Phenotypic Mutation 'dysfunctional'

• Allele: dysfunctional
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 101,474,629 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Rag1
• Gene Name: recombination activating 1
• Synonym(s): Rag-1
• Chromosomal Location: 101,468,627-101,479,846 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in activation of immunoglobulin V-D-J recombination. The encoded protein is involved in recognition of the DNA substrate, but stable binding and cleavage activity also requires RAG2. Defects in this gene can be the cause of several diseases. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Proline changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000077584]
• AlphaFold: P15919
• PDB Structure: RAG1 DIMERIZATION DOMAIN [X-RAY DIFFRACTION] ; Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION] ; Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION] ; Crystal structure of the core RAG1/2 recombinase [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000077584; Gene: ENSMUSG00000061311; AA Change: P171L

Domain	Start	End	E-Value	Type
Pfam:RAG1_imp_bd	11	288	5.7e-120	PFAM
RING	290	328	1.39e-3	SMART
ZnF_C2H2	353	376	2.61e1	SMART
PDB:3GNB|A	389	464	3e-44	PDB
ZnF_C2H2	725	750	7e1	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000078494)
• Meta Mutation Damage Score: 0.8409
• Is this an essential gene?: Possibly nonessential (E-score: 0.391)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:28 PM by Diantha La Vine
• Record Created: 2019-02-14 5:18 AM by Bruce Beutler
• Record Posted: 2019-02-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009019; MGI: 97848

Alleles Listed at MGI

All Mutations and Alleles(23) : Chemically induced (ENU)(4) Chemically induced (other)(1) Endonuclease-mediated(4) Radiation induced(1) Targeted(13)

Phenotypic Description

Figure 1. Dysfunctional mice exhibit increased frequencies of peripheral central memory CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The dysfunctional phenotype was identified among G3 mice of the pedigree R6679, some of which showed increased frequencies of central memory CD8 T cells (in CD8 T cells) in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased central memory CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 45 mutations (X-axis) identified in the G1 male of pedigree R6679. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 45 mutations. The central memory CD8 T cell phenotype was linked by continuous variable mapping to a mutation in Rag1:  a C to T transition at base pair 101,644,284 (v38) on chromosome 2, or base pair 5,249 in the GenBank genomic region NC_000068. Linkage was found with a recessive model of inheritance, wherein 11 variant homozygotes departed phenotypically from 23 homozygous reference mice and 23 heterozygous mice with a P value of 1.161 x 10^-6 (Figure 2).  

The mutation corresponds to residue 637 in the mRNA sequence NM_009019 within exon 2 of 2 total exons.

621 GTTGACTCCATCCACCCGACGGAATTCTGCCAT 166 -V--D--S--I--H--P--T--E--F--C--H-

The mutated nucleotide is indicated in red. The mutation results in a proline to leucine substitution at position 171 (P171L) in the RAG1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 3. Domain structure of RAG1. The positions of catalytic triad residues are shown above the diagram. The central domain contains binding sites for the RSS heptamer and for RAG2, as well as a zinc finger motif (ZFB, hatched box). The C-terminal domain (C-term) binds DNA in a non-sequence-specific manner, and may mediate dimerization. The dysfunctional mutation results in a proline to leucine substitution at position 171. ZDD, zinc-binding dimerization domain; RING, RING finger domain; ZFA, C₂H₂ zinc finger motif A; NBR, nonamer binding region; ZFB, zinc finger motif B. This image is interactive. Other mutations found in RAG1 are noted in red. Click on the mutations for more specific information.  

The recombination activating gene 1 (RAG1) and RAG2 (see the record for snowcock) proteins carry out the first enzymatic step of V(D)J recombination, the process by which the variable region of antigen receptor genes is assembled in developing B and T lymphocytes. Mouse RAG1 consists of 1040 amino acids (Figure 3). However, deletion of 383 amino acids from the N-terminus and 32 amino acids from the C-terminus still yields an active protein capable of recombining a plasmid substrate (1;2). 

Recombination of the antigen receptor genes is specifically directed to the coding elements by a recombination signal sequence (RSS) flanking each variable (V), diversity (D), and joining (J) encoding gene segment. The core region of RAG1 contains several domains that mediate binding to RSSs and to RAG2. The N-terminus of core RAG1 (amino acids 384-454 in the full length protein) contains the nonamer-binding region (NBR), which binds to the RSS nonamer (3;4) as well as to the high mobility group proteins HMG1 and HMG2 (5). HMG1, 2 facilitate the bending of RSS DNA between the heptamer and nonamer, and enhance binding of RAG1 to the RSS. X-ray crystallographic studies of the NBR in complex with DNA demonstrate that it forms a dimer that holds closely together two nonamer elements, with each NBR contacting both DNA molecules (PDB ID 3GNA) (6).

Amino acids 528-760 constitute the central domain of core RAG1, which contains a binding site for the RSS heptamer (7).  Also present in the central domain is a classic C₂H₂ zinc finger (amino acids 723-754; designated ZFB) that interacts with core RAG2 (8). The C-terminal portion of core RAG1 (amino acids 761-979) binds to dsDNA in a non-sequence-specific manner cooperatively and with high affinity, and self-associates to form dimers (7).  

The non-core regions of RAG1 (amino acids 1-383 and 1009-1040) influence the catalytic efficiency of V(D)J recombination and the resulting gene products (9;10). Residues 1-264 of RAG1 contain a proposed zinc-binding site, and three basic regions that associate with SRP1 (suppressor of RNA polymerase 1), a protein that promotes nuclear transport (4;11). Residues 265-380 contain a zinc-binding dimerization domain (ZDD), which encompasses a zinc RING finger motif (amino acids 288-339) and a C₂H₂ zinc finger domain (amino acids 349-378; designated ZFA) (12).  

The dysfunctional mutation results in a proline to leucine substitution at position 171 (P171L); amino acid 171 is within the non-core region of RAG1, which regulates the catalytic efficiency of RAG1.

Please see the record for maladaptive for information about Rag1.

Putative Mechanism

The RAG1 and RAG2 proteins are the only lymphoid-specific factors required for V(D)J recombination, permitting recombination of test substrates when coexpressed in non-lymphoid cells (13). Conversely, mice lacking either RAG1 or RAG2 are completely deficient in V(D)J recombination (14;15). RAG1 and RAG2 are both necessary and sufficient to complete the first phase of V(D)J recombination. First, a complex containing RAG1 and RAG2 binds one RSS. This RAG-RSS complex then captures the second RSS (of the gene segment to be joined) in a process known as synapsis. Within the synaptic complex, RAG1 and RAG2 have been shown to contact both the heptamer and nonamer sequences of an RSS [for a detailed discussion of RAG-RSS contacts see (16)]. Cleavage by RAG1/2 occurs between the RSS heptamer and flanking coding sequence, and proceeds in two steps (17). A nick is made at the 5’ end of the RSS heptamer, leaving a 5’-phosphoryl group on the RSS and a 3’-hydroxyl group on the coding end. The second step is a hairpinning step in which the 3’-hydroxyl on the coding end attacks a phosphodiester bond on the opposite strand, joining the 3’-hydroxyl to the phosphoryl group at the same nucleotide position on the other strand. DNA cleavage is completed within the synaptic complex, as reflected by the requirement for a 12/23 RSS pair at the final hairpinning step (18;19). The product of this first phase of V(D)J recombination is the “cleaved signal complex,” which contains four DNA ends: two blunt 5’-phosphorylated signal ends, and two coding ends terminating in DNA hairpin structures. During the second phase of V(D)J recombination, RAG1 and RAG2 work together with DNA repair proteins to process and ligate coding ends to form a coding joint, and ligate signal ends to form a signal joint.RAG1 itself is required during the process of joint formation, as evidenced by point mutations that prevent joining but do not affect cleavage (20;21). 

Null mutations in RAG1 or RAG2 underlie approximately half of the human T cell-negative, B cell-negative severe combined immune deficiencies (SCIDs; OMIM #601457) (22). Hypomorphic mutations in RAG1 or RAG2 cause Omenn syndrome (OMIM #603554), an autosomal recessive SCID characterized by enlarged lymphoid tissue, severe erythroderma, hypereosinophilia, elevated serum IgE, few B cells, and oligoclonal expansion of T cells. 

The phenotype of the dysfunctional mice indicates some loss of RAG1-associated function. Changes in B cell frequency were not observed, indicating some residual RAG1 function remains.

Primers

PCR Primer
dysfunctional_pcr_F: TTGCTGAGCTGCACATTGGG
dysfunctional_pcr_R: AAGCAGTTCACCAAGCCAGG

Sequencing Primer
dysfunctional_seq_F: CTGCACATTGGGCTGATGTCTC
dysfunctional_seq_R: AGCCAGGCTTAGACACTTCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 403 nucleotides is amplified (chromosome 2, - strand):

1   aagcagttca ccaagccagg cttagacact tctgccgcat ctgtgggaat cgtttcaaga
61  gtgacgggca cagccggaga tacccagtcc acgggcccgt ggacgctaaa acccaaagtc
121 ttttccgaaa gaaggaaaaa agagtcactt cctggccaga cctcattgcc aggattttcc
181 ggatcgacgt gaaggcagat gttgactcca tccacccgac ggaattctgc catgactgtt
241 ggagcatcat gcacagaaag ttcagcagtt cccacagtca ggtctacttc ccaaggaaag
301 tgaccgtgga gtggcacccc cacacaccgt cctgtgacat ctgttttact gcccatcggg
361 gactcaagag gaagagacat cagcccaatg tgcagctcag caa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

   1. Sadofsky, M. J., Hesse, J. E., McBlane, J. F., and Gellert, M. (1993) Expression and V(D)J Recombination Activity of Mutated RAG-1 Proteins. Nucleic Acids Res. 21, 5644-5650.

   2. Silver, D. P., Spanopoulou, E., Mulligan, R. C., and Baltimore, D. (1993) Dispensable Sequence Motifs in the RAG-1 and RAG-2 Genes for Plasmid V(D)J Recombination. Proc. Natl. Acad. Sci. U. S. A. 90, 6100-6104.

 3. Difilippantonio, M. J., McMahan, C. J., Eastman, Q. M., Spanopoulou, E., and Schatz, D. G. (1996) RAG1 Mediates Signal Sequence Recognition and Recruitment of RAG2 in V(D)J Recombination. Cell. 87, 253-262.

 4. Spanopoulou, E., Cortes, P., Shih, C., Huang, C. M., Silver, D. P., Svec, P., and Baltimore, D. (1995) Localization, Interaction, and RNA Binding Properties of the V(D)J Recombination-Activating Proteins RAG1 and RAG2. Immunity. 3, 715-726.

 5. Aidinis, V., Bonaldi, T., Beltrame, M., Santagata, S., Bianchi, M. E., and Spanopoulou, E. (1999) The RAG1 Homeodomain Recruits HMG1 and HMG2 to Facilitate Recombination Signal Sequence Binding and to Enhance the Intrinsic DNA-Bending Activity of RAG1-RAG2. Mol. Cell. Biol. 19, 6532-6542.

 6. Yin, F. F., Bailey, S., Innis, C. A., Ciubotaru, M., Kamtekar, S., Steitz, T. A., and Schatz, D. G. (2009) Structure of the RAG1 Nonamer Binding Domain with DNA Reveals a Dimer that Mediates DNA Synapsis. Nat. Struct. Mol. Biol. 16, 499-508.

 7. Arbuckle, J. L., Fauss, L. A., Simpson, R., Ptaszek, L. M., and Rodgers, K. K. (2001) Identification of Two Topologically Independent Domains in RAG1 and their Role in Macromolecular Interactions Relevant to V(D)J Recombination. J. Biol. Chem. 276, 37093-37101.

 8. Aidinis, V., Dias, D. C., Gomez, C. A., Bhattacharyya, D., Spanopoulou, E., and Santagata, S. (2000) Definition of Minimal Domains of Interaction within the Recombination-Activating Genes 1 and 2 Recombinase Complex. J. Immunol. 164, 5826-5832.

 9. Noordzij, J. G., Verkaik, N. S., Hartwig, N. G., de Groot, R., van Gent, D. C., and van Dongen, J. J. (2000) N-Terminal Truncated Human RAG1 Proteins can Direct T-Cell Receptor but Not Immunoglobulin Gene Rearrangements. Blood. 96, 203-209.

 10. Santagata, S., Gomez, C. A., Sobacchi, C., Bozzi, F., Abinun, M., Pasic, S., Cortes, P., Vezzoni, P., and Villa, A. (2000) N-Terminal RAG1 Frameshift Mutations in Omenn's Syndrome: Internal Methionine Usage Leads to Partial V(D)J Recombination Activity and Reveals a Fundamental Role in Vivo for the N-Terminal Domains. Proc. Natl. Acad. Sci. U. S. A. 97, 14572-14577.

 11. Roman, C. A., Cherry, S. R., and Baltimore, D. (1997) Complementation of V(D)J Recombination Deficiency in RAG-1(-/-) B Cells Reveals a Requirement for Novel Elements in the N-Terminus of RAG-1. Immunity. 7, 13-24.

 12. Rodgers, K. K., Bu, Z., Fleming, K. G., Schatz, D. G., Engelman, D. M., and Coleman, J. E. (1996) A Zinc-Binding Domain Involved in the Dimerization of RAG1. J. Mol. Biol. 260, 70-84.

   13 Oettinger, M. A., Schatz, D. G., Gorka, C., and Baltimore, D. (1990) RAG-1 and RAG-2, Adjacent Genes that Synergistically Activate V(D)J Recombination. Science. 248, 1517-1523.

 14. Mombaerts, P., Iacomini, J., Johnson, R. S., Herrup, K., Tonegawa, S., and Papaioannou, V. E. (1992) RAG-1-Deficient Mice have no Mature B and T Lymphocytes. Cell. 68, 869-877.

 15. Shinkai, Y., Rathbun, G., Lam, K. P., Oltz, E. M., Stewart, V., Mendelsohn, M., Charron, J., Datta, M., Young, F., and Stall, A. M. (1992) RAG-2-Deficient Mice Lack Mature Lymphocytes Owing to Inability to Initiate V(D)J Rearrangement. Cell. 68, 855-867.

 16. Swanson, P. C. (2004) The Bounty of RAGs: Recombination Signal Complexes and Reaction Outcomes. Immunol. Rev. 200, 90-114.

 17. McBlane, J. F., van Gent, D. C., Ramsden, D. A., Romeo, C., Cuomo, C. A., Gellert, M., and Oettinger, M. A. (1995) Cleavage at a V(D)J Recombination Signal Requires Only RAG1 and RAG2 Proteins and Occurs in Two Steps. Cell. 83, 387-395.

 18. van Gent, D. C., Ramsden, D. A., and Gellert, M. (1996) The RAG1 and RAG2 Proteins Establish the 12/23 Rule in V(D)J Recombination. Cell. 85, 107-113.

 19. Yu, K., and Lieber, M. R. (2000) The Nicking Step in V(D)J Recombination is Independent of Synapsis: Implications for the Immune Repertoire. Mol. Cell. Biol. 20, 7914-7921.

 20. Yarnell Schultz, H., Landree, M. A., Qiu, J. X., Kale, S. B., and Roth, D. B. (2001) Joining-Deficient RAG1 Mutants Block V(D)J Recombination in Vivo and Hairpin Opening in Vitro. Mol. Cell. 7, 65-75.

 21. Huye, L. E., Purugganan, M. M., Jiang, M. M., and Roth, D. B. (2002) Mutational Analysis of all Conserved Basic Amino Acids in RAG-1 Reveals Catalytic, Step Arrest, and Joining-Deficient Mutants in the V(D)J Recombinase. Mol. Cell. Biol. 22, 3460-3473.

 22. Schwarz, K., Gauss, G. H., Ludwig, L., Pannicke, U., Li, Z., Lindner, D., Friedrich, W., Seger, R. A., Hansen-Hagge, T. E., Desiderio, S., Lieber, M. R., and Bartram, C. R. (1996) RAG Mutations in Human B Cell-Negative SCID. Science. 274, 97-99.