Phenotypic Mutation 'bronze' (pdf version)
List |< first << previous [record 40 of 511] next >> last >|
Allelebronze
Mutation Type missense
Chromosome10
Coordinate87,570,226 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Pah
Gene Name phenylalanine hydroxylase
Synonym(s) AW106920, OTTMUSP00000027786, PH, PKU, PKU1
Chromosomal Location 87,521,795-87,584,136 bp (+)
MGI Phenotype Homozygotes for ENU-induced mutations of this gene have altered serum and urine phenylalanine levels and may display reduced body size, microcephaly, microphthalmia, decreased litter size, hypopigmentation, impaired balance/swimming, cognitive deficits, and environmentally-induced seizures.
Accession Number

NCBI RefSeq: NM_008777; MGI: 97473

Mapped Yes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Ref Sequences
L242P in Ensembl: ENSMUSP00000020241 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:ACT 35 103 2.2e-4 PFAM
Pfam:Biopterin_H 119 450 1.4e-187 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000020241)
Phenotypic Category behavior/neurological, homeostasis/metabolism, pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(3) : Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Pah APN 10 87578893 missense probably benign 0.00
IGL00823:Pah APN 10 87570331 missense probably damaging 1.00
IGL01350:Pah APN 10 87578359 splice donor site probably benign 0.00
IGL01668:Pah APN 10 87578261 missense probably damaging 0.99
IGL01794:Pah APN 10 87578922 missense possibly damaging 0.46
IGL01956:Pah APN 10 87538199 missense probably benign 0.01
IGL01985:Pah APN 10 87578982 missense probably benign 0.04
IGL02014:Pah APN 10 87581927 missense probably benign 0.00
IGL02552:Pah APN 10 87578845 splice site 0.00
IGL03096:Pah APN 10 87538242 missense probably benign 0.00
R0238:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0839:Pah UTSW 10 87522062 missense probably benign 0.21
R0853:Pah UTSW 10 87576218 splice donor site probably null
R1474:Pah UTSW 10 87578313 missense probably damaging 1.00
R1762:Pah UTSW 10 87567468 missense possibly damaging 0.91
R1886:Pah UTSW 10 87528328 missense probably benign 0.00
R2016:Pah UTSW 10 87570351 splice donor site probably benign
R2060:Pah UTSW 10 87567265 splice acceptor site probably benign
R2179:Pah UTSW 10 87567335 missense probably damaging 1.00
R2852:Pah UTSW 10 87567465 missense probably damaging 1.00
R3818:Pah UTSW 10 87522004 start gained unknown
R4509:Pah UTSW 10 87576215 unclassified probably null
R4725:Pah UTSW 10 87554376 missense probably damaging 1.00
R4911:Pah UTSW 10 87570267 missense probably benign 0.42
R5094:Pah UTSW 10 87538219 nonsense probably null
R5766:Pah UTSW 10 87567347 missense probably damaging 1.00
Z1088:Pah UTSW 10 87571291 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 031810-MU
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 09/15/2009
Phenotypic Description
Figure 1. Homozygous bronze and wild type mice over 5 weeks of age. Note the different extents of hypopigmentation in bronze mice. The top left mouse in (B) is undergoing a seizure.

First observed in an ENU-mutagenized G3 female, the bronze phenotype is characterized by hypopigmentation of the fur, mild micropthalmia, and reduced body size. Although the fur of homozygous mice is black at birth, it becomes brown by approximately 5 weeks of age (Figure 1).  Different mice show varying degrees of hypopigmentation. Homozygotes older than 6 months of age experience seizures if startled and after handling.

Nature of Mutation
The bronze mutation was mapped to Chromosome 10, and corresponds to a T to C transition at position 947 of the Pah cDNA, in exon 7 of 13 total exons.
 
931  TGTACTGGTTTCCGCCTCCGTCCTGTTGCTGGC
237  -C--T--G--F--R--L--R--P--V--A--G-
 
The mutated nucleotide is indicated in red lettering, and results in a leucine to proline substitution at amino acid 242 of the Pah protein.
Protein Prediction
Figure 2. (A) Phenylalanine hydroxylase (PAH) catalyzes the hydroxylation of phenylalanine to tyrosine in the major pathway of L-Phe catabolism. (B) In the minor pathway, transaminoases of broad specificity catalyze the transfer of the NH2 group from phenylalanine to α-ketoglutarate, yielding glutamate and phenylpyruvuc acid, which may be further metabolized (not shown).

Figure 3. Domain structure of mouse PAH. PAH contains three domains, an N-terminal regulatory domain, catalytic domain, and a C-terminal tetramerization domain (TD). The location of the bronze mutation is indicated in the catalytic domain.
Phenylalanine hydroxylase (PAH) belongs to the family of tetrahydrobiopterin-dependent aromatic amino acid hydroxylases (AAHs), which includes tyrosine hydroxylase (TH) and tryptophan hydroxylase (TPH). TH and TPH both contribute to the synthesis of neurotransmitters, catalyzing the first step in the biosynthesis of catecholamines and serotonin, respectively. PAH provides the major route for catabolic degradation of dietary L-Phe, converting the essential amino acid L-phenylalanine (L-Phe) into L-tyrosine. The hydroxylation reaction carried out by PAH (Figure 2A) requires iron, molecular oxygen (O2), and the non-protein cofactor 6(R)-L-erythro-5,6,7,8-tetrahydrobiopterin (BH4), all three of which must bind before catalysis occurs. Iron is required for the formation of reaction intermediates, including the hydroxylating intermediate formed by BH4 (1). Molecular oxygen is the source of the oxygen atoms incorporated into BH4 to form pterin 4a-carbinolamine (4a-hydroxypterin), and into phenylalanine to form tyrosine (2;3). The ubiquitous BH4 is a cofactor for all three AAHs, as well as for other proteins such as nitric oxide synthase in the conversion of nitrogen to nitric oxide (4). BH4 is generated de novo from GTP via a dedicated biosynthetic pathway, and recycled enzymatically following its function as a cofactor. Transamination to phenylpyruvic acid is the minor route for catabolism of L-Phe (Figure 2B).
 
The human and mouse PAH proteins are 92% identical, and consist of 452 and 453 amino acids, respectively. Much of the research on phenylalanine hydroxylase has been carried out with the human protein and the discussion here will pertain to human PAH unless indicated. PAH exists in a pH-dependent equilibrium of homotetramers and homodimers (5). Like the other AAHs, PAH contains three domains, an N-terminal regulatory domain (amino acids 1-142), catalytic domain (amino acids 143-410), and a C-terminal tetramerization domain (amino acids 411-452) (Figure 3). The protein sequences of the catalytic domains of the three AAHs are highly conserved, but the regulatory domains are relatively more divergent (less than 14% sequence identity), reflecting different mechanisms of regulation. The crystal structures of several truncated forms of PAH have been solved [(6-11) and reviewed in (12)].  When the catalytic domains of these structures are superimposed, a composite full-length structural model can be constructed (13).
 
Figure 4. Structure of the PAH catalytic (green) and regulatory (pink) domains. Iron (gray sphere) is located in the active site, which is covered by the autoregulatory sequence (ARS, yellow). The location of the bronze mutation is indicated. UCSF Chimera model based on PDB 1PHZ, Kobe et al, Nat. Struct. Biol. 6, 442-448 (1999). This image is interactive. Click on the 3D structure to view it rotate.
The regulatory domain of PAH consists of an α-β sandwich core and an N-terminal autoregulatory sequence (ARS, amino acids 19-33) that extends over the active site pocket in the inactive form of the enzyme (Figure 4; PDB ID 1PHZ) (10). Removal of the regulatory domain by either limited proteolysis or mutation results in a fully activated enzyme (14-17). Phenylalanine bound to the catalytic domain is required for catalysis, but in addition activation of PAH is regulated by phenylalanine binding to the regulatory region. This event results in a relative rotation of the regulatory and catalytic domains that moves the ARS away from the active site via a hinge at Gly33 (10). Phosphorylation also activates PAH (18-20), and has been shown to occur in vitro on serine 16 of the regulatory domain through the action of cyclic AMP-dependent protein kinase (PKA) (21). Phosphorylation has been reported to increase Vmax of the hydroxylation reaction 3-4-fold (19;20), and to reduce the concentration of phenylalanine required for PAH activation, although the mechanism is unknown (22). Conversely, phenylalanine binding increases the propensity of PAH to be phosphorylated, indicating that these two activation mechanisms can synergize (22).
 
Figure 5. Structure of the PAH catalytic domain. Iron (gray sphere) is located in the active site and is coordinated to His285 (yellow), His290 (cyan), and Glu330 (orange). The pink and purple protein represents part of the N-terminal regulatory domain and the tetramerization domain, respectively. The location of the bronze mutation is indicated. UCSF Chimera model based on PDB 1PAH, Erlandsen et al, Nat. Struct. Biol. 4, 995-1000 (1997). This image is interactive. Click on the 3D structure to view it rotate.
Flexibly linked to the N-terminal regulatory domain is the catalytic domain, which forms a basket-like structure containing 13 α-helices and 8 β-strands (Figure 5; PDB ID 1PAH) (12). The active site is in a deep pocket 10 Å wide and 13 Å deep formed by α-helices, and is located in the center of the catalytic domain. Substrate access to the active site may be provided by a channel 8 Å wide and 16 Å deep located adjacent to the active site. A crystal structure of the PAH catalytic domain bound to both BH4 and the substrate analog β-thienylalanine reveals differences from the structure of enzymes with only the pterin bound (7). In particular, an overall compression of the entire catalytic domain is observed, along with a major conformational change in a loop consisting of residues 131-150 that brings it over the active site. 
 
Like the other AAHs, PAH is an iron-dependent enzyme, requiring one iron atom per subunit for activity (23;24). Ferrous iron (Fe2+) is required for the hydroxylation reaction and is found in the active site at the start and finish of each catalytic cycle. The iron atom (Fe3+ in the form isolated for structural studies) is located on the floor of the active site, at the intersection of the channel and the active site pocket. It is coordinated by His285, His290, an oxygen atom in Glu330 (12;25), as well as three water molecules, all of which are arranged in an octahedral geometry. Hydroxylation by PAH also requires the cofactor BH4, which binds close to the catalytic iron and packs against a flexible loop formed by residues 247-251 (8;9).  Most of the interactions are with the pyrimidine ring of the pterin, which also forms an aromatic π-stacking interaction with Phe254. BH4 hydrogen bonds with two of the water molecules coordinated to the iron atom, with Ala322, Gly247, Leu249, and Ser251; Glu286 forms the only electrostatic interaction between PAH and BH4.  A large conformational change occurs upon binding of BH4 to PAH, in which residues 245-250 move towards the iron. In this position, O2 can form a bridge between iron and the pterin during the hydroxylation reaction. In addition to its interaction with the catalytic domain, BH4 also binds to the regulatory domain of PAH, serving to negatively regulate enzyme activity (26;27). In this role, BH4 competes with phenylalanine for binding to the regulatory domain to form a dead-end complex.
 
The C-terminal 42 amino acids comprise the tetramerization domain, and a PAH crystallizes as a tetramer (dimer of dimers) when this domain is present (11). The tetramerization domain contains two β-strands and an α-helix 40 Å in length (amino acids 428-452) that makes the coiled-coil interaction critical for tetramer formation (28). α-helices from four monomers pack into a tight antiparallel coiled-coil in the center of the tetramer.
 
The bronze mutation in leucine 242 is located at the center of the catalytic domain, within a β-strand approximately 8-10 Å from the active site iron atom. Leucine 242 is not part of the active site.
Expression/Localization
Northern blot analysis demonstrates that PAH transcript is most highly expressed in the liver, and at lower levels in the kidney, pancreas, and brain (29;30). Enzyme assay confirms PAH activity in the liver and kidney. In mice and rats, immunohistochemical analysis and enzyme assay identify Pah in the liver (hepatocytes) and at lower levels in the kidney (renal epithelial cells) (31;32). Low Pah activity is also detected in mouse pancreas (31;33) and rat brain (34). The expression of Pah in rodent liver is developmentally regulated such that it is first observed at low levels around embryonic days 17-18, and then dramatically upregulated within one week after birth (31;32). PAH is localized in the cytosol.
Background
PAH catalyzes the hydroxylation of L-Phe to L-Tyr, the rate-limiting first step in the catabolic pathway leading to the complete oxidation of L-Phe to carbon dioxide and water. The catalytic mechanism of hydroxylation is believed to involve formation of a hydroxylating intermediate followed by oxygen transfer to the amino acid substrate (35). Kinetic and computational analyses support peroxy-pterin and Fe(IV)O-enzyme reaction intermediates, respectively, for each of these steps (1), however no intermediates have yet been captured for direct structural analysis, and thus the proposed reaction mechanism remains to be proven.
 
The catabolic pathway initiated by PAH in the liver and kidney accounts for at least 75% of the disposal of dietary phenylalanine. Deficiencies in the PAH pathway result in activation of the typically minor pathway for transamination of phenylalanine to phenylpyruvic acid, an α-keto acid. This and other metabolites of phenylalanine (phenyl lactate, phenylacetate, phenylethylamine, phenylacetyl glutamine) are excreted through the urine. Mutations in human PAH result in the recessively inherited disease hyperphenylalaninemia (high levels of phenylalanine in the blood). Severe forms of the disease are called phenylketonuria (PKU; OMIM #261600), first described in Norway in 1934 as “oligophrenica phenylpyruvica” [reviewed in (36;37)]. The essential feature of the disease was the urinary excretion of large amounts (about 1 gram per day) of phenylpyruvic acid, detected by adding a few drops of 5% ferric chloride solution to the urine and observing the development of a deep blue-green color. Mental retardation was almost always associated with the metabolic phenotype. The name phenylketonuria was proposed by Penrose in 1937 (38). In 1947, the metabolic defect was ascribed to an inability to oxidize phenylalanine to tyrosine (39), and in 1953, a deficiency in hepatic PAH activity was demonstrated in a patient (40). It was shown that the metabolic phenotype could be treated by dietary restriction of phenylalanine, with the potential to prevent mental retardation (41). To facilitate early detection, a blood test for PKU in newborns was developed in 1961 (42), and is now routinely administered to neonates in the United States and many other countries.
 
The pathologic changes in the brains of PKU patients are of two primary types (43). First, arrest or delay in the development of cortical neurons, and changes in the numbers of cortical neurons are thought to result in dysfunction of the late maturing regions of the neocortex. Mental retardation and seizures may be clinical manifestations of such defects. Similar findings have been reported in rodent models of PKU (44). White matter abnormalities such as spongy myelin, pale myelin staining, and demyelination are routinely observed (unlike cortical lesions) and constitute the second type of pathology observed in PKU brains.  It has been hypothesized that elevated levels of phenylalanine are toxic to myelination (45). One proposed mechanism is that high levels of phenylalanine, through inhibition of the enzyme 3-hydroxyl-3methylglutaryl-coenzyme A reductase (HMGR; required for cholesterol biosynthesis), may prevent the production of myelin by oligodendrocytes (46-48). Cholesterol comprises 30% of myelin lipids and must be synthesized locally in the brain. Since myelin is critical to both axonal development and neurotransmission, an inability to produce or maintain myelin may lead to the neuronal dysfunction and mental retardation observed in PKU.
 
In addition to mental retardation, untreated classical PKU is characterized by an accentuation of all reflexes, epileptic seizures, and hyperkinetic behavior or spasticity (37;49). Physical characteristics include small stature, reduced head size, widely spaced incisor teeth, eczema, kyphosis, a ‘mousy’ odor, and sometimes excessive sweating. Light colored hair and eyes are also common due to impaired melanin production, which requires tyrosine (see record for ghost). Treatment involves restoration of blood phenylalanine levels to normal values as early in postnatal life and for as long as possible. The primary therapy is close monitoring of blood plasma L-Phe combined with dietary restriction of phenylalanine, found in high-protein foods such as milk, eggs, nuts, beans, chicken, beef, and fish. Dietary supplementation with phenylalanine-free formula may be used to provide essential nutrients required for development.  However, even with early treatment, mildly depressed IQ is common in PKU (50). Some cases of PKU (~30% of classic PKU, and up to 70% of mild PKU), depending on the particular PAH allele, also respond to treatment with pharmacological doses of BH4 (51;52). A chaperone-like effect of BH4 on enzyme stability, increased binding of BH4 in the catalytic domain, and restoration of optimal concentrations of BH4 in hepatocytes may all contribute to the therapeutic effect (53;54).
 
The human gene encoding PAH was cloned in 1983 (55), and mutations in the gene are now known to account for 99% of all cases of hyperphenylalaninemia (HPA) (56). The remaining 1% result from mutations in genes encoding the enzymes responsible for BH4 biosynthesis. Extensive screening of newborns has revealed that a range of phenotypes exists, from the severe classical PKU to moderate PKU, mild PKU, and non-PKU HPA, for which the risk of impaired cognitive development is low. The prevalence of HPA (both PKU and non-PKU) is about 1 in 10,000 live births among European and Oriental Asian populations, while the incidence is less than 1 in 100,000 among sub-Saharan Africans and their descendants (57).  Approximately 550 mutations in the PAH gene, identified by researchers internationally and reported in published articles or direct submissions, are currently recorded in the Phenylalanine Hydroxylase Locus Knowledgebase (PAHdb) (www.pahdb.mcgill.ca), although as few as six alleles account for 60% of all disease-causing alleles within certain ethnic populations.  The majority are relatively rare alleles. Missense mutations are the most common type of mutation (61%).
 
To further study PAH in vivo, three ENU-induced Pah-deficient mouse strains were generated and found to recapitulate human HPA disease. All three mouse alleles are recessive.  Pahenu1 (also known as Pahhph5) causes a relatively mild phenotype similar to non-PKU HPA, with only slightly elevated levels of phenylalanine in the blood, and a reduced ability to clear a 1 mg/g intraperitoneal phenylalanine challenge (clearance within 6 hours versus 2 hours in control mice) (58;59). The Pahenu1 mutation is a T to C transition at nucleotide 364 in exon 3, resulting in a valine to alanine substitution at amino acid 106 (60). Although the mutation is associated with reduced Pah protein levels, the conservative nature of the amino acid change apparently permits sufficient residual activity to prevent severe HPA. A second ENU-induced mutation, Pahenu2, causes a classical PKU phenotype with serum phenylalanine and urinary ketone concentrations elevated 15.4-fold and 15-40-fold, respectively, over those of wild type mice (58). Homozygous Pahenu2 mice also display hypopigmented fur, reduced head size, and behavioral abnormalities beginning at 2 weeks of age. The mutation is a T to C transition at nucleotide 835 in exon 7 (the most frequently mutated exon in human PAH), resulting in a phenylalanine to serine substitution at amino acid 263 (60). Pahenu2 protein is detectable in liver extracts from homozygous mutants, but retains no catalytic activity (58). The third mutant allele, Pahenu3, results in a phenotype similar to that of Pahenu2 mice (58)Pahenu3 is a T to G transversion in the splice donor site of Pah intron 11 (61). The mutation induces usage of two cryptic splice donor sites, one 5 bp upstream and one 5 bp downstream of the normal splice site, both resulting in coding frameshifts and premature termination. No protein is detected in liver extracts from Pahenu3 homozygotes. These three Pah-deficient strains continue to be used for studies of phenylalanine metabolism in vivo.
Putative Mechanism
Figure 6. Hypothesized effect of mutations on PAH protein folding.  Mutations in PAH may result in a greater proportion of misfolded proteins, leading to degradation.  Figure adapted from (64).
75% of individuals with PKU in mixed populations are not homozygous for a single variant allele, but heterozygous for two different alleles that in combination give rise to elevated phenylalanine levels (62). In light of this, correlating genotype with phenotype becomes complicated, and some 10-50% of diploid genotypes expected to result in disease do not do so (63). Positioning the many known mutations within the 3D structure of PAH demonstrates a distribution in all domains of the protein (13)In vitro expression of mutant PAH alleles using a variety of systems has been carried out to understand how mutated residues affect PAH activity and impact the severity of HPA [reviewed in (64)]. These studies have revealed the whole spectrum of possible mutation effects, from aberrant oligomerization and accelerated turnover of mutant proteins, to reduced catalytic activity and impaired binding of phenylalanine to the regulatory domain. Most mutations, however, appear to result in a reduction of activity that correlates with a corresponding decrease in protein expression level but normal mRNA levels. One hypothesis, supported by the finding that many mutant PAH proteins tend to form aggregates when expressed in E. coli or in vitro translation systems (65-67), is that these mutations cause protein misfolding leading to degradation, and therefore reduced steady-state protein levels.
 
The human PAH mutation L242F has been reported in a single PKU patient among a group from West Germany and Bulgaria (68). The bulky phenylalanine residue may disrupt protein folding and lead to degradation. A similar situation likely occurs in bronze mice containing the L242P mutation. Leucine 242 exists in the middle of a β-strand, and substitution with proline is predicted to disrupt this secondary structure. Notably, a mutant PAHR243Q protein retains less than 10% of wild type activity when expressed in COS cells (69).
Primers Primers cannot be located by automatic search.
Genotyping
Bronze genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
Primers
bronze (F): 5’-TGTGAGGTTACATGACCCAAAGCAG -3’
bronze (R): 5’- GGAGATGCTGAGATCACTTGGCTAC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
bronze_seq(F): 5’- TGCAACCTGGTAATACTGATCC -3’
bronze_seq(R): 5’- CCAAATCCTTGGTTCACAGGATG -3’
 
The following sequence of 745 nucleotides (from Genbank genomic region NC_­­­­­000076 for linear genomic sequence of Pah, sense strand) is amplified:
 
47931                                                        tgtgaggtta
47941 catgacccaa agcagtaggg gggttgtagt ctctctggat ttaccataag gcttacaatt
48001 ctcaaccttc ctaatgctgc aacctggtaa tactgatcct catgttgtgg tgaccaccaa
48061 ccacaaaatt actttgttgc tactttataa ctgcaatttt gctattctta tgaatcataa
48121 catttgattt atttgatatg caggatatct aaggtgccac ccccttgggg agtcatacct
48181 cacaggttgt aaaccactta taaaaagcct tgagttttag gttcttttct gctttccagc
48241 ttgtactggt ttccgcctcc gtcctgttgc tggcttactg tcgtctcgag atttcttggg
48301 tggcctggcc ttccgagtct tccactgcac acagtacatt aggcatggat ctaagcccat
48361 gtacacacct gaaccgtaag tatcattctt cagctacccc tgccaaccac aatggatgct
48421 caaagaatgc tgatcaggct cattgcaggc tggtccccat gatccactgc ctgctttatt
48481 tgatcatagt cctaaaggaa actcatactc tgtgaatttt ctctgtccaa atagatgaaa
48541 tttggactca cagagctgga catcctgtga accaaggatt tggaactctt tgagtaccag
48601 gaaaagggat tccatcaagc tccaatgttc caaataggac aggaacaaga gtagccaagt
48661 gatctcagca tctcc
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Bruce Beutler
List |< first << previous [record 40 of 511] next >> last >|
Edit History
08/31/2011 7:35 PM (current)
08/31/2011 7:33 PM
08/31/2011 7:23 PM
08/31/2011 6:00 PM
08/31/2011 5:58 PM
08/31/2011 5:49 PM
08/31/2011 5:44 PM
08/31/2011 5:43 PM
08/31/2011 5:42 PM
08/31/2011 5:36 PM
08/31/2011 5:36 PM
08/31/2011 5:33 PM
01/28/2011 6:53 PM
01/13/2011 8:19 AM
01/11/2011 3:35 PM
01/11/2011 1:33 PM
01/11/2011 1:32 PM
01/11/2011 1:30 PM
01/11/2011 1:15 PM
12/23/2010 11:52 AM
02/03/2010 5:35 PM