ulcerative colitis is correlated with a significantly increased incidence of colon tumors (2)Muc2-/- mice lacked morphologically distinguishable goblet cells, although the goblet cell lineage remained intact. Muc2 knockout mice also exhibited increased proliferation, decreased apoptosis and increased migration of epithelial cells along the intestinal crypts. Two missense mutations in murine Muc2 also resulted in the development of ulcerative colitis in mice, although the mechanism behind the development of disease in these animals appears to be somewhat different than complete lack of the protective mucus layer (26) (see Putative Mechanism). In addition, mice lacking the enzyme responsible for appropriately glycosylating MUC2, and mice lacking an enzyme catalyzing the formation of MUC2 disulfide bonds lacked MUC2 protein and were susceptible to DSS-induced colitis (45;46).
 
The role of MUC2 as a potential tumor suppressor contrasts with the high expression of MUC2 in many epithelial cancers (29). Subsequent studies suggest that the expression of MUC2 in certain cancers is associated with a lack of invasiveness (30). Furthermore, MUC2 expression is decreased in some types of colon cancer (31).
Putative Mechanism
The Schlendrian mutation alters a cysteine in the N-terminal D2 domain of MUC2. The susceptibility of Schlendrian mutant mice to low doses of DSS-induced colitis suggests that this residue may affect MUC2 biosynthesis and assembly, perhaps by disrupting the formation of an important disulfide bond. MUC2 trimerization does occur through disulfide bond formation in the D3 domain of MUC2 (16), but a similar role for D2 has not been demonstrated. 
 
In mice with missense mutations in Muc2, the development of colitis resulted from the aberrant oligomerization and subsequent accumulation of MUC2 in the ER, which lead to ER stress, triggering of the unfolded protein response (UPR), subsequent inflammation and goblet cell apoptosis (26). These mutations resulted in amino acid changes in either the MUC2 D3 domain or the C-terminal D4 domain, further demonstrating the importance of the D domains in MUC2 function and assembly. Several recent reports provide evidence for a causal role for ER stress in IBD. Mice lacking IRE1β, an ER stress sensor expressed in intestinal epithelial cells, are more susceptible to DSS-induced colitis relative to wild type mice (47).  These mice exhibit increased levels of the ER chaperone GRP78 in the colonic mucosa, indicative of ER stress.  Mice lacking XBP1, a UPR response protein activated by IRE1, in intestinal epithelial cells display a loss of secretory Paneth cells and goblet cells in the intestinal epithelia, as well as spontaneous inflammation in the ileum (48). Elevated levels of GRP78 and CHOP, and IRE1 hyperactivation in the small intestine were also detected in these mice.  In addition, single nucleotide polymorphisms (SNPs) in the XBP1 locus have been correlated with IBD in humans (48). Finally, mice with a missense mutation in Mbtps1 encoding the Site I protease (S1P), also demonstrate increased susceptibility to DSS-induced colitis (49) (see the record for woodrat). In response to ER stress, S1P cleaves the ATF6 transcription factor, which then activates transcription of UPR target genes such as XBP1 and GRP78 (50).
 
We have not demonstrated that the Schlendrian mutation results in MUC2 accumulation in the ER. It is also possible that the Schlendrian mutation results in complete lack of MUC2 protein, which can also result in the development of colitis (44). However, unlike Muc2-/- mice, the Schlendrian mutation is semidominant, suggesting the presence of aberrant protein. It is also possible that secretion of MUC2 in Schlendrian animals will result in alterations of the intestinal mucus layer. Changes in mucus formation may result in inability to bind to molecules such as trefoil factors or sequester important bioactive molecules. Mice with defects in TFF3, TGF-α and the EGF receptor (see the record for Velvet) all develop severe colitis after exposure to DSS (17;51;52).
Primers Primers cannot be located by automatic search.
Genotyping
Schlendrian genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Schlen(F): 5’- TCCTGAACTGCTGCCAGTCAAC -3’
Schlen(R): 5’- TGGACCAGGCTCCCTTTCACAAAC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Schlen_seq(F): 5’- CTCTGTGGAAACTTCAATGGC -3’
Schlen_seq(R): 5’- TGTCCTTGACAAGCCAGTG -3’
 
The following sequence of 1107 nucleotides (from Genbank genomic region NC_000073 for linear DNA sequence of Muc2) is amplified:
 

 
			4800                                                                 t
4801 cctgaactgc tgccagtcaa cagagccagc tgagattcgg acagcctaag agtctgggca
4861 aggagaggcc ttgtgtcctc aggcagactc tattcttggg tccctgctag tggaaggggg
4921 tggtgggcat gtcaccccat agtatggtgg aaccaaggag ccctgcagcc tttcaccatg
4981 tccttccttg tcttatagcc agcttctcca tcttccaacc ctcctcctac cacattgttg
5041 tgaacacgaa gttcgggctg cggctgcaga tccagttgct tccagtcatg cagctttttg
5101 tgactctgga ccaggctgcc cagggacagg tgcagggtga gtggctctct cctgtcttgt
5161 ctctgaaaaa tccccatgag ggtcctattt ttttccccca cccccaggtt cttcctaatc
5221 ctgtcctggc cctttaggtc tctgtggaaa cttcaatggc ctagagagtg atgacttcat
5281 gacgtctggt ggaatggtgg aggccaccgg tgctggcttc gccaatacct ggaaggccca
5341 atcaagctgc cacgacaagc tggactggct agatgacccc tgctccctca acattgagag
5401 tggtaaggct caggagaagc tggttgctgt ccactggctt gtcaaggaca cacaatcctg
5461 acagtccagc ctcagagcag atggggctcc tgatgaagac ataggatgtg ggtgaggagt
5521 gggtgtaggt cacatggcct atggtgctgg gatcagcaca tttacctgct gtttcagttg
5581 acagtggccc catggtggca gcattccagg tgacaaagta aatggactgg gcaggctaac
5641 tgctgggtgg tggctctcat ctcggcctgg cttaatgcta ggatgacatg cccttctatc
5701 catttctcca tcatatctgt ggatttctag ccccttgggg tcgaaaaagg gagaggtggg
5761 tgttatgcag aaaggtctca tcttgttcat agctgcctgg agttatgaag aaaggggtct
5821 ggctttggtc acccaggaga ccatgtcacc tccatcctgg gtgatcagac tttaggctca
5881 gggtttgtga aagggagcct ggtcca 
			PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsKatharina Brandl, Bruce Beutler
Edit History
06/23/2011 8:55 AM (current)
06/10/2011 4:26 PM
06/10/2011 4:18 PM
12/16/2010 11:43 AM
12/01/2010 2:13 PM
10/14/2010 1:41 PM
10/14/2010 1:15 PM
08/10/2010 10:49 AM
08/10/2010 10:47 AM
08/10/2010 10:47 AM
02/03/2010 4:41 PM